PlantPromoterDB promoter information of AT5G57240

Summary of Gene (AT5G57240)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G57240 TAIR NCBI
Gene model	AT5G57240
Description	OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4C (ORP4C); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein, conserved site (InterPro:IPR018494), Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4B (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B); oxysterol binding (TAIR:AT4G25850.1); Has 1659 Blast hits to 1658 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 914; Fungi - 432; Plants - 123; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 23192449-23193648)

`Genome position from initiation codon` `AT5G57240.1 AT5G57240.2 TSS from cDNA TSS information AT5G57240 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G57240

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 8 + 23193158 -291

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	8	+	23193158	-291

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone G clone + 23193321 -128

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`G`	clone	+	23193321	-128

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CTACTATATATACA + 23193122 23193135 -327 -314

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTACTATATATACA`	+	23193122	23193135	-327	-314
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG GGCGTTTT + 23192874 23192881 -575 -568

AtREG650 GGCGTTTT PPDB Motif AAACG(C/G) PLACE Motif

REG TTTCCGGT + 23193011 23193018 -438 -431

AtREG644 TTTCCGGT PPDB Motif AACCG(G/A) PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`GGCGTTTT`		+	23192874	23192881	-575	-568
	AtREG650	`GGCGTTTT`		PPDB Motif	`AAACG(C/G)`	PLACE Motif
REG	`TTTCCGGT`		+	23193011	23193018	-438	-431
	AtREG644	`TTTCCGGT`		PPDB Motif	`AACCG(G/A)`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None