version
PlantPromoterDB promoter information of AT5G66510.2

Summary of Gene (AT5G66510.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G66510  TAIR      NCBI 
Gene model AT5G66510.2  
Description Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex.  
#
#

Overview

Focused view (chromosome 5: 26552496-26551297)

Genome position     
from initiation codon
AT5G66510.1         
TSS from cDNA
TSS information
AT5G66510.2                      5'->3' (-)
Promoter sequence








 
AT5G66520.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G66510.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA31-26551603-107

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-26551603-107
TSS cloneCclone-26551598-102
TSS cloneCclone-26551595-99
TSS cloneAclone-26551594-98
TSS cloneCclone-26551593-97
TSS cloneGclone-26551570-74

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCCTCTTCCTCT-2655157726551593-81-97
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAACCGGAT-2655165926551668-163-172
 AtREG480TGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561  AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTGACGTGGCGA-2655173126551742-235-246
 AtREG466GTGACGTG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419 TGACGTGG    PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG388  GACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG371   ACGTGGCG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG471    CGTGGCGAABA PPDB Motif  PLACE MotifGCCAC 
REGTGCCGTTT-2655176526551772-269-276
 AtREG500TGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCGGTTCA+2655165926551668AT5G66520.1
 AtREG561ATCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480  CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCGCCACGTCAC+2655173126551742AT5G66520.1
 AtREG471TCGCCACG    ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG371 CGCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388  GCCACGTC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG419   CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG466    CACGTCACABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGAAACGGCA+2655176526551772AT5G66520.1
 AtREG500AAACGGCA PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.