version
PlantPromoterDB promoter information of AT5G58330.3

Summary of Gene (AT5G58330.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G58330  TAIR      NCBI 
Gene model AT5G58330.3  
Description malate dehydrogenase (NADP), chloroplast, putative; FUNCTIONS IN: oxidoreductase activity, binding, malate dehydrogenase activity, catalytic activity, malate dehydrogenase (NADP+) activity; INVOLVED IN: malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), Malate dehydrogenase, NADP-dependent, plants (InterPro:IPR011273), NAD(P)-binding (InterPro:IPR016040), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G56720.1); Has 6543 Blast hits to 6543 proteins in 1476 species: Archae - 77; Bacteria - 3514; Metazoa - 459; Fungi - 108; Plants - 380; Viruses - 0; Other Eukaryotes - 2005 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 23582751-23581552)

Genome position     
from initiation codon
AT5G58330.1         
AT5G58330.2         
TSS from cDNA
TSS information
AT5G58330.3                      5'->3' (-)
Promoter sequence












 
AT5G58340.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G58330.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA60-23582334-583

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-23582586-835
TSS cloneAclone-23582364-613
TSS cloneTclone-23582358-607
TSS cloneTclone-23582343-592
TSS cloneAclone-23582336-585
TSS cloneTclone-23582335-584
TSS cloneGclone-23582333-582
TSS cloneAclone-23582321-570
TSS cloneCclone-23582313-562
TSS cloneCclone-23582307-556
TSS cloneGclone-23582305-554

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTCC-2358233723582346-586-595
Y PatchCCTCTTTCT-2358236923582377-618-626
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTATTGGGCCTTAACTGGGCCTAAAAGTCAA-2358245223582482-701-731
 AtREG417TTATTGGG                        PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC                       PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC                      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT                     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353    TGGGCCTT                    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351     GGGCCTTA                   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416      GGCCTTAA                  PPDB Motif  PLACE Motif 
 AtREG384             ACTGGGCC           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410              CTGGGCCT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358               TGGGCCTA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360                GGGCCTAA        PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430                 GGCCTAAA       PPDB Motif  PLACE Motif 
 AtREG632                       AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4+23582518AT5G58340.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACGTCGTTTT+2358225023582260AT5G58340.1
 AtREG431GACGTCGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG493 ACGTCGTT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG415  CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520   GTCGTTTT PPDB Motif  PLACE Motif 
REGTTGACTTTTAGGCCCAGTTAAGGCCC+2358245223582477AT5G58340.1
 AtREG632TTGACTTT                   PPDB Motif  PLACE MotifTTGAC 
 AtREG430      TTTAGGCC             PPDB Motif  PLACE Motif 
 AtREG360       TTAGGCCC            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358        TAGGCCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410         AGGCCCAG          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384          GGCCCAGT         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG416                 TTAAGGCC  PPDB Motif  PLACE Motif 
 AtREG351                  TAAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.