version
PlantPromoterDB promoter information of AT5G53490.1

Summary of Gene (AT5G53490.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G53490  TAIR      NCBI 
Gene model AT5G53490.1  
Description thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein.  
#
#

Overview

Focused view (chromosome 5: 21725621-21724422)

Genome position     
from initiation codon
AT5G53490.2         
AT5G53500.1         
TSS from cDNA
TSS information
AT5G53490.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G53490.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-21724639-18

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-21724641-20
TSS cloneAclone-21724638-17
TSS cloneTclone-21724637-16
TSS cloneTclone-21724635-14
TSS cloneAclone-21724633-12
TSS cloneCclone-21724628-7

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGCCACGTCAT-2172469521724706-74-85
 AtREG448ATGCCACG    ABA, DREB1Aox PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388  GCCACGTC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG419   CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG483    CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTCAGGCCCAATGGGCTAA-2172473721724754-116-133
 AtREG374TCAGGCCC           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG461    GCCCAATG       PPDB MotifGCCCA  PLACE Motif 
 AtREG551       CAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372        AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581         ATGGGCTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571          TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTTTAACCG-2172482121724828-200-207
 AtREG645TTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTAATTACG-2172489321724900-272-279
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.