PlantPromoterDB promoter information of AT5G67300
Summary of Gene (AT5G67300)
|
Overview
|
Focused view (chromosome 5: 26853109-26854308)
|
Genome position
from initiation codon TSS from cDNA TSS information AT5G67300 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G67300
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 95 | + | 26854025 | -84 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | + | 26854023 | -86 |
| TSS clone | G | clone | + | 26854025 | -84 |
| TSS clone | A | clone | + | 26854026 | -83 |
| TSS clone | A | clone | + | 26854027 | -82 |
| TSS clone | T | clone | + | 26854032 | -77 |
| TSS clone | G | clone | + | 26854038 | -71 |
| TSS clone | T | clone | + | 26854043 | -66 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TGTATAAATA | + | 26853991 | 26854000 | -118 | -109 |
| Y Patch | CCTCTCTT | + | 26853976 | 26853983 | -133 | -126 |
| Y Patch | TCCTCTCTTT | + | 26854007 | 26854016 | -102 | -93 |
| Y Patch | CATCTCTC | + | 26854041 | 26854048 | -68 | -61 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CACGCGCTT | + | 26853728 | 26853736 | -381 | -373 | |||
| AtREG381 | CACGCGCT | PPDB Motif | ACGCGC | PLACE Motif | |||||
| AtREG492 | ACGCGCTT | PPDB Motif | ACGCGC | PLACE Motif | |||||
| REG | GGCGCGTGT | + | 26853741 | 26853749 | -368 | -360 | |||
| AtREG486 | GGCGCGTG | PPDB Motif | ACGCGC | PLACE Motif | |||||
| AtREG385 | GCGCGTGT | PPDB Motif | ACGCGC | PLACE Motif | ACACNNG | ||||
| REG | AAAACGACA | + | 26853832 | 26853840 | -277 | -269 | |||
| AtREG520 | AAAACGAC | PPDB Motif | PLACE Motif | ||||||
| AtREG569 | AAACGACA | PPDB Motif | PLACE Motif | ||||||
| REG | ACGCGTGT | + | 26853871 | 26853878 | -238 | -231 | |||
| AtREG536 | ACGCGTGT | ABA, Drought | PPDB Motif | PLACE Motif | ACACNNG | ||||
| REG | CTTAACCGGTTTCCGGTTAT | + | 26853953 | 26853972 | -156 | -137 | |||
| AtREG605 | CTTAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG501 | TTAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG503 | TAACCGGT | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG436 | ACCGGTTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG644 | TTTCCGGT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG534 | TTCCGGTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG621 | TCCGGTTA | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG548 | CCGGTTAT | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||