version
PlantPromoterDB promoter information of AT5G62440.1

Summary of Gene (AT5G62440.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G62440  TAIR      NCBI 
Gene model AT5G62440.1  
Description Encodes a protein DOMINO1 that belongs to a plant-specific gene family sharing a common motif present in the tomato DEFECTIVE CHLOROPLASTS AND LEAVES (LeDCL) protein. DOMINO1 is located in the nucleus. Arabidopsis embryos carrying the domino1 mutation grow slowly in comparison with wild type embryos and reach only the globular stage at desiccation. The primary defect of the mutation at the cellular level is the large size of the nucleolus that can be observed soon after fertilization in the nuclei of both the embryo and the endosperm. DOMINO1 might have a role in ribosome biogenesis and in determining the rate of cell division.  
#
#

Overview

Focused view (chromosome 5: 25074917-25073718)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G62440.1                      5'->3' (-)
Promoter sequence




 
AT5G62460.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G62440.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-25073989-72

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-25073991-74
TSS cloneAclone-25073989-72
TSS cloneCclone-25073988-71

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATAAATATA-2507401425074025-97-108
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGAACCAGTTCGGTTCAA-2507404025074059-123-142
 AtREG451ACCGAACC             PPDB Motif  PLACE Motif 
 AtREG655 CCGAACCA            PPDB Motif  PLACE Motif 
 AtREG556         GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG640            CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+25074900AT5G62460.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+25074901AT5G62460.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCCGGTTTT+2507483525074843AT5G62460.1
 AtREG521TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542 CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.