version
PlantPromoterDB promoter information of AT5G58590.1

Summary of Gene (AT5G58590.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G58590  TAIR      NCBI 
Gene model AT5G58590.1  
Description Encodes a Ran-binding protein 1 homolog (RanBP1).  
#
#

Overview

Focused view (chromosome 5: 23682714-23681515)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G58590.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G58590.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-23681742-28

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-23681798-84
TSS cloneTclone-23681792-78
TSS cloneGclone-23681790-76
TSS cloneAclone-23681789-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTCC-2368177723681786-63-72
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAGCCCACTA-2368186323681873-149-159
 AtREG571TTAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510  AGCCCACT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG532   GCCCACTA PPDB MotifGCCCA  PLACE Motif 
REGGGGCCTTAATGGGCTTA-2368189523681911-181-197
 AtREG351GGGCCTTA          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416 GGCCTTAA         PPDB Motif  PLACE Motif 
 AtREG604    CTTAATGG      PPDB Motif  PLACE MotifTTAATGG 
 AtREG396     TTAATGGG     PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357      TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372       AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378        ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426         TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.