PlantPromoterDB promoter information of AT5G55950.1

Summary of Gene (AT5G55950.1)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G55950 TAIR NCBI
Gene model	AT5G55950.1
Description	transporter-related; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: membrane; EXPRESSED IN: leaf whorl, petal, inflorescence meristem, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: transporter-related (TAIR:AT5G57100.1); Has 1314 Blast hits to 1312 proteins in 158 species: Archae - 2; Bacteria - 4; Metazoa - 423; Fungi - 187; Plants - 539; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 22659053-22657854)

`Genome position from initiation codon` `AT5G55940.1 TSS from cDNA TSS information AT5G55950.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G55950.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak A clone - 22660433 -180

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`A`	clone	-	22660433	-180

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 23 - 22657960 AT5G55940.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	23	-	22657960	AT5G55940.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone - 22658050 AT5G55940.1

TSS clone G clone - 22658048 AT5G55940.1

TSS clone C clone - 22658014 AT5G55940.1

TSS clone A clone - 22657959 AT5G55940.1

TSS clone G clone - 22657949 AT5G55940.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	-	22658050	AT5G55940.1
TSS clone	`G`	clone	-	22658048	AT5G55940.1
TSS clone	`C`	clone	-	22658014	AT5G55940.1
TSS clone	`A`	clone	-	22657959	AT5G55940.1
TSS clone	`G`	clone	-	22657949	AT5G55940.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG TGACCCGAACCCGGTTTAG - 22658017 22658035 AT5G55940.1

AtREG617 TGACCCGA            PPDB Motif PLACE Motif

AtREG597 GACCCGAA           PPDB Motif GGGACCC PLACE Motif

AtREG516        AACCCGGT     PPDB Motif PLACE Motif

AtREG455         ACCCGGTT    PPDB Motif AACCG(G/A) PLACE Motif

AtREG412           CCGGTTTA PPDB Motif AACCG(G/A) PLACE Motif

AtREG511            CGGTTTAG PPDB Motif AACCG(G/A) PLACE Motif

REG TTGACTTT - 22658112 22658119 AT5G55940.1

AtREG632 TTGACTTT PPDB Motif PLACE Motif TTGAC