version
PlantPromoterDB promoter information of AT5G56130

Summary of Gene (AT5G56130)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G56130  TAIR      NCBI 
Gene model AT5G56130  
Description transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: HOS15 (high expression of osmotically responsive genes 15) (TAIR:AT5G67320.1); Has 39801 Blast hits to 20795 proteins in 547 species: Archae - 54; Bacteria - 5003; Metazoa - 18429; Fungi - 7672; Plants - 3597; Viruses - 0; Other Eukaryotes - 5046 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 22726065-22724866)

Genome position     
from initiation codon
AT5G56130.1         
TSS from cDNA
TSS information
AT5G56130                        5'->3' (-)
Promoter sequence

 
AT5G56140.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G56130

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-22725085-20
TSS clone peakGclone-22725080-15
TSS cloneAclone-22725076-11
TSS cloneGclone-22725075-10

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA34+22725368AT5G56140.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+22725369AT5G56140.1
TSS cloneAclone+22725370AT5G56140.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTCTATAAAAT+2272533322725344AT5G56140.1
Y PatchCTTCTTCTTCT+2272540622725416AT5G56140.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGCAGCGTTT+2272513922725148AT5G56140.1
 AtREG369CGCAGCGT   PPDB Motif  PLACE Motif 
 AtREG626  CAGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCCGGTATA+2272515622725163AT5G56140.1
 AtREG629CCGGTATA PPDB Motif  PLACE Motif 
REGATAAACCGAA+2272516522725174AT5G56140.1
 AtREG598ATAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTAAACCGGAT+2272518522725195AT5G56140.1
 AtREG519GTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.