version
PlantPromoterDB promoter information of AT5G62060.1

Summary of Gene (AT5G62060.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G62060  TAIR      NCBI 
Gene model AT5G62060.1  
Description F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 3 (InterPro:IPR013187), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G32420.1); Has 662 Blast hits to 644 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 662; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 24926688-24927887)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G62060.1                      5'->3' (+)
Promoter sequence



 
AT5G62050.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G62060.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTCGGTTTGG+2492737724927387-311-301
 AtREG556GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568 TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550   CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGAACCA+2492740024927408-288-280
 AtREG451ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655 CCGAACCA PPDB Motif  PLACE Motif 
REGTTGACTTT+2492741724927424-271-264
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG5-24927258AT5G62050.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-24927287AT5G62050.1
TSS cloneCclone-24927278AT5G62050.1
TSS cloneTclone-24927275AT5G62050.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTTCTTC-2492720924927221AT5G62050.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGGTTTAA-2492735524927363AT5G62050.1
 AtREG652ACGGTTTA  PPDB Motif  PLACE Motif 
 AtREG473 CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGAAC-2492737724927387AT5G62050.1
 AtREG550CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGGTTCGGT-2492740024927408AT5G62050.1
 AtREG655TGGTTCGG  PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT PPDB Motif  PLACE Motif 
REGAAAGTCAA-2492741724927424AT5G62050.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.