version
PlantPromoterDB promoter information of AT5G62920.1

Summary of Gene (AT5G62920.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G62920  TAIR      NCBI 
Gene model AT5G62920.1  
Description Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin.  
#
#

Overview

Focused view (chromosome 5: 25255158-25253959)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G62920.1                      5'->3' (-)
Promoter sequence





 
AT5G62930.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G62920.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-25254218-60

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-25254212-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATATAAATG-2525423825254249-80-91
Y PatchTCTTTCTCTTCCT-2525419225254204-34-46
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGGTTT-2525441425254421-256-263
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTGACTTT-2525442425254431-266-273
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGTTGAACCG-2525443825254445-280-287
 AtREG640TTGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGTTTTGA-2525445225254459-294-301
 AtREG653CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGCGGTTAAA-2525449625254503-338-345
 AtREG645CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCGGTTTGG-2525450625254513-348-355
 AtREG550CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA38+25254888AT5G62930.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+25254888AT5G62930.1
TSS cloneGclone+25254889AT5G62930.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAAGGCCCGGCCCATAT+2525481825254835AT5G62930.1
 AtREG467TAAAGGCC           PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG404      CCCGGCCC    CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG457       CCGGCCCA   CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380        CGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364         GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432          GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCAG+2525483925254847AT5G62930.1
 AtREG484TTGGCCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 TGGCCCAG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.