version
PlantPromoterDB promoter information of AT5G59600.1

Summary of Gene (AT5G59600.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G59600  TAIR      NCBI 
Gene model AT5G59600.1  
Description pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2758 (embryo defective 2758) (TAIR:AT4G33990.1); Has 16346 Blast hits to 5424 proteins in 162 species: Archae - 0; Bacteria - 5; Metazoa - 170; Fungi - 149; Plants - 15583; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 24013919-24012720)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G59600.1                      5'->3' (-)
Promoter sequence




 
AT5G59610.1         
AT5G59610.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G59600.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24013025-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCCGGTTCA-2401307724013087-158-168
 AtREG644TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480   CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTTAACCG-2401309724013104-178-185
 AtREG645TTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGATCCGGTTTT-2401310724013116-188-197
 AtREG561ATCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542  CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+24013155AT5G59610.1, AT5G59610.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGAACCGGAAA+2401307724013087AT5G59610.1, AT5G59610.2
 AtREG480TGAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534  AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644   ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGTTAAA+2401309724013104AT5G59610.1, AT5G59610.2
 AtREG645CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGAAAACCGG+2401310724013114AT5G59610.1, AT5G59610.2
 AtREG542AAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.