PlantPromoterDB promoter information of AT5G59090.2

Summary of Gene (AT5G59090.2)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G59090 TAIR NCBI
Gene model	AT5G59090.2
Description	ATSBT4.12; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast, nucleus, cytoplasm; EXPRESSED IN: 6 plant structures; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ATSBT4.13 (ARABIDOPSIS THALIANA SUBTILASE 4.13); identical protein binding / serine-type endopeptidase (TAIR:AT5G59120.1); Has 4384 Blast hits to 3866 proteins in 705 species: Archae - 135; Bacteria - 2617; Metazoa - 62; Fungi - 180; Plants - 882; Viruses - 0; Other Eukaryotes - 508 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 23848985-23847786)

`Genome position from initiation codon` `AT5G59080.1 TSS from cDNA TSS information AT5G59090.2 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G59090.2

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 49 - 23855272 -37

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	49	-	23855272	-37

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 23855275 -40

TSS clone A clone - 23855272 -37

TSS clone T clone - 23855271 -36

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	23855275	-40
TSS clone	`A`	clone	-	23855272	-37
TSS clone	`T`	clone	-	23855271	-36

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CTTCTATATAAAGA - 23855298 23855311 -63 -76

Y Patch TCTCTTCT - 23855307 23855314 -72 -79

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTTCTATATAAAGA`	-	23855298	23855311	-63	-76
Y Patch	`TCTCTTCT`	-	23855307	23855314	-72	-79
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TGGGCTTT - 23855421 23855428 -186 -193

AtREG376 TGGGCTTT PPDB Motif GCCCA PLACE Motif TGGGCY

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TGGGCTTT`		-	23855421	23855428	-186	-193
	AtREG376	`TGGGCTTT`		PPDB Motif	`GCCCA`	PLACE Motif	`TGGGCY`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 5 - 23848601 AT5G59080.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	5	-	23848601	AT5G59080.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone - 23848495 AT5G59080.1

TSS clone A clone - 23848486 AT5G59080.1

TSS clone A clone - 23848485 AT5G59080.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	-	23848495	AT5G59080.1
TSS clone	`A`	clone	-	23848486	AT5G59080.1
TSS clone	`A`	clone	-	23848485	AT5G59080.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTTTCTCT - 23848616 23848624 AT5G59080.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTTTCTCT`	-	23848616	23848624	AT5G59080.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CCAATAAG - 23848770 23848777 AT5G59080.1

AtREG611 CCAATAAG PPDB Motif PLACE Motif