version
PlantPromoterDB promoter information of AT5G63890.1

Summary of Gene (AT5G63890.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G63890  TAIR      NCBI 
Gene model AT5G63890.1  
Description Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  
#
#

Overview

Focused view (chromosome 5: 25568879-25567680)

Genome position     
from initiation codon
AT5G63890.2         
TSS from cDNA
TSS information
AT5G63890.1                      5'->3' (-)
Promoter sequence








 
AT5G63900.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G63890.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-25568183-304

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-25568195-316
TSS cloneGclone-25568176-297
TSS cloneTclone-25568175-296
TSS cloneGclone-25568169-290

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAATGGGCTTTACGGGCCTTAA-2556825125568272-372-393
 AtREG643GAATGGGC               PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA           PPDB MotifGCCCA  PLACE Motif 
 AtREG429           ACGGGCCT    PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG351             GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416              GGCCTTAA PPDB Motif  PLACE Motif 
REGTAAAGGCCCAATTA-2556829225568305-413-426
 AtREG467TAAAGGCC       PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418     GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG600      CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGATTAGGCCCATAA-2556837225568384-493-505
 AtREG506ATTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364    GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG394     GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGAAAGGCCCATTC-2556840225568413-523-534
 AtREG359AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG643    GCCCATTC PPDB MotifGCCCA  PLACE Motif 
REGGTGGGCCTTTG-2556844725568457-568-578
 AtREG482GTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353 TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359  GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG656   GGCCTTTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.