version
PlantPromoterDB promoter information of AT5G63880.1

Summary of Gene (AT5G63880.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G63880  TAIR      NCBI 
Gene model AT5G63880.1  
Description VPS20.1; INVOLVED IN: vesicle-mediated transport, N-terminal protein myristoylation; LOCATED IN: ESCRT III complex, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS20.2 (VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN 20.2) (TAIR:AT5G09260.1); Has 1502 Blast hits to 1439 proteins in 224 species: Archae - 29; Bacteria - 103; Metazoa - 652; Fungi - 285; Plants - 140; Viruses - 4; Other Eukaryotes - 289 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 25562890-25564089)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G63880.1                      5'->3' (+)
Promoter sequence

 
AT5G63870.1         
AT5G63870.2         
AT5G63870.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G63880.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+25563733-157

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-25563264AT5G63870.2, AT5G63870.3, AT5G63870.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-25563274AT5G63870.2, AT5G63870.3, AT5G63870.1
TSS cloneCclone-25563248AT5G63870.2, AT5G63870.3, AT5G63870.1
TSS cloneTclone-25563247AT5G63870.2, AT5G63870.3, AT5G63870.1
TSS cloneGclone-25563242AT5G63870.2, AT5G63870.3, AT5G63870.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACGTCGTTT-2556330625563315AT5G63870.1, AT5G63870.2, AT5G63870.3
 AtREG431GACGTCGT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG493 ACGTCGTT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG415  CGTCGTTT PPDB Motif  PLACE Motif 
REGTTAAACCGGCCGGTTTGG-2556335525563372AT5G63870.1, AT5G63870.2, AT5G63870.3
 AtREG473TTAAACCG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496         CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550          CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAAACGC-2556341025563417AT5G63870.1, AT5G63870.2, AT5G63870.3
 AtREG585CAAAACGC PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
REGAGCGCGTGA-2556342125563429AT5G63870.1, AT5G63870.2, AT5G63870.3
 AtREG381AGCGCGTG  PPDB MotifACGCGC  PLACE Motif 
 AtREG395 GCGCGTGA PPDB MotifACGCGC  PLACE Motif 
REGCGCGTTTT-2556343425563441AT5G63870.1, AT5G63870.2, AT5G63870.3
 AtREG566CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCAAACCGGT-2556346925563477AT5G63870.1, AT5G63870.2, AT5G63870.3
 AtREG496CAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.