PlantPromoterDB promoter information of AT5G65660

Summary of Gene (AT5G65660)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G65660 TAIR NCBI
Gene model	AT5G65660
Description	hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 26262295-26261096)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G65660 5'->3' (-) Promoter sequence AT5G65683.1 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G65660

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 20 - 26246375 -130

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	20	-	26246375	-130

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone C clone - 26246377 -132

TSS clone T clone - 26246374 -129

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`C`	clone	-	26246377	-132
TSS clone	`T`	clone	-	26246374	-129

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TTTATAAATA - 26246404 26246413 -159 -168

Y Patch CTCTCTTCTCTTCTCT - 26246332 26246347 -87 -102

Y Patch TCTCTTCTT - 26246384 26246392 -139 -147

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TTTATAAATA`	-	26246404	26246413	-159	-168
Y Patch	`CTCTCTTCTCTTCTCT`	-	26246332	26246347	-87	-102
Y Patch	`TCTCTTCTT`	-	26246384	26246392	-139	-147
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TTAATGGG - 26246573 26246580 -328 -335

AtREG396 TTAATGGG PPDB Motif GCCCA PLACE Motif TTAATGG

REG AAAGTCAA - 26246632 26246639 -387 -394

AtREG632 AAAGTCAA PPDB Motif PLACE Motif TTGAC

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TTAATGGG`		-	26246573	26246580	-328	-335
	AtREG396	`TTAATGGG`		PPDB Motif	`GCCCA`	PLACE Motif	`TTAATGG`
REG	`AAAGTCAA`		-	26246632	26246639	-387	-394
	AtREG632	`AAAGTCAA`		PPDB Motif		PLACE Motif	`TTGAC`

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 4 + 26261417 AT5G65683.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	4	+	26261417	AT5G65683.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone + 26261320 AT5G65683.1

TSS clone T clone + 26261346 AT5G65683.1

TSS clone A clone + 26261355 AT5G65683.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	+	26261320	AT5G65683.1
TSS clone	`T`	clone	+	26261346	AT5G65683.1
TSS clone	`A`	clone	+	26261355	AT5G65683.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box TCTCTATAA + 26261378 26261386 AT5G65683.1

Y Patch TTCTTCTTCTTCTCT + 26261368 26261382 AT5G65683.1

Y Patch CTTCTCTTCTT + 26261443 26261453 AT5G65683.1

Y Patch TCTTTCTC + 26261457 26261464 AT5G65683.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TCTCTATAA`	+	26261378	26261386	AT5G65683.1
Y Patch	`TTCTTCTTCTTCTCT`	+	26261368	26261382	AT5G65683.1
Y Patch	`CTTCTCTTCTT`	+	26261443	26261453	AT5G65683.1
Y Patch	`TCTTTCTC`	+	26261457	26261464	AT5G65683.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None