version
PlantPromoterDB promoter information of AT5G65660

Summary of Gene (AT5G65660)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G65660  TAIR      NCBI 
Gene model AT5G65660  
Description hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 26254495-26253296)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G65660                        5'->3' (-)
Promoter sequence

 
AT5G65670.1         
AT5G65670.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G65660

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG20-26246375-130

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-26246377-132
TSS cloneTclone-26246374-129

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATAAATA-2624640426246413-159-168
Y PatchCTCTCTTCTCTTCTCT-2624633226246347-87-102
Y PatchTCTCTTCTT-2624638426246392-139-147
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAATGGG-2624657326246580-328-335
 AtREG396TTAATGGG PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGAAAGTCAA-2624663226246639-387-394
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG40+26253754AT5G65670.1, AT5G65670.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+26253685AT5G65670.1, AT5G65670.2
TSS cloneAclone+26253695AT5G65670.1, AT5G65670.2
TSS cloneTclone+26253833AT5G65670.1, AT5G65670.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCTCTCTCTTTCTCT+2625373326253751AT5G65670.1, AT5G65670.2
Y PatchCTCTTCTTCTCC+2625378826253799AT5G65670.1, AT5G65670.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGGTTTAG+2625354026253548AT5G65670.1, AT5G65670.2
 AtREG652ACGGTTTA  PPDB Motif  PLACE Motif 
 AtREG511 CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGTTGGAT+2625357426253582AT5G65670.1, AT5G65670.2
 AtREG554CCGTTGGA  PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG586 CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.