version
PlantPromoterDB promoter information of AT5G53310.1

Summary of Gene (AT5G53310.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G53310  TAIR      NCBI 
Gene model AT5G53310.1  
Description myosin heavy chain-related; FUNCTIONS IN: motor activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Myosin tail 2 (InterPro:IPR010926); Has 312 Blast hits to 312 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 37; Plants - 16; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 21633657-21634856)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G53310.1                      5'->3' (+)
Promoter sequence



 
AT5G53300.1         
AT5G53300.2         
AT5G53300.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G53310.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+21634626-31

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+21634591-66
TSS cloneAclone+21634600-57
TSS cloneAclone+21634618-39
TSS cloneAclone+21634622-35
TSS cloneCclone+21634648-9

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAACGACGC+2163433221634341-325-316
 AtREG576GAAACGAC   PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG  PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC PPDB Motif  PLACE Motif 
REGGAAACGACATCG+2163437421634385-283-272
 AtREG576GAAACGAC     PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630    CGACATCG PPDB Motif  PLACE Motif 
REGCTAACGGT+2163440521634412-252-245
 AtREG603CTAACGGT PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGAAACGCGT+2163449321634500-164-157
 AtREG633AAACGCGT PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAGCCACGTC+2163456321634572-94-85
 AtREG608AAGCCACG  ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG450 AGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388  GCCACGTC PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA73-21634134AT5G53300.1, AT5G53300.2, AT5G53300.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-21634227AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneTclone-21634226AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneCclone-21634203AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneTclone-21634189AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneCclone-21634186AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneTclone-21634185AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneTclone-21634184AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneCclone-21634182AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneCclone-21634181AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneCclone-21634180AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneCclone-21634179AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneTclone-21634178AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneAclone-21634176AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneGclone-21634175AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneTclone-21634165AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneTclone-21634159AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneAclone-21634153AT5G53300.1, AT5G53300.2, AT5G53300.3
TSS cloneCclone-21634150AT5G53300.1, AT5G53300.2, AT5G53300.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTCTCT-2163415521634168AT5G53300.1, AT5G53300.2, AT5G53300.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCGTCGTTTC-2163433221634341AT5G53300.1, AT5G53300.2, AT5G53300.3
 AtREG439GCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415 CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576  GTCGTTTC PPDB Motif  PLACE Motif 
REGCGATGTCGTTTC-2163437421634385AT5G53300.1, AT5G53300.2, AT5G53300.3
 AtREG630CGATGTCG     PPDB Motif  PLACE Motif 
 AtREG569   TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576    GTCGTTTC PPDB Motif  PLACE Motif 
REGACCGTTAG-2163440521634412AT5G53300.1, AT5G53300.2, AT5G53300.3
 AtREG603ACCGTTAG PPDB Motif  PLACE MotifYAACKG, CNGTTR 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.