version
PlantPromoterDB promoter information of AT5G65430.1

Summary of Gene (AT5G65430.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G65430  TAIR      NCBI 
Gene model AT5G65430.1  
Description member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1  
#
#

Overview

Focused view (chromosome 5: 26151255-26150056)

Genome position     
from initiation codon
AT5G65430.2         
TSS from cDNA
TSS information
AT5G65430.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G65430.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA161-26150321-66

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-26150341-86
TSS cloneAclone-26150321-66
TSS cloneGclone-26150320-65
TSS cloneAclone-26150319-64
TSS cloneTclone-26150316-61
TSS cloneTclone-26150315-60
TSS cloneCclone-26150312-57
TSS cloneTclone-26150311-56
TSS cloneAclone-26150307-52
TSS cloneAclone-26150288-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCCTCC-2615030926150316-54-61
Y PatchTTCTTCTTCTC-2615034026150350-85-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCACGCGCGAG-2615040326150413-148-158
 AtREG395TCACGCGC    PPDB MotifACGCGC  PLACE Motif 
 AtREG512   CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGAACGACGTCGTTTA-2615042826150441-173-186
 AtREG493AACGACGTCGTT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG431 ACGACGTCGT    PPDB MotifACGT  PLACE MotifACGT 
 AtREG415     CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG565      GTCGTTTA PPDB Motif  PLACE Motif 
REGCACGCGCC-2615048826150495-233-240
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 
REGAAACCGAA-2615050326150510-248-255
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAAGCCC-2615060226150609-347-354
 AtREG409AAAAGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.