PlantPromoterDB promoter information of AT5G55920.1

Summary of Gene (AT5G55920.1)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G55920 TAIR NCBI
Gene model	AT5G55920.1
Description	nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 57341 Blast hits to 24891 proteins in 1676 species: Archae - 352; Bacteria - 19580; Metazoa - 14938; Fungi - 5674; Plants - 1601; Viruses - 625; Other Eukaryotes - 14571 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 22642633-22641434)

`Genome position from initiation codon` `AT5G55910.1 TSS from cDNA TSS information AT5G55920.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G55920.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak T clone - 22649447 -64

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`T`	clone	-	22649447	-64

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 8 - 22642262 AT5G55910.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	8	-	22642262	AT5G55910.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone T clone - 22642353 AT5G55910.1

TSS clone T clone - 22642289 AT5G55910.1

TSS clone G clone - 22642265 AT5G55910.1

TSS clone T clone - 22642261 AT5G55910.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`T`	clone	-	22642353	AT5G55910.1
TSS clone	`T`	clone	-	22642289	AT5G55910.1
TSS clone	`G`	clone	-	22642265	AT5G55910.1
TSS clone	`T`	clone	-	22642261	AT5G55910.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTCTTTCTCTCTCT - 22642237 22642251 AT5G55910.1

Y Patch CTCTCTCTCCCTCTCTCT - 22642295 22642312 AT5G55910.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTCTTTCTCTCTCT`	-	22642237	22642251	AT5G55910.1
Y Patch	`CTCTCTCTCCCTCTCTCT`	-	22642295	22642312	AT5G55910.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG TTTGACCC - 22642378 22642385 AT5G55910.1

AtREG592 TTTGACCC PPDB Motif PLACE Motif TTGAC, TTGACC

REG AAAAAGCC - 22642524 22642531 AT5G55910.1

AtREG589 AAAAAGCC PPDB Motif PLACE Motif