PlantPromoterDB promoter information of AT5G65770.2
Summary of Gene (AT5G65770.2)
|
Overview
|
Focused view (chromosome 5: 26310587-26311786)
|
Genome position
from initiation codon AT5G65770.1 TSS from cDNA TSS information AT5G65770.2 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G65770.2
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 2 | + | 26311455 | -132 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCTTCTT | + | 26311469 | 26311476 | -118 | -111 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TAAAACGCCGTCGTTTGGGC | + | 26311354 | 26311373 | -233 | -214 | |||
| AtREG564 | TAAAACGC | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| AtREG650 | AAAACGCC | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| AtREG415 | CGTCGTTT | PPDB Motif | PLACE Motif | ||||||
| AtREG474 | GTTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||