PlantPromoterDB promoter information of AT5G63420

Summary of Gene (AT5G63420)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G63420 TAIR NCBI
Gene model	AT5G63420
Description	embryo defective 2746 (emb2746); FUNCTIONS IN: hydrolase activity, DNA binding, catalytic activity; INVOLVED IN: embryonic development ending in seed dormancy, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), RNA-metabolising metallo-beta-lactamase (InterPro:IPR011108), Beta-lactamase-like (InterPro:IPR001279), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT2G38250.1); Has 5467 Blast hits to 5398 proteins in 932 species: Archae - 259; Bacteria - 2061; Metazoa - 290; Fungi - 126; Plants - 222; Viruses - 2; Other Eukaryotes - 2507 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 25398065-25399264)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G63420 5'->3' (+) Promoter sequence AT5G63410.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G63420

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone G clone + 25400386 -129

TSS clone peak A clone + 25400387 -128

TSS clone T clone + 25400426 -89

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`G`	clone	+	25400386	-129
TSS clone peak	`A`	clone	+	25400387	-128
TSS clone	`T`	clone	+	25400426	-89

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 4 - 25398204 AT5G63410.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	4	-	25398204	AT5G63410.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone - 25398153 AT5G63410.1

TSS clone T clone - 25398087 AT5G63410.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	-	25398153	AT5G63410.1
TSS clone	`T`	clone	-	25398087	AT5G63410.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG ACGACACC - 25398469 25398476 AT5G63410.1

AtREG599 ACGACACC PPDB Motif PLACE Motif