version
PlantPromoterDB promoter information of AT5G57290.3

Summary of Gene (AT5G57290.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G57290  TAIR      NCBI 
Gene model AT5G57290.3  
Description 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 23208835-23207636)

Genome position     
from initiation codon
AT5G57290.1         
AT5G57290.2         
AT5G57300.1         
AT5G57300.2         
TSS from cDNA
TSS information
AT5G57290.3                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G57290.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG128-23207895-60

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-23207893-58
TSS cloneAclone-23207892-57
TSS cloneCclone-23207891-56
TSS cloneGclone-23207861-26

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCATATATAAACA-2320791623207928-81-93
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAGCCC-2320796823207975-133-140
 AtREG462ATAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGTCAGGCCCATCT-2320797923207990-144-155
 AtREG374TCAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG403   GGCCCATC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG572    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCTTTG-2320799323208004-158-169
 AtREG386AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559    GGGCTTTG PPDB MotifGCCCA  PLACE Motif 
REGTAATTACG-2320801823208025-183-190
 AtREG646TAATTACGABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.