version
PlantPromoterDB promoter information of AT5G66060.1

Summary of Gene (AT5G66060.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G66060  TAIR      NCBI 
Gene model AT5G66060.1  
Description iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae - 0; Bacteria - 195; Metazoa - 891; Fungi - 57; Plants - 219; Viruses - 14; Other Eukaryotes - 403 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 26418481-26419680)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G66060.1                      5'->3' (+)
Promoter sequence








 
AT5G66055.1         
AT5G66055.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G66060.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+26419403-78
TSS peakA2+26419411-70

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGGTG+2641921326419220-268-261
 AtREG618GTGGGGTG PPDB Motif  PLACE Motif 
REGCAATGGGCCTCA+2641930926419320-172-161
 AtREG551CAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG447   TGGGCCTC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG587    GGGCCTCA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCTAATGGGCCTTAC+2641932526419338-156-143
 AtREG558CTAATGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353    TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351     GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG530      GGCCTTAC PPDB Motif  PLACE Motif 
REGATATGGGCCTGA+2641934526419356-136-125
 AtREG432ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370   TGGGCCTG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG374    GGGCCTGA PPDB MotifGCCCA  PLACE MotifGGGCC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-26419256AT5G66055.1, AT5G66055.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-26419265AT5G66055.1, AT5G66055.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGAGGCCCATTG-2641930926419320AT5G66055.1, AT5G66055.2
 AtREG587TGAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447 GAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG551    GCCCATTG PPDB MotifGCCCA  PLACE Motif 
REGGTAAGGCCCATTAG-2641932526419338AT5G66055.1, AT5G66055.2
 AtREG530GTAAGGCC       PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361    GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357     GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG558      CCCATTAG PPDB MotifGCCCA  PLACE Motif 
REGTCAGGCCCATAT-2641934526419356AT5G66055.1, AT5G66055.2
 AtREG374TCAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364   GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432    GCCCATAT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.