PlantPromoterDB promoter information of AT5G58390

Summary of Gene (AT5G58390)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G58390 TAIR NCBI
Gene model	AT5G58390
Description	peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G58400.1); Has 2891 Blast hits to 2875 proteins in 212 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 66; Plants - 2777; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 23602244-23601045)

`Genome position from initiation codon` `AT5G58390.1 TSS from cDNA TSS information AT5G58390 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G58390

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 4 - 23601325 -81

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	4	-	23601325	-81

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone G clone - 23601322 -78

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`G`	clone	-	23601322	-78

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TCTCTATAAAGC - 23601350 23601361 -106 -117

Y Patch TCCTCTCT - 23601357 23601364 -113 -120

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TCTCTATAAAGC`	-	23601350	23601361	-106	-117
Y Patch	`TCCTCTCT`	-	23601357	23601364	-113	-120
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CGTAATTA - 23601444 23601451 -200 -207

AtREG646 CGTAATTA ABA PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CGTAATTA`		-	23601444	23601451	-200	-207
	AtREG646	`CGTAATTA`	ABA	PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None