PlantPromoterDB promoter information of AT5G59690

Summary of Gene (AT5G59690)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G59690 TAIR NCBI
Gene model	AT5G59690
Description	histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: thylakoid; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone H4 (InterPro:IPR001951), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2716 Blast hits to 2716 proteins in 361 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 282; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 24050649-24051848)

`Genome position from initiation codon` `AT5G59680.1 AT5G59690.1 TSS from cDNA TSS information AT5G59690 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G59690

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 61 + 24051579 -70

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	61	+	24051579	-70

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 24051573 -76

TSS clone A clone + 24051574 -75

TSS clone C clone + 24051577 -72

TSS clone T clone + 24051578 -71

TSS clone C clone + 24051580 -69

TSS clone A clone + 24051627 -22

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	24051573	-76
TSS clone	`A`	clone	+	24051574	-75
TSS clone	`C`	clone	+	24051577	-72
TSS clone	`T`	clone	+	24051578	-71
TSS clone	`C`	clone	+	24051580	-69
TSS clone	`A`	clone	+	24051627	-22

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TGCCTATAAAAA + 24051539 24051550 -110 -99

Y Patch TCTTTCTC + 24051561 24051568 -88 -81

Y Patch TTCTTCTTCTTCT + 24051590 24051602 -59 -47

Y Patch TTTCTCTC + 24051614 24051621 -35 -28

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TGCCTATAAAAA`	+	24051539	24051550	-110	-99
Y Patch	`TCTTTCTC`	+	24051561	24051568	-88	-81
Y Patch	`TTCTTCTTCTTCT`	+	24051590	24051602	-59	-47
Y Patch	`TTTCTCTC`	+	24051614	24051621	-35	-28
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TCACGCGG + 24051400 24051407 -249 -242

AtREG502 TCACGCGG Drought PPDB Motif PLACE Motif

REG ACGGTTTAT + 24051442 24051450 -207 -199

AtREG652 ACGGTTTA PPDB Motif PLACE Motif

AtREG598 CGGTTTAT PPDB Motif AACCG(G/A) PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TCACGCGG`		+	24051400	24051407	-249	-242
	AtREG502	`TCACGCGG`	Drought	PPDB Motif		PLACE Motif
REG	`ACGGTTTAT`		+	24051442	24051450	-207	-199
	AtREG652	`ACGGTTTA`		PPDB Motif		PLACE Motif
	AtREG598	`CGGTTTAT`		PPDB Motif	`AACCG(G/A)`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None