version
PlantPromoterDB promoter information of AT5G53530.1

Summary of Gene (AT5G53530.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G53530  TAIR      NCBI 
Gene model AT5G53530.1  
Description Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport.  
#
#

Overview

Focused view (chromosome 5: 21749156-21747957)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G53530.1                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G53530.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-21748564-408

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-21748565-409
TSS cloneGclone-21748564-408
TSS cloneTclone-21748563-407

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAATGGGCTTG-2174861221748623-456-467
 AtREG443TAAATGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525    TGGGCTTG PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTGGGCTTTG-2174864021748648-484-492
 AtREG376TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559 GGGCTTTG PPDB MotifGCCCA  PLACE Motif 
REGGCCGTTTT-2174867321748680-517-524
 AtREG531GCCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGGAAACGAC-2174873821748745-582-589
 AtREG576GAAACGAC PPDB Motif  PLACE Motif 
REGGGCCTAAT-2174879421748801-638-645
 AtREG506GGCCTAAT PPDB Motif  PLACE Motif 
REGAAAGTCAA-2174881221748819-656-663
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.