version
PlantPromoterDB promoter information of AT5G64670.1

Summary of Gene (AT5G64670.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G64670  TAIR      NCBI 
Gene model AT5G64670.1  
Description ribosomal protein L15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15, bacterial-type (InterPro:IPR005749), Ribosomal protein L15 (InterPro:IPR001196); Has 5287 Blast hits to 5287 proteins in 1515 species: Archae - 0; Bacteria - 2940; Metazoa - 111; Fungi - 84; Plants - 51; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 25854880-25853681)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G64670.1                      5'->3' (-)
Promoter sequence




 
AT5G64680.1         
AT5G64680.2         
AT5G64680.3         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence













 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G64670.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-25854004-124

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-25853978-98
TSS cloneAclone-25853936-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCCAT-2585404425854054-164-174
 AtREG421ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437   TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTCAAAACGACA-2585408525854095-205-215
 AtREG653TCAAAACG    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG520  AAAACGAC  PPDB Motif  PLACE Motif 
 AtREG569   AAACGACA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4+25854161AT5G64680.1, AT5G64680.2, AT5G64680.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+25854140AT5G64680.1, AT5G64680.2, AT5G64680.3
TSS cloneTclone+25854151AT5G64680.1, AT5G64680.2, AT5G64680.3
TSS cloneAclone+25854176AT5G64680.1, AT5G64680.2, AT5G64680.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTCTCTTT+2585418025854191AT5G64680.1, AT5G64680.2, AT5G64680.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTAAAGGCCCATTATGGCCCAAAT+2585403125854054AT5G64680.1, AT5G64680.2, AT5G64680.3
 AtREG639TTAAAGGC                 PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG467 TAAAGGCC                PPDB Motif  PLACE Motif 
 AtREG359  AAAGGCCC               PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353   AAGGCCCA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354    AGGCCCAT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361     GGCCCATT            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357      GCCCATTA           PPDB MotifGCCCA  PLACE Motif 
 AtREG546       CCCATTAT          PPDB Motif  PLACE Motif 
 AtREG479            TATGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437             ATGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420              TGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373               GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421                GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTGTCGTTTTGA+2585408525854095AT5G64680.1, AT5G64680.2, AT5G64680.3
 AtREG569TGTCGTTT    PPDB Motif  PLACE Motif 
 AtREG520 GTCGTTTT   PPDB Motif  PLACE Motif 
 AtREG653   CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.