PlantPromoterDB promoter information of AT5G65750

Summary of Gene (AT5G65750)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G65750  TAIR      NCBI 
Gene model AT5G65750  
Description 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, oxoglutarate dehydrogenase (succinyl-transferring) activity, thiamin pyrophosphate binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative (TAIR:AT3G55410.1); Has 8716 Blast hits to 8694 proteins in 1114 species: Archae - 2; Bacteria - 2389; Metazoa - 550; Fungi - 187; Plants - 68; Viruses - 0; Other Eukaryotes - 5520 (source: NCBI BLink).  


Focused view (chromosome 5: 26310412-26311611)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT5G65750                        5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT5G65750

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
TSS peakA10+26303736-476

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneAclone+26303729-483
TSS cloneGclone+26303730-482

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCCTTCTTTCTCT+2630370526303721-507-491
Y PatchCGTCTTCTTC+2630377226303781-440-431

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 AtREG529TTTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG555    GGGCCGAT            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG462          ATAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426           TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407            AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402             AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355              GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509               CCCAATAT PPDB Motif  PLACE Motif 
 AtREG360   GGGCCTAA            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG430    GGCCTAAA           PPDB Motif  PLACE Motif 
 AtREG549        TAAAAGCC       PPDB Motif  PLACE Motif 
 AtREG409         AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG355             GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509              CCCAATAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
TSS peakG2+26311455AT5G65770.1, AT5G65770.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTT+2631146926311476AT5G65770.1, AT5G65770.2

REG information

TypeSequenceAnnotationGenome positionGene model
REGTAAAACGCCGTCGTTTGGGC+2631135426311373AT5G65770.1, AT5G65770.2
 AtREG564TAAAACGC             PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650 AAAACGCC            PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG415        CGTCGTTT     PPDB Motif  PLACE Motif 
 AtREG474            GTTTGGGC PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.