PlantPromoterDB promoter information of AT5G65740.2

Summary of Gene (AT5G65740.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G65740  TAIR      NCBI 
Gene model AT5G65740.2  
Description protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); Has 130 Blast hits to 129 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  


Focused view (chromosome 5: 26311622-26310423)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT5G65740.2                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT5G65740.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneGclone-26303471-49
TSS clone peakGclone-26303433-11
TSS cloneTclone-26303425-3

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
TSS peakG2+26311455AT5G65770.1, AT5G65770.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTT+2631146926311476AT5G65770.1, AT5G65770.2

REG information

TypeSequenceAnnotationGenome positionGene model
REGTAAAACGCCGTCGTTTGGGC+2631135426311373AT5G65770.1, AT5G65770.2
 AtREG564TAAAACGC             PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650 AAAACGCC            PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG415        CGTCGTTT     PPDB Motif  PLACE Motif 
 AtREG474            GTTTGGGC PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.