PlantPromoterDB promoter information of AT5G65760.1

Summary of Gene (AT5G65760.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G65760  TAIR      NCBI 
Gene model AT5G65760.1  
Description serine carboxypeptidase S28 family protein; FUNCTIONS IN: serine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S28 (InterPro:IPR008758); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S28 family protein (TAIR:AT2G24280.1); Has 916 Blast hits to 880 proteins in 115 species: Archae - 0; Bacteria - 6; Metazoa - 522; Fungi - 131; Plants - 109; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  


Focused view (chromosome 5: 26310589-26311788)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT5G65760.1                      5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT5G65760.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneTclone+26308258-31
TSS clone peakAclone+26308261-28
TSS cloneAclone+26308276-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
TSS peakG2+26311455AT5G65770.1, AT5G65770.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTT+2631146926311476AT5G65770.1, AT5G65770.2

REG information

TypeSequenceAnnotationGenome positionGene model
REGTAAAACGCCGTCGTTTGGGC+2631135426311373AT5G65770.1, AT5G65770.2
 AtREG564TAAAACGC             PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650 AAAACGCC            PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG415        CGTCGTTT     PPDB Motif  PLACE Motif 
 AtREG474            GTTTGGGC PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.