version
PlantPromoterDB promoter information of AT5G61228.1

Summary of Gene (AT5G61228.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G61228  TAIR      NCBI 
Gene model AT5G61228.1  
Description Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF15 represents a conserved upstream opening reading frame relative to major ORF AT5G61230.1  
#
#

Overview

Focused view (chromosome 5: 24626892-24628091)

Genome position     
from initiation codon
AT5G61230.1         
TSS from cDNA
TSS information
AT5G61228.1                      5'->3' (+)
Promoter sequence







 
AT5G61220.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G61228.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+24627194-698

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+24627171-721
TSS cloneTclone+24627174-718
TSS cloneCclone+24627179-713
TSS cloneTclone+24627193-699

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTCCTTCTCT+2462717924627193-713-699
Y PatchTTCTCTCTT+2462720624627214-686-678
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTAAACCGG+2462697824626986-914-906
 AtREG511CTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAACCGGAT+2462700124627009-891-883
 AtREG579GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561 AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAACCGGTTTT+2462703324627043-859-849
 AtREG528GAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542   CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAATGGGCTA+2462704524627054-847-838
 AtREG643GAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581  ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCAAAGGCC+2462705924627066-833-826
 AtREG656CAAAGGCC PPDB Motif  PLACE Motif 
REGAATTGGGCCAAT+2462707224627083-820-809
 AtREG418AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484   TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446    GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.