PlantPromoterDB promoter information of ATCG00650.1
Summary of Gene (ATCG00650.1)
|
Overview
|
Focused view (chromosome C: 66917-68116)
|
Genome position
from initiation codon ATCG00640.1 TSS from cDNA TSS information ATCG00650.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of ATCG00650.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 4 | + | 66918 | -999 |
| TSS peak | G | 13 | + | 67176 | -741 |
| TSS peak | G | 2 | + | 67674 | -243 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TATATATTACTATATATAATG | + | 66874 | 66894 | -1043 | -1023 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | AATAGGCCTTTA | + | 66735 | 66746 | -1182 | -1171 | |||
| AtREG424 | AATAGGCC | PPDB Motif | PLACE Motif | ||||||
| AtREG649 | ATAGGCCT | PPDB Motif | PLACE Motif | ||||||
| AtREG467 | GGCCTTTA | PPDB Motif | PLACE Motif | ||||||
| REG | TGGTTCGGTTCG | + | 66980 | 66991 | -937 | -926 | |||
| AtREG655 | TGGTTCGG | PPDB Motif | PLACE Motif | ||||||
| AtREG451 | GGTTCGGT | PPDB Motif | PLACE Motif | ||||||
| AtREG556 | GTTCGGTT | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG575 | TCGGTTCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||