PlantPromoterDB promoter information of AT5G63480.1

Summary of Gene (AT5G63480.1)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G63480 TAIR NCBI
Gene model	AT5G63480.1
Description	unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 28 proteins in 16 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 12; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 25416317-25417516)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G63480.1 5'->3' (+) Promoter sequence AT5G63470.1 AT5G63470.2 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G63480.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 8 - 25417098 AT5G63470.1, AT5G63470.2

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	8	-	25417098	AT5G63470.1, AT5G63470.2

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone - 25417117 AT5G63470.1, AT5G63470.2

TSS clone G clone - 25417109 AT5G63470.1, AT5G63470.2

TSS clone A clone - 25417103 AT5G63470.1, AT5G63470.2

TSS clone C clone - 25417099 AT5G63470.1, AT5G63470.2

TSS clone G clone - 25417095 AT5G63470.1, AT5G63470.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	-	25417117	AT5G63470.1, AT5G63470.2
TSS clone	`G`	clone	-	25417109	AT5G63470.1, AT5G63470.2
TSS clone	`A`	clone	-	25417103	AT5G63470.1, AT5G63470.2
TSS clone	`C`	clone	-	25417099	AT5G63470.1, AT5G63470.2
TSS clone	`G`	clone	-	25417095	AT5G63470.1, AT5G63470.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CGATGTCGTTTT - 25417257 25417268 AT5G63470.1, AT5G63470.2

AtREG630 CGATGTCG     PPDB Motif PLACE Motif

AtREG569    TGTCGTTT PPDB Motif PLACE Motif

AtREG520     GTCGTTTT PPDB Motif PLACE Motif

REG ACGGCGTC - 25417289 25417296 AT5G63470.1, AT5G63470.2

AtREG540 ACGGCGTC PPDB Motif PLACE Motif