version
PlantPromoterDB promoter information of AT5G65940.3

Summary of Gene (AT5G65940.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G65940  TAIR      NCBI 
Gene model AT5G65940.3  
Description hydrolyzes beta-hydroxyisobutyryl-CoA  
#
#

Overview

Focused view (chromosome 5: 26380161-26378962)

Genome position     
from initiation codon
AT5G65940.1         
AT5G65940.2         
TSS from cDNA
TSS information
AT5G65940.3                      5'->3' (-)
Promoter sequence







 
AT5G65950.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G65940.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA42-26379232-71

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-26379234-73
TSS cloneGclone-26379231-70

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCTCC-2637919626379205-35-44
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAGGCCCAATAT-2637927426379287-113-126
 AtREG425ATAAGGCC       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351 TAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509      CCCAATAT PPDB Motif  PLACE Motif 
REGATAAAGCCCATTAT-2637930626379319-145-158
 AtREG601ATAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357     GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG546      CCCATTAT PPDB Motif  PLACE Motif 
REGGGGCTTTG-2637936426379371-203-210
 AtREG559GGGCTTTG PPDB MotifGCCCA  PLACE Motif 
REGCCCACGTGTCAT-2637949026379501-329-340
 AtREG464CCCACGTG    ABA, Auxin, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG382 CCACGTGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366  CACGTGTC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG389   ACGTGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG438    CGTGTCATABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGTGGGCTTATAATGGGCCTGA+2638001226380033AT5G65950.1
 AtREG510AGTGGGCT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518 GTGGGCTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426  TGGGCTTA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462   GGGCTTAT            PPDB MotifGCCCA  PLACE Motif 
 AtREG546         ATAATGGG      PPDB Motif  PLACE Motif 
 AtREG357          TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361           AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354            ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370             TGGGCCTG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG374              GGGCCTGA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGATACCCTTA+2638009426380102AT5G65950.1
 AtREG623ATACCCTT  PPDB MotifACCCT  PLACE Motif 
 AtREG570 TACCCTTA PPDB MotifACCCT  PLACE Motif 
REGTTAAAGGCCCGTT+2638010726380119AT5G65950.1
 AtREG639TTAAAGGC      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG467 TAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG359  AAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429    AGGCCCGT  PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG401     GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
REGCCCATTAAG+2638012526380133AT5G65950.1
 AtREG396CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604 CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGTCTGGGCCA+2638014926380157AT5G65950.1
 AtREG397TCTGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 CTGGGCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.