Organism | Arabidopsis thaliana | |
ID | AtREG354 | |
Sequence | AGGCCCAT | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | GGGCC | one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); | TGGGCY | "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);) |
Total Entry Count | 1186 |
Locus | Gene model | Sequence | Description |
AT1G01100 | AT1G01100.1 | AAATGGGCCTAG | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
AT1G01100.2 | AAATGGGCCTAG | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G01100.3 | AAATGGGCCTAG | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G01100.4 | AAATGGGCCTAG | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G01160 | AT1G01160.1 | CCATGGGCCTTAG | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA  |
AT1G01160.2 | CCATGGGCCTTAG | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA  | |
AT1G01320 | AT1G01320.1 | CTTAGGCCCATTAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G28080.1); Has 10077 Blast hits to 4062 proteins in 343 species: Archae - 100; Bacteria - 2124; Metazoa - 5307; Fungi - 1095; Plants - 343; Viruses - 76; Other Eukaryotes - 1032 (source: NCBI BLink).  |
AT1G01710 | AT1G01710.1 | TTAATGGGCCTTG | acyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).  |
AT1G01820 | AT1G01820.1 | ACAGGCCCATG | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.  |
AT1G01970 | AT1G01970.1 | AAAAGGCCCATA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: NFD5 (NUCLEAR FUSION DEFECTIVE 5) (TAIR:AT1G19520.1); Has 7256 Blast hits to 3017 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 83; Fungi - 5; Plants - 6997; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink).  |
AT1G02290 | AT1G02290.1 | CATGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G02290.1 | TATAGGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G02680 | AT1G02680.1 | TAAATGGGCCTATT | TBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G02816 | AT1G02816.1 | TTAAAGCCCATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G03090 | AT1G03090.1 | ATAGGCCCATTAA | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  |
AT1G03090.2 | ATAGGCCCATTAA | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  | |
AT1G03600 | AT1G03600.1 | ATATGGGCCTTAT | photosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT1G03860 | AT1G03860.1 | AAATGGGCCTCT | prohibitin 2  |
AT1G03860.1 | ATAATGGGCCTGA | prohibitin 2  | |
AT1G03860.1 | TAATGGGCCTAAG | prohibitin 2  | |
AT1G03860.2 | AAATGGGCCTCT | prohibitin 2  | |
AT1G03860.2 | ATAATGGGCCTGA | prohibitin 2  | |
AT1G03860.2 | TAATGGGCCTAAG | prohibitin 2  | |
AT1G03860.3 | AAATGGGCCTCT | prohibitin 2  | |
AT1G03860.3 | ATAATGGGCCTGA | prohibitin 2  | |
AT1G03860.3 | TAATGGGCCTAAG | prohibitin 2  | |
AT1G04070 | AT1G04070.1 | CTTAATGGGCCTAC | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.  |
AT1G04080 | AT1G04080.1 | GTAGGCCCATTAAG | PRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink).  |
AT1G04190 | AT1G04190.1 | TGAGGCCCATTTA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 15524 Blast hits to 9686 proteins in 698 species: Archae - 779; Bacteria - 4552; Metazoa - 3572; Fungi - 847; Plants - 951; Viruses - 0; Other Eukaryotes - 4823 (source: NCBI BLink).  |
AT1G04260 | AT1G04260.1 | CATGGGCCTTTG | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors.  |
AT1G04260.1 | TTAATGGGCCTTTAA | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors.  | |
AT1G04410 | AT1G04410.1 | AGAGGCCCATTAG | malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink).  |
AT1G04420 | AT1G04420.1 | CTAATGGGCCTCT | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink).  |
AT1G04510 | AT1G04510.1 | AAAAGGCCCATTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink).  |
AT1G04510.2 | AAAAGGCCCATTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink).  | |
AT1G04790 | AT1G04790.1 | AAAAGGCCCATTAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink).  |
AT1G05190 | AT1G05190.1 | ATAATGGGCCTAG | embryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink).  |
AT1G06560 | AT1G06560.1 | CAAGGCCCATA | NOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).  |
AT1G06560.1 | CAAGGCCCATCT | NOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).  | |
AT1G06560.1 | CAAGGCCCATCT | NOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).  | |
AT1G06560.1 | CAAGGCCCATCT | NOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).  | |
AT1G07070 | AT1G07070.1 | TATAGGCCCATTAA | 60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT1G07210 | AT1G07210.1 | TAAATGGGCCTGG | 30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink).  |
AT1G07645 | AT1G07645.1 | TAAAGGCCCATAT | DESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT1G07660 | AT1G07660.1 | ATATGGGCCTTTA | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).  |
AT1G07660.2 | ATATGGGCCTTTA | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).  | |
AT1G07980 | AT1G07980.1 | TAAATGGGCCTAAA | NUCLEAR FACTOR Y, SUBUNIT C10 (NF-YC10); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); Has 837 Blast hits to 835 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 200; Plants - 185; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT1G09140 | AT1G09140.1 | ACAGGCCCATTAA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.  |
AT1G09140.2 | ACAGGCCCATTAA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.  | |
AT1G09150 | AT1G09150.1 | TTAATGGGCCTGT | pseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).  |
AT1G09490 | AT1G09490.1 | CAAGGCCCATAT | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565  |
AT1G09490.2 | CAAGGCCCATAT | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565  | |
AT1G09660 | AT1G09660.1 | GTAGGCCCATTAT | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT1G09660.2 | GTAGGCCCATTAT | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT1G09760 | AT1G09760.1 | TTATGGGCCTAACCGACTGGGCCAAT | U2 small nuclear ribonucleoprotein A (U2A'); FUNCTIONS IN: protein binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U2A'/phosphoprotein 32 family A, C-terminal (InterPro:IPR003603); Has 5479 Blast hits to 4495 proteins in 302 species: Archae - 0; Bacteria - 1581; Metazoa - 2979; Fungi - 220; Plants - 106; Viruses - 2; Other Eukaryotes - 591 (source: NCBI BLink).  |
AT1G09770 | AT1G09770.1 | ATTGGCCCAGTCGGTTAGGCCCATAA | Member of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1.  |
AT1G10170 | AT1G10170.1 | TATAGGCCCATTGTTAGCCCATTAG | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response.  |
AT1G10230 | AT1G10230.1 | TTTAGGCCCATAA | ARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink).  |
AT1G11430 | AT1G11430.1 | CTAATGGGCCTAAT | plastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G12800 | AT1G12800.1 | CTATTGGGCCAATTTTAGGCCCATG | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink).  |
AT1G13330 | AT1G13330.1 | TAAAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tat binding protein 1-interacting (InterPro:IPR010776); Has 2425 Blast hits to 2142 proteins in 283 species: Archae - 50; Bacteria - 240; Metazoa - 929; Fungi - 179; Plants - 47; Viruses - 23; Other Eukaryotes - 957 (source: NCBI BLink).  |
AT1G13900 | AT1G13900.1 | GTAAGGCCCATAATATTGGGCTTAGATAGGCCCATATA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).  |
AT1G13910 | AT1G13910.1 | TATATGGGCCTATCTAAGCCCAATATTATGGGCCTTAC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink).  |
AT1G14010 | AT1G14010.1 | TTAATGGGCCTTAA | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
AT1G14030 | AT1G14030.1 | ATAATGGGCCTTTAA | ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 838 Blast hits to 833 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 218; Plants - 233; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).  |
AT1G14270 | AT1G14270.1 | TAAATGGGCCTTAA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
AT1G14270.2 | TAAATGGGCCTTAA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14270.3 | TAAATGGGCCTTAA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14270.4 | TAAATGGGCCTTAA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14490 | AT1G14490.1 | AAAGGCCCATC | DNA-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT5G49700.1); Has 415 Blast hits to 414 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 415; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G14650 | AT1G14650.1 | GCCCGTTAAAGGCCCATTAA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).  |
AT1G14650.2 | GCCCGTTAAAGGCCCATTAA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).  | |
AT1G14980 | AT1G14980.1 | TGAGGCCCATTAA | Encodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs.  |
AT1G14990 | AT1G14990.1 | ATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G15000 | AT1G15000.1 | TATGGGCCTAT | serine carboxypeptidase-like 50 (scpl50); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2538 Blast hits to 2426 proteins in 320 species: Archae - 0; Bacteria - 215; Metazoa - 624; Fungi - 565; Plants - 842; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink).  |
AT1G15020 | AT1G15020.1 | TAATGGGCCTATA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.  |
AT1G15020.2 | TAATGGGCCTATA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.  | |
AT1G15215 | AT1G15215.1 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G15215.2 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G15215.3 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G15220 | AT1G15220.1 | CAAGGCCCATG | Encodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2.  |
AT1G15220.2 | CAAGGCCCATG | Encodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2.  | |
AT1G15250 | AT1G15250.1 | CCAGGCCCATGAAGCCCATTAAGAAGCCCATAT | 60S ribosomal protein L37 (RPL37A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT1G15260 | AT1G15260.1 | CATGGGCCTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16070.1); Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G15930 | AT1G15930.1 | AGCCCAATTAATAGGCCCATTTAAGCCCAAAT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  |
AT1G15930.2 | AGCCCAATTAATAGGCCCATTTAAGCCCAAAT | 40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  | |
AT1G16030 | AT1G16030.1 | ATATGGGCTTTAATAGGCCCATTTA | heat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink).  |
AT1G16040 | AT1G16040.1 | TAAATGGGCCTATTAAAGCCCATAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G16570 | AT1G16570.1 | CATGGGCCTAAC | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).  |
AT1G16570.2 | CATGGGCCTAAC | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).  | |
AT1G16590 | AT1G16590.1 | GTTAGGCCCATG | putative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).  |
AT1G16870 | AT1G16870.1 | TTAATGGGCCTAAC | mitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT1G17070 | AT1G17070.1 | TAAATGGGCCTTTA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink).  |
AT1G17690 | AT1G17690.1 | CAAGGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae - 70; Bacteria - 4843; Metazoa - 8327; Fungi - 2833; Plants - 863; Viruses - 487; Other Eukaryotes - 7064 (source: NCBI BLink).  |
AT1G17890 | AT1G17890.1 | TTTAGGCCCATGGGCCA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).  |
AT1G17890.2 | TTTAGGCCCATGGGCCA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).  | |
AT1G17890.3 | TTTAGGCCCATGGGCCA | GER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).  | |
AT1G18070 | AT1G18070.1 | ATATGGGCCTT | EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).  |
AT1G18070.1 | CTAAGGCCCATTAGTTGGGCTTT | EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).  | |
AT1G18070.2 | ATATGGGCCTT | EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).  | |
AT1G18070.2 | CTAAGGCCCATTAGTTGGGCTTT | EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).  | |
AT1G18480 | AT1G18480.1 | TTAATGGGCCTAC | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G07010.1); Has 433 Blast hits to 431 proteins in 108 species: Archae - 12; Bacteria - 139; Metazoa - 0; Fungi - 17; Plants - 53; Viruses - 3; Other Eukaryotes - 209 (source: NCBI BLink).  |
AT1G20340 | AT1G20340.1 | CAAAGCCCATTAAGGCCCATTT | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis.  |
AT1G20350 | AT1G20350.1 | AAATGGGCCTTAATGGGCTTTG | mitochondrial inner membrane translocase  |
AT1G20510 | AT1G20510.1 | TAAAGGCCCATTAT | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).  |
AT1G20510.2 | TAAAGGCCCATTAT | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).  | |
AT1G20540 | AT1G20540.1 | GTTAGGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G76260.1); Has 6759 Blast hits to 5575 proteins in 300 species: Archae - 0; Bacteria - 624; Metazoa - 3227; Fungi - 1427; Plants - 781; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink).  |
AT1G20575 | AT1G20575.1 | TTTTGGGCTTTATATAGGCCCATAT | dolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative; FUNCTIONS IN: elongation factor-2 kinase activity, dolichyl-phosphate beta-D-mannosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 2 protein (TAIR:AT2G39630.1); Has 14265 Blast hits to 14249 proteins in 1426 species: Archae - 553; Bacteria - 8256; Metazoa - 255; Fungi - 173; Plants - 49; Viruses - 21; Other Eukaryotes - 4958 (source: NCBI BLink).  |
AT1G20580 | AT1G20580.1 | ATATGGGCCTATATAAAGCCCAAAA | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SmD3 (snRNP core protein SmD3) (TAIR:AT1G76300.1); Has 893 Blast hits to 893 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 219; Plants - 128; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT1G20760 | AT1G20760.1 | ATTAGGCCTATAAAGGCCCATTTA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink).  |
AT1G20770 | AT1G20770.1 | TTAATGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G20780 | AT1G20780.1 | TAAAGGCCCATTAA | Encodes a protein containing a U-box and an ARM domain.  |
AT1G21100 | AT1G21100.1 | AGAGGCCCATTAG | O-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; EXPRESSED IN: stem, cotyledon, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21130.1); Has 2126 Blast hits to 2123 proteins in 426 species: Archae - 0; Bacteria - 600; Metazoa - 84; Fungi - 432; Plants - 916; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
AT1G21280 | AT1G21280.1 | CAAGGCCCATTAAGCCCAACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G21560 | AT1G21560.1 | TTATGGGCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G22200 | AT1G22200.1 | ATATGGGCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).  |
AT1G22200.2 | ATATGGGCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).  | |
AT1G22520 | AT1G22520.1 | ATAAGGCCCATTAATCGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1).  |
AT1G22520.2 | ATAAGGCCCATTAATCGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1).  | |
AT1G23100 | AT1G23100.1 | GAATGGGCCTGGGCCACGTA | 10 kDa chaperonin, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Chaperonin Cpn10, conserved site (InterPro:IPR018369), Chaperonin Cpn10 (InterPro:IPR001476); BEST Arabidopsis thaliana protein match is: CPN10 (CHAPERONIN 10); chaperone binding (TAIR:AT1G14980.1); Has 5807 Blast hits to 5744 proteins in 1499 species: Archae - 0; Bacteria - 3188; Metazoa - 245; Fungi - 75; Plants - 201; Viruses - 2; Other Eukaryotes - 2096 (source: NCBI BLink).  |
AT1G23280 | AT1G23280.1 | TGAGGCCCATTAT | MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink).  |
AT1G23290 | AT1G23290.1 | ATAATGGGCCTCA | Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20.  |
AT1G23400 | AT1G23400.1 | TTATGGGCCTGGCCTTAGGGCCCAATT | Promotes the splicing of chloroplast group II introns.  |
AT1G23740 | AT1G23740.1 | TTTAGGCCCATTAA | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae - 321; Bacteria - 14032; Metazoa - 1331; Fungi - 2499; Plants - 781; Viruses - 3; Other Eukaryotes - 6768 (source: NCBI BLink).  |
AT1G23750 | AT1G23750.1 | TTAATGGGCCTAAA | DNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT1G24040 | AT1G24040.1 | ATATGGGCCTTAAGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G24040.2 | ATATGGGCCTTAAGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  | |
AT1G24510 | AT1G24510.1 | GTTAGGCCCATG | T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).  |
AT1G24510.2 | GTTAGGCCCATG | T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).  | |
AT1G26800 | AT1G26800.1 | TTTAGGCCCATGGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14200.1); Has 6695 Blast hits to 6676 proteins in 207 species: Archae - 0; Bacteria - 0; Metazoa - 2341; Fungi - 548; Plants - 2751; Viruses - 14; Other Eukaryotes - 1041 (source: NCBI BLink).  |
AT1G26880 | AT1G26880.1 | AAAAGGCCCATATA | 60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  |
AT1G26880.1 | CATGGGCCTTTAA | 60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  | |
AT1G26880.2 | AAAAGGCCCATATA | 60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  | |
AT1G26880.2 | CATGGGCCTTTAA | 60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  | |
AT1G26940 | AT1G26940.1 | ATATGGGCCTTAC | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink).  |
AT1G27070 | AT1G27070.1 | AAATGGGCCTATA | 5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae - 1; Bacteria - 66; Metazoa - 210; Fungi - 126; Plants - 98; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).  |
AT1G27310 | AT1G27310.1 | ATAAGGCCCATTTA | Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport.  |
AT1G27385 | AT1G27385.1 | AAATGGGCCTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).  |
AT1G27385.2 | AAATGGGCCTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).  | |
AT1G27385.3 | AAATGGGCCTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).  | |
AT1G27385.4 | AAATGGGCCTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).  | |
AT1G27390 | AT1G27390.1 | ATATGGGCCTTCTGGGCCAC | Form of TOM20, which is a component of the TOM complex, involved in transport of nuclear-encoded mitochondrial proteins  |
AT1G27400 | AT1G27400.1 | GTGGCCCAGAAGGCCCATAT | 60S ribosomal protein L17 (RPL17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane, chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17B) (TAIR:AT1G67430.1); Has 1647 Blast hits to 1647 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink).  |
AT1G27435 | AT1G27435.1 | AAATGGGCCTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G28120 | AT1G28120.1 | TTTAGGCCCATTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin thioesterase Otubain (InterPro:IPR016615), Ovarian tumour, otubain (InterPro:IPR003323); Has 295 Blast hits to 295 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 50; Plants - 47; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT1G30380 | AT1G30380.1 | TAAATGGGCCTG | Encodes subunit K of photosystem I reaction center.  |
AT1G30680 | AT1G30680.1 | TTAATGGGCCTTTT | toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink).  |
AT1G31420 | AT1G31420.1 | TAATGGGCCTTAAAAATGGGCCCAATG | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.  |
AT1G31812 | AT1G31812.1 | TTATGGGCCTGA | Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases.  |
AT1G31817 | AT1G31817.1 | GAGGCCCATG | NUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink).  |
AT1G32730 | AT1G32730.1 | CCAGGCCCATATAAAAACGAC | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT1G32990 | AT1G32990.1 | TTTAGGCCCATTAAGCCCATAA | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11  |
AT1G33290 | AT1G33290.1 | TAAAAGCCCATAGGCCCAAAGGCCCATAA | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 615 Blast hits to 609 proteins in 245 species: Archae - 8; Bacteria - 419; Metazoa - 33; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
AT1G33290.2 | TAAAAGCCCATAGGCCCAAAGGCCCATAA | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 615 Blast hits to 609 proteins in 245 species: Archae - 8; Bacteria - 419; Metazoa - 33; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  | |
AT1G33520 | AT1G33520.1 | ATATGGGCCTAAC | Has single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4;  |
AT1G33680 | AT1G33680.1 | ATAGGCCCAT | RNA binding / nucleic acid binding; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G10070.1); Has 44280 Blast hits to 25473 proteins in 1107 species: Archae - 50; Bacteria - 4243; Metazoa - 22643; Fungi - 6988; Plants - 3074; Viruses - 316; Other Eukaryotes - 6966 (source: NCBI BLink).  |
AT1G33980 | AT1G33980.1 | TTAAGGCCCATTAGAGGCCCATATA | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD)  |
AT1G33980.2 | TTAAGGCCCATTAGAGGCCCATATA | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD)  | |
AT1G34190 | AT1G34190.1 | ATAATGGGCCTGT | Arabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 1564; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G34190.1 | TTAATGGGCCTGA | Arabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 1564; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT1G34220 | AT1G34220.1 | GTAGGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink).  |
AT1G34220.2 | GTAGGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink).  | |
AT1G47720 | AT1G47720.1 | ATAATGGGCCTAG | Encodes an organellar single-strand DNA binding protein, located in mitochondria, controls the stoichiometry of alternative mitochondrial DNA forms generated by homologous recombination.  |
AT1G47720.1 | GAATGGGCCTAAA | Encodes an organellar single-strand DNA binding protein, located in mitochondria, controls the stoichiometry of alternative mitochondrial DNA forms generated by homologous recombination.  | |
AT1G48320 | AT1G48320.1 | CTAATGGGCCTTTA | thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT5G48950.1); Has 1639 Blast hits to 1639 proteins in 507 species: Archae - 0; Bacteria - 1172; Metazoa - 3; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink).  |
AT1G48420 | AT1G48420.1 | GAATGGGCCGAGGCCCATAA | Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. Unlike homologous bacterial enzymes, it does not have 1-aminocyclopropane-1-carboxylate deaminase activity.  |
AT1G48900 | AT1G48900.1 | GTAAGGCCCATTAA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink).  |
AT1G48900.2 | GTAAGGCCCATTAA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink).  | |
AT1G49140 | AT1G49140.1 | TGAGGCCCATTAA | NADH-ubiquinone oxidoreductase-related; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT3G18410.2); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G50320 | AT1G50320.1 | TATGGGCCTAG | encodes a prokaryotic thioredoxin  |
AT1G51650 | AT1G51650.1 | ATAAGGCCCATTG | ATP synthase epsilon chain, mitochondrial; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP biosynthetic process, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, epsilon subunit, mitochondrial (InterPro:IPR006721); Has 170 Blast hits to 170 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 3; Plants - 40; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT1G51965 | AT1G51965.1 | GTAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 21191 Blast hits to 6126 proteins in 185 species: Archae - 5; Bacteria - 14; Metazoa - 565; Fungi - 542; Plants - 18830; Viruses - 0; Other Eukaryotes - 1235 (source: NCBI BLink).  |
AT1G51965.1 | TTAAGGCCCATTTA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 21191 Blast hits to 6126 proteins in 185 species: Archae - 5; Bacteria - 14; Metazoa - 565; Fungi - 542; Plants - 18830; Viruses - 0; Other Eukaryotes - 1235 (source: NCBI BLink).  | |
AT1G51980 | AT1G51980.1 | TTATGGGCCTAT | mitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink).  |
AT1G51980.2 | TTATGGGCCTAT | mitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink).  | |
AT1G52300 | AT1G52300.1 | TTAAGGCCCATGGGCCTGA | 60S ribosomal protein L37 (RPL37B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT1G52340 | AT1G52340.1 | TTAAGGCCCATAA | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose.  |
AT1G53750 | AT1G53750.1 | ATATGGGCCTC | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA,  |
AT1G53850 | AT1G53850.1 | GTTAGGCCCATGAAAGCCCATTAT | Encodes alpha5 subunit of 20s proteosome involved in protein degradation.  |
AT1G53850.2 | GTTAGGCCCATGAAAGCCCATTAT | Encodes alpha5 subunit of 20s proteosome involved in protein degradation.  | |
AT1G54100 | AT1G54100.1 | TTAATGGGCCTGGCCCATA | Aldehyde dehydrogenase  |
AT1G54100.2 | TTAATGGGCCTGGCCCATA | Aldehyde dehydrogenase  | |
AT1G54140 | AT1G54140.1 | TTAATGGGCCTAT | putative TATA binding protein associated factor 21kDa  |
AT1G54150 | AT1G54150.1 | ATAGGCCCATTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 1572 Blast hits to 1571 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1041; Fungi - 23; Plants - 178; Viruses - 133; Other Eukaryotes - 197 (source: NCBI BLink).  |
AT1G54340 | AT1G54340.1 | TCAGGCCCATATA | NADP-specific isocitrate dehydrogenase (ICDH)  |
AT1G55530 | AT1G55530.1 | AAAAGGCCCATCT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7739 Blast hits to 7642 proteins in 225 species: Archae - 0; Bacteria - 8; Metazoa - 2938; Fungi - 729; Plants - 2721; Viruses - 30; Other Eukaryotes - 1313 (source: NCBI BLink).  |
AT1G56070 | AT1G56070.1 | ATTGGCCCATTAAGGCCCATTAAG | encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive.  |
AT1G56110 | AT1G56110.1 | CCGTTAAATGGGCCTGGCCCATTG | NOP56-like protein  |
AT1G56590 | AT1G56590.1 | AAGGCCCATG | clathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: HAP13 (HAPLESS 13); protein binding (TAIR:AT1G60780.1); Has 1451 Blast hits to 1434 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 782; Fungi - 300; Plants - 105; Viruses - 0; Other Eukaryotes - 264 (source: NCBI BLink).  |
AT1G57660 | AT1G57660.1 | TATGGCCCAATCAGGCCCATTTA | 60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
AT1G58200 | AT1G58200.1 | GAATGGGCCTAACGATGGGCCCATTT | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.  |
AT1G58200.2 | GAATGGGCCTAACGATGGGCCCATTT | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.  | |
AT1G58210 | AT1G58210.1 | AAATGGGCCCATCGTTAGGCCCATTC | EMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink).  |
AT1G60600 | AT1G60600.1 | TAATGGGCCTTAAAGGCCCAC | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.  |
AT1G60600.2 | TAATGGGCCTTAAAGGCCCAC | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.  | |
AT1G60780 | AT1G60780.1 | CAATGGGCCTTT | HAPLESS 13 (HAP13); FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT1G10730.1); Has 1643 Blast hits to 1593 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 929; Fungi - 318; Plants - 104; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink).  |
AT1G60780.1 | TATATGGGCCTGA | HAPLESS 13 (HAP13); FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT1G10730.1); Has 1643 Blast hits to 1593 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 929; Fungi - 318; Plants - 104; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink).  | |
AT1G61570 | AT1G61570.1 | ACAGGCCCATTAA | Encodes a putative small zinc finger-like protein (TIM13); nucleus-encoded gene whose product is found in the mitochondrial inner membrane space.  |
AT1G62690 | AT1G62690.1 | TGATGGGCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G63900 | AT1G63900.1 | GTAGGCCCATTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 2665 Blast hits to 2573 proteins in 206 species: Archae - 0; Bacteria - 8; Metazoa - 1654; Fungi - 30; Plants - 409; Viruses - 201; Other Eukaryotes - 363 (source: NCBI BLink).  |
AT1G64510 | AT1G64510.1 | AAAAGGCCCATGG | ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: thylakoid, chloroplast thylakoid membrane, ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 978 Blast hits to 978 proteins in 282 species: Archae - 0; Bacteria - 578; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink).  |
AT1G64520 | AT1G64520.1 | CCATGGGCCTTTT | Regulatory Particle non-ATPase 12a (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: RPN12b (Regulatory Particle Non-ATPase 12b); peptidase (TAIR:AT5G42040.1); Has 353 Blast hits to 353 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 84; Plants - 39; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT1G64628 | AT1G64628.1 | AAGGCCCATTTA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF57 represents a conserved upstream opening reading frame relative to major ORF AT1G64630.1  |
AT1G64630 | AT1G64630.1 | AAGGCCCATTTA | WITH NO LYSINE KINASE 10 (WNK10); FUNCTIONS IN: transcription factor activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: WNK8 (WITH NO LYSINE (K) KINASE 8); kinase/ protein kinase (TAIR:AT5G41990.1); Has 77185 Blast hits to 76497 proteins in 1905 species: Archae - 28; Bacteria - 5972; Metazoa - 32664; Fungi - 6701; Plants - 16849; Viruses - 382; Other Eukaryotes - 14589 (source: NCBI BLink).  |
AT1G64850 | AT1G64850.1 | TTAAGGCCCATTTGAGCCCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37445.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G65000 | AT1G65000.1 | CCCAATAAGCCCATTAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, pollen tube, stamen; EXPRESSED DURING: 4 anthesis; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38060.1); Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G65370 | AT1G65370.1 | TTTAGGCCCATTC | meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65150.2); Has 227 Blast hits to 224 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 220; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G65820 | AT1G65820.1 | TATGGGCCTAAA | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).  |
AT1G65820.2 | TATGGGCCTAAA | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).  | |
AT1G65820.3 | TATGGGCCTAAA | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).  | |
AT1G66500 | AT1G66500.1 | ACAGGCCCATTAA | zinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 85; Plants - 35; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT1G66530 | AT1G66530.1 | ATAATGGGCCTCT | arginyl-tRNA synthetase, putative / arginine--tRNA ligase, putative; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, arginine-tRNA ligase activity, ATP binding; INVOLVED IN: arginyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), DALR anticodon binding (InterPro:IPR008909), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Arginyl-tRNA synthetase, class Ic, core (InterPro:IPR015945), Arginyl tRNA synthetase, class Ic, N-terminal (InterPro:IPR005148), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Arginyl-tRNA synthetase, class Ic (InterPro:IPR001278); BEST Arabidopsis thaliana protein match is: emb1027 (embryo defective 1027); ATP binding / aminoacyl-tRNA ligase/ arginine-tRNA ligase/ nucleotide binding (TAIR:AT4G26300.1); Has 6538 Blast hits to 6477 proteins in 1602 species: Archae - 156; Bacteria - 2983; Metazoa - 242; Fungi - 116; Plants - 35; Viruses - 3; Other Eukaryotes - 3003 (source: NCBI BLink).  |
AT1G66530.1 | CATGGGCCTTAT | arginyl-tRNA synthetase, putative / arginine--tRNA ligase, putative; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, arginine-tRNA ligase activity, ATP binding; INVOLVED IN: arginyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), DALR anticodon binding (InterPro:IPR008909), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Arginyl-tRNA synthetase, class Ic, core (InterPro:IPR015945), Arginyl tRNA synthetase, class Ic, N-terminal (InterPro:IPR005148), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Arginyl-tRNA synthetase, class Ic (InterPro:IPR001278); BEST Arabidopsis thaliana protein match is: emb1027 (embryo defective 1027); ATP binding / aminoacyl-tRNA ligase/ arginine-tRNA ligase/ nucleotide binding (TAIR:AT4G26300.1); Has 6538 Blast hits to 6477 proteins in 1602 species: Archae - 156; Bacteria - 2983; Metazoa - 242; Fungi - 116; Plants - 35; Viruses - 3; Other Eukaryotes - 3003 (source: NCBI BLink).  | |
AT1G67250 | AT1G67250.1 | TTAATGGGCCTTAG | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT5G38650.1); Has 170 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 2; Plants - 63; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT1G67430 | AT1G67430.1 | CAAGGCCCATTTA | 60S ribosomal protein L17 (RPL17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17A) (TAIR:AT1G27400.1); Has 1644 Blast hits to 1644 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  |
AT1G67660 | AT1G67660.1 | ATTGGGCTTCATGGGCCTTAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative phage-type endonuclease (InterPro:IPR017482), Exonuclease, phage-type/RecB, C-terminal (InterPro:IPR011604), Restriction endonuclease, type II-like, core (InterPro:IPR011335); BEST Arabidopsis thaliana protein match is: DNA binding / nuclease (TAIR:AT1G13810.1); Has 366 Blast hits to 366 proteins in 59 species: Archae - 0; Bacteria - 65; Metazoa - 25; Fungi - 0; Plants - 35; Viruses - 27; Other Eukaryotes - 214 (source: NCBI BLink).  |
AT1G67660.2 | ATTGGGCTTCATGGGCCTTAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative phage-type endonuclease (InterPro:IPR017482), Exonuclease, phage-type/RecB, C-terminal (InterPro:IPR011604), Restriction endonuclease, type II-like, core (InterPro:IPR011335); BEST Arabidopsis thaliana protein match is: DNA binding / nuclease (TAIR:AT1G13810.1); Has 366 Blast hits to 366 proteins in 59 species: Archae - 0; Bacteria - 65; Metazoa - 25; Fungi - 0; Plants - 35; Viruses - 27; Other Eukaryotes - 214 (source: NCBI BLink).  | |
AT1G67680 | AT1G67680.1 | AAAGGCCCATATAAAAAGCCCATTAA | 7S RNA binding; FUNCTIONS IN: 7S RNA binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP72 subunit, RNA-binding (InterPro:IPR013699); BEST Arabidopsis thaliana protein match is: 7S RNA binding (TAIR:AT1G67650.1); Has 525 Blast hits to 512 proteins in 165 species: Archae - 12; Bacteria - 42; Metazoa - 217; Fungi - 108; Plants - 25; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT1G68300 | AT1G68300.1 | TCAGGCCCATC | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: ethylene-responsive protein, putative (TAIR:AT1G09740.1); Has 4247 Blast hits to 4068 proteins in 895 species: Archae - 347; Bacteria - 3225; Metazoa - 46; Fungi - 59; Plants - 390; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).  |
AT1G68310 | AT1G68310.1 | GATGGGCCTGA | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized.  |
AT1G68310.2 | GATGGGCCTGA | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized.  | |
AT1G68830 | AT1G68830.1 | TTAATGGGCCTAAA | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation  |
AT1G69620 | AT1G69620.1 | AGATGGGCCTTTGGGCCAA | putative 60S ribosomal protein L34  |
AT1G69680 | AT1G69680.1 | AGATGGGCCTGGGCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Ran-interacting Mog1 protein (InterPro:IPR007681), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 202 Blast hits to 202 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 83; Plants - 25; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
AT1G69740 | AT1G69740.1 | ACAGGCCCATTAA | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.  |
AT1G69740.2 | ACAGGCCCATTAA | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.  | |
AT1G69770 | AT1G69770.1 | AGATGGGCCTCA | Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing.  |
AT1G69900 | AT1G69900.1 | TATAGGCCCATG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF569 (InterPro:IPR007679), Actin_cross-linking (InterPro:IPR008999); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27100.1); Has 142 Blast hits to 77 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G70600 | AT1G70600.1 | GGGCCTAAAGGCCCATCT | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15 (InterPro:IPR001196); BEST Arabidopsis thaliana protein match is: RPL27AB; structural constituent of ribosome (TAIR:AT1G23290.1); Has 825 Blast hits to 825 proteins in 317 species: Archae - 121; Bacteria - 11; Metazoa - 289; Fungi - 107; Plants - 96; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).  |
AT1G70610 | AT1G70610.1 | AGATGGGCCTTTAGGCCC | member of TAP subfamily  |
AT1G70980 | AT1G70980.1 | AAGGCCCATG | SYNC3; FUNCTIONS IN: in 6 functions; INVOLVED IN: asparaginyl-tRNA aminoacylation, aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Asparaginyl-tRNA synthetase, class IIb (InterPro:IPR004522), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: SYNC1; ATP binding / aminoacyl-tRNA ligase/ asparagine-tRNA ligase/ aspartate-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT5G56680.1); Has 10794 Blast hits to 8026 proteins in 1494 species: Archae - 413; Bacteria - 7139; Metazoa - 538; Fungi - 533; Plants - 135; Viruses - 0; Other Eukaryotes - 2036 (source: NCBI BLink).  |
AT1G71260 | AT1G71260.1 | TAAAGGCCCATTGGGCCGTTAAA | Encodes a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to mitochondria and not the nucleus.  |
AT1G71270 | AT1G71270.1 | TTTAACGGCCCAATGGGCCTTTA | Encodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network.  |
AT1G71500 | AT1G71500.1 | AGAGGCCCATATA | Rieske (2Fe-2S) domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske [2Fe-2S] region (InterPro:IPR005806); Has 207 Blast hits to 207 proteins in 61 species: Archae - 0; Bacteria - 101; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
AT1G71500.1 | CAAGGCCCATTG | Rieske (2Fe-2S) domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske [2Fe-2S] region (InterPro:IPR005806); Has 207 Blast hits to 207 proteins in 61 species: Archae - 0; Bacteria - 101; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  | |
AT1G71780 | AT1G71780.1 | ATACCCTTTAGGCCCATCATAAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G72020 | AT1G72020.1 | TAAATGGGCCTGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G72090 | AT1G72090.1 | TCGACCCGACCCAGGCCCATTA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), Aldolase-type TIM barrel (InterPro:IPR013785), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792), MiaB-like tRNA modifying enzyme, archaeal-type (InterPro:IPR006466); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT4G36390.1); Has 10341 Blast hits to 10323 proteins in 1298 species: Archae - 269; Bacteria - 4639; Metazoa - 269; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5110 (source: NCBI BLink).  |
AT1G72480 | AT1G72480.1 | AAGGCCCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01070.1); Has 422 Blast hits to 420 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 208; Fungi - 101; Plants - 83; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
AT1G73350 | AT1G73350.1 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G73350.2 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G73350.3 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G73930 | AT1G73930.1 | TGATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 216 Blast hits to 196 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 22; Plants - 20; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT1G73930.2 | TGATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 216 Blast hits to 196 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 22; Plants - 20; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  | |
AT1G74260 | AT1G74260.1 | ATCGGCCCTTAGGCCCATTAG | Encodes formylglycinamidine ribonucleotide synthase an enzyme involved in de novo purine biosynthesis. PUR4 is localizes to the chloroplast and mitochondria. Loss of PUR4 function affects male but not female gametophyte development.  |
AT1G74270 | AT1G74270.1 | TTAAGGCCCATAAGCCCATA | 60S ribosomal protein L35a (RPL35aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aA) (TAIR:AT1G07070.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT1G74280 | AT1G74280.1 | AAGCCCTAATATGGGCTTATGGGCCTTAA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT1G74290.1); Has 506 Blast hits to 505 proteins in 118 species: Archae - 4; Bacteria - 217; Metazoa - 4; Fungi - 28; Plants - 184; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  |
AT1G75330 | AT1G75330.1 | AAATGGGCCTAG | ORNITHINE CARBAMOYLTRANSFERASE (OTC); FUNCTIONS IN: amino acid binding, ornithine carbamoyltransferase activity, carboxyl- or carbamoyltransferase activity; INVOLVED IN: amino acid metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (InterPro:IPR006132), Aspartate/ornithine carbamoyltransferase (InterPro:IPR006130), Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding region (InterPro:IPR006131), Ornithine carbamoyltransferase (InterPro:IPR002292); BEST Arabidopsis thaliana protein match is: aspartate carabmoyltransferase, chloroplast / aspartate transcarbamylase / ATCase (PYRB) (TAIR:AT3G20330.1); Has 11337 Blast hits to 11337 proteins in 1659 species: Archae - 346; Bacteria - 6031; Metazoa - 180; Fungi - 195; Plants - 66; Viruses - 6; Other Eukaryotes - 4513 (source: NCBI BLink).  |
AT1G75510 | AT1G75510.1 | ATATGGGCCTTGGCCTATT | transcription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT1G76050 | AT1G76050.1 | TTAAGGCCCATTTA | pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink).  |
AT1G76050.2 | TTAAGGCCCATTTA | pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink).  | |
AT1G76200 | AT1G76200.1 | AAATGGGCCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 29; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT1G76730 | AT1G76730.1 | AAAAGGCCCATTTA | 5-formyltetrahydrofolate cyclo-ligase family protein; FUNCTIONS IN: catalytic activity, ATP binding, 5-formyltetrahydrofolate cyclo-ligase activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 5-formyltetrahydrofolate cyclo-ligase (InterPro:IPR002698); Has 270 Blast hits to 270 proteins in 109 species: Archae - 50; Bacteria - 73; Metazoa - 104; Fungi - 6; Plants - 17; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT1G76740 | AT1G76740.1 | TAAATGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76840.1); Has 3136 Blast hits to 2432 proteins in 274 species: Archae - 9; Bacteria - 251; Metazoa - 1340; Fungi - 208; Plants - 114; Viruses - 8; Other Eukaryotes - 1206 (source: NCBI BLink).  |
AT1G76860 | AT1G76860.1 | TTATGGGCCTAAT | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G21190.1); Has 944 Blast hits to 944 proteins in 205 species: Archae - 232; Bacteria - 0; Metazoa - 303; Fungi - 144; Plants - 105; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).  |
AT1G76940 | AT1G76940.1 | TAAATGGGCCTTAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT1G77030 | AT1G77030.1 | TTAATGGGCCTTAATGG | ATP binding / ATP-dependent helicase/ RNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DBP10CT (InterPro:IPR012541), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 46457 Blast hits to 14119 proteins in 1029 species: Archae - 31; Bacteria - 19714; Metazoa - 12532; Fungi - 2798; Plants - 5760; Viruses - 615; Other Eukaryotes - 5007 (source: NCBI BLink).  |
AT1G77060 | AT1G77060.1 | TAAAGGCCCATTT | mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G21440.1); Has 6429 Blast hits to 6429 proteins in 855 species: Archae - 72; Bacteria - 2891; Metazoa - 29; Fungi - 318; Plants - 109; Viruses - 0; Other Eukaryotes - 3010 (source: NCBI BLink).  |
AT1G77420 | AT1G77420.1 | TGAGGCCCATCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink).  |
AT1G77440 | AT1G77440.1 | GAGGCCCATCA | Encodes beta subunit of 20s proteosome complex which is involved in protein degradation.  |
AT1G77540 | AT1G77540.1 | AATAGGCCCATTAATAGGCCC | Encodes a H3/H4 histone acetyltransferase. Belongs to the GNAT family, whose many members are involved in histone acetylation and chromatin remodeling, and are important for the regulation of cell growth and development.  |
AT1G77600 | AT1G77600.1 | AGTTGGGCCTGTAGGCCCATATA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G47690.3); Has 420 Blast hits to 371 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 153; Fungi - 83; Plants - 153; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT1G77710 | AT1G77710.1 | AAATGGGCCTAAAATGGGCCTGA | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-like, Ufm1 (InterPro:IPR005375); Has 170 Blast hits to 170 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT1G78190 | AT1G78190.1 | AAAAGGCCCATTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22270.1); Has 285 Blast hits to 285 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT1G78190.1 | TTATGGGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22270.1); Has 285 Blast hits to 285 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  | |
AT1G78870 | AT1G78870.1 | ATATGGGCCTCA | UBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B.  |
AT1G78870.2 | ATATGGGCCTCA | UBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B.  | |
AT1G78870.3 | ATATGGGCCTCA | UBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B.  | |
AT1G78920 | AT1G78920.1 | TTTTGGGCTAGGCCCATATA | vacuolar-type H+-translocating inorganic pyrophosphatase  |
AT1G78920.2 | TTTTGGGCTAGGCCCATATA | vacuolar-type H+-translocating inorganic pyrophosphatase  | |
AT1G79590 | AT1G79590.1 | TAAATGGGCCTTAA | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  |
AT1G79590.2 | TAAATGGGCCTTAA | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  | |
AT1G79610 | AT1G79610.1 | ATTAGGCCCATAAAAGCCCAAAA | sodium proton exchanger, putative (NHX6); FUNCTIONS IN: solute:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: cation transport, sodium ion transport, regulation of pH; LOCATED IN: integral to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: NHX5; sodium ion transmembrane transporter/ sodium:hydrogen antiporter (TAIR:AT1G54370.1); Has 4010 Blast hits to 4005 proteins in 1041 species: Archae - 71; Bacteria - 2418; Metazoa - 735; Fungi - 95; Plants - 280; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink).  |
AT1G79810 | AT1G79810.1 | ATATGGGCCTTTT | Dominant suppressor of det1 phenotypes. Encodes a peroxisomal protein essential for Arabidopsis growth. Inserted directly from the cytosol into peroxisomes.  |
AT1G79810.1 | TATGGGCCTATT | Dominant suppressor of det1 phenotypes. Encodes a peroxisomal protein essential for Arabidopsis growth. Inserted directly from the cytosol into peroxisomes.  | |
AT1G79810.2 | ATATGGGCCTTTT | Dominant suppressor of det1 phenotypes. Encodes a peroxisomal protein essential for Arabidopsis growth. Inserted directly from the cytosol into peroxisomes.  | |
AT1G79810.2 | TATGGGCCTATT | Dominant suppressor of det1 phenotypes. Encodes a peroxisomal protein essential for Arabidopsis growth. Inserted directly from the cytosol into peroxisomes.  | |
AT1G79870 | AT1G79870.1 | TTATGGGCCCAAAAATAGGCCCATCT | oxidoreductase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19936 Blast hits to 19933 proteins in 1515 species: Archae - 283; Bacteria - 9447; Metazoa - 662; Fungi - 752; Plants - 323; Viruses - 5; Other Eukaryotes - 8464 (source: NCBI BLink).  |
AT1G80550 | AT1G80550.1 | TGATGGGCCTAAG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).  |
AT1G80770 | AT1G80770.1 | AGAGGCCCATTAG | pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink).  |
AT2G01090 | AT2G01090.1 | ACAGGCCCATAT | ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT1G15120.1); Has 95 Blast hits to 95 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT2G01110 | AT2G01110.1 | TAATGGGCCTTAT | mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein.  |
AT2G01120 | AT2G01120.1 | ATAAGGCCCATTA | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b.  |
AT2G01180 | AT2G01180.1 | AAGGCCCATAATAAGGCCTAAT | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  |
AT2G01180.2 | AAGGCCCATAATAAGGCCTAAT | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  | |
AT2G01250 | AT2G01250.1 | TGAGGCCCATA | 60S ribosomal protein L7 (RPL7B); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7C) (TAIR:AT2G44120.2); Has 979 Blast hits to 977 proteins in 287 species: Archae - 144; Bacteria - 0; Metazoa - 384; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  |
AT2G01250.2 | TGAGGCCCATA | 60S ribosomal protein L7 (RPL7B); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7C) (TAIR:AT2G44120.2); Has 979 Blast hits to 977 proteins in 287 species: Archae - 144; Bacteria - 0; Metazoa - 384; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  | |
AT2G01400 | AT2G01400.1 | CTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G01470 | AT2G01470.1 | TAATGGGCCTTAA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER.  |
AT2G01470.1 | TGATGGGCCTATA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER.  | |
AT2G01650 | AT2G01650.1 | TTGGCCCAAAAGGCCCATTAA | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo.  |
AT2G02350 | AT2G02350.1 | AAAAGGCCCATAT | encodes a protein containing an F-box domain and physically interacts with SCF subunit SKP1/ASK1. The protein also exhibits similarity in sequence to phloem protein 2 (PP2) from cucumber.  |
AT2G02500 | AT2G02500.1 | TTAATGGGCCTGATGGGCTTAT | Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity).  |
AT2G02500.1 | TTATGGGCCTTATTAAAAGCCCATTAG | Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity).  | |
AT2G02510 | AT2G02510.1 | ATAAGCCCATCAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G02510.1 | CTAATGGGCTTTTAATAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G02880 | AT2G02880.1 | TTAAGGCCCATTTA | mucin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62270.1); Has 72 Blast hits to 72 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT2G03200 | AT2G03200.1 | ATTAGGCCCATATA | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: CDR1 (CONSTITUTIVE DISEASE RESISTANCE 1); aspartic-type endopeptidase (TAIR:AT5G33340.1); Has 1708 Blast hits to 1685 proteins in 189 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 322; Plants - 1102; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT2G03270 | AT2G03270.1 | AAATGGGCCTAAA | DNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae - 141; Bacteria - 1267; Metazoa - 1124; Fungi - 651; Plants - 305; Viruses - 8; Other Eukaryotes - 902 (source: NCBI BLink).  |
AT2G03430 | AT2G03430.1 | AAAAGGCCCATAAACGGGCCCAATAT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink).  |
AT2G04030 | AT2G04030.1 | TATAGGCCCATTAT | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR.  |
AT2G04030.2 | TATAGGCCCATTAT | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR.  | |
AT2G04378 | AT2G04378.1 | CAGGCCCATGG | beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G04378.2 | CAGGCCCATGG | beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G04390 | AT2G04390.1 | CCATGGGCCTG | 40S ribosomal protein S17 (RPS17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus, plasma membrane; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT2G05920 | AT2G05920.1 | AAATGGGCCTGA | subtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae - 130; Bacteria - 2232; Metazoa - 135; Fungi - 512; Plants - 867; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink).  |
AT2G11890 | AT2G11890.1 | TATATGGGCCTAG | adenylate cyclase  |
AT2G11890.2 | TATATGGGCCTAG | adenylate cyclase  | |
AT2G16780 | AT2G16780.1 | GAATGGGCTTTACAGGCCCATAA | Encodes a WD-40 repeat protein similar to yeast MSI1.  |
AT2G17870 | AT2G17870.1 | AATAGGCCCATTT | cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink).  |
AT2G17870.1 | CCATGGGCCTGA | cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink).  | |
AT2G17975 | AT2G17975.1 | TTAATGGGCCTAATGGGCCTAG | zinc finger (Ran-binding) family protein; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: zinc finger (Ran-binding) family protein (TAIR:AT5G25490.1); Has 893 Blast hits to 535 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 304; Fungi - 62; Plants - 313; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink).  |
AT2G17980 | AT2G17980.1 | CTAGGCCCATTAGGCCCATTAA | member of SLY1 Gene Family  |
AT2G18020 | AT2G18020.1 | CTTAGGCCCATTAG | embryo defective 2296 (EMB2296); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: in 7 components; EXPRESSED IN: male gametophyte, guard cell, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein L2, domain 3 (InterPro:IPR014726), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L8 (RPL8C) (TAIR:AT4G36130.1); Has 7419 Blast hits to 7417 proteins in 2201 species: Archae - 236; Bacteria - 3117; Metazoa - 334; Fungi - 188; Plants - 928; Viruses - 0; Other Eukaryotes - 2616 (source: NCBI BLink).  |
AT2G18390 | AT2G18390.1 | CAAGGCCCATA | Encodes a member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Mutant has abnormal mitosis and cell cycle control during seed development.  |
AT2G18510 | AT2G18510.1 | CTTAATGGGCTTATAGGCCCATTAG | embryo defective 2444 (emb2444); FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: PAB8 (POLY(A) BINDING PROTEIN 8); RNA binding / translation initiation factor (TAIR:AT1G49760.1); Has 56184 Blast hits to 33244 proteins in 1255 species: Archae - 48; Bacteria - 4095; Metazoa - 27429; Fungi - 7959; Plants - 8932; Viruses - 890; Other Eukaryotes - 6831 (source: NCBI BLink).  |
AT2G19560 | AT2G19560.1 | ATATGGGCCTTAAATGGCCCAACT | encodes a protein with a PAM domain involved in ethylene signaling. eer5 mutants show ethylene hypersensitivity in relation to hypocotyl elongation. EER5 interacts with EIN2 and with COP9 in Y2H assays. EIN3 protein levels are the same in WT and eer5-1 mutants. EER5 may be involved in promoting a dampening of the ethylene response.  |
AT2G19740 | AT2G19740.1 | AAAAGCCCATCAGGCCCATA | 60S ribosomal protein L31 (RPL31A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, chloroplast, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31C) (TAIR:AT5G56710.1); Has 851 Blast hits to 851 proteins in 263 species: Archae - 99; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink).  |
AT2G19750 | AT2G19750.1 | TTAAGGCCCATTTA | 40S ribosomal protein S30 (RPS30A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT2G20330 | AT2G20330.1 | TAAATGGGCCTTTA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 23940 Blast hits to 14550 proteins in 496 species: Archae - 38; Bacteria - 4162; Metazoa - 9990; Fungi - 4392; Plants - 2081; Viruses - 20; Other Eukaryotes - 3257 (source: NCBI BLink).  |
AT2G20360 | AT2G20360.1 | CAAGGCCCAGGCCCATTT | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink).  |
AT2G20450 | AT2G20450.1 | TTAATGGGCCTTTAA | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT2G20480 | AT2G20480.1 | CAATGGGCCTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G20490 | AT2G20490.1 | GTAGGCCCATTG | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT2G20490.2 | GTAGGCCCATTG | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  | |
AT2G20530 | AT2G20530.1 | CTAATGGGCCTGA | PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink).  |
AT2G20530.2 | CTAATGGGCCTGA | PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink).  | |
AT2G20860 | AT2G20860.1 | TTAATGGGCCTAC | LIP1,Lipoic acid synthase,  |
AT2G20890 | AT2G20890.1 | TAAATGGGCCTAAT | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membranedelimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex.  |
AT2G21150 | AT2G21150.1 | AAAGGCCCATAA | XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. Nuclear localized.  |
AT2G21280 | AT2G21280.1 | TAAATGGGCCTTAA | A nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system.  |
AT2G21290 | AT2G21290.1 | TTAAGGCCCATTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G22610 | AT2G22610.1 | CAAGGCCCATG | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT1G72250.1); Has 61125 Blast hits to 37324 proteins in 1305 species: Archae - 470; Bacteria - 4361; Metazoa - 29529; Fungi - 3969; Plants - 2072; Viruses - 206; Other Eukaryotes - 20518 (source: NCBI BLink).  |
AT2G23090 | AT2G23090.1 | AAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1909 (InterPro:IPR015023); Has 104 Blast hits to 104 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 33; Plants - 46; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT2G23120 | AT2G23120.1 | AAAAGGCCCATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein 18 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23110.1); Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G23390 | AT2G23390.1 | TTAATGGGCCTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF482 (InterPro:IPR007434), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 1806 Blast hits to 1806 proteins in 374 species: Archae - 0; Bacteria - 707; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 1084 (source: NCBI BLink).  |
AT2G23440 | AT2G23440.1 | CCCATGGGCCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G23940 | AT2G23940.1 | CTTAGGCCCATATA | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30500.1); Has 231 Blast hits to 231 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 70; Plants - 27; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT2G24395 | AT2G24395.1 | TTAATGGGCCTT | chaperone protein dnaJ-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G24490 | AT2G24490.1 | CTTAGGCCCATTT | Encodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1.  |
AT2G24490.2 | CTTAGGCCCATTT | Encodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1.  | |
AT2G24960 | AT2G24960.1 | AAAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 838 Blast hits to 293 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 21; Plants - 817; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G24960.2 | AAAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 838 Blast hits to 293 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 21; Plants - 817; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G25210 | AT2G25210.1 | TAAATGGGCCTTTGTGGCCCAAT | 60S ribosomal protein L39 (RPL39A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 574 Blast hits to 574 proteins in 219 species: Archae - 142; Bacteria - 0; Metazoa - 205; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
AT2G26140 | AT2G26140.1 | ATATGGGCCTTTA | encodes an FtsH protease that is localized to the mitochondrion  |
AT2G26240 | AT2G26240.1 | TTATGGGCCTAC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43520.1); Has 306 Blast hits to 306 proteins in 93 species: Archae - 0; Bacteria - 30; Metazoa - 172; Fungi - 29; Plants - 67; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT2G27030 | AT2G27030.1 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6.  |
AT2G27030.2 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6.  | |
AT2G27030.3 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6.  | |
AT2G27100 | AT2G27100.1 | AGATGGGCCTCT | Identified as a leaf form mutant by Redei having serrated leaves. Further analysis of the single loss of function allele indicated pleiotropic effects extending to many aspects of shoot development such as taller meristems, alterations in phase transition, phyllotaxy and branching. Encodes a single zinc finger containing protein that is expressed in meristems and organ primordia.  |
AT2G27680 | AT2G27680.1 | AGAGGCCCATAA | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G06690.1); Has 7113 Blast hits to 7107 proteins in 1067 species: Archae - 127; Bacteria - 5110; Metazoa - 109; Fungi - 309; Plants - 217; Viruses - 0; Other Eukaryotes - 1241 (source: NCBI BLink).  |
AT2G28000 | AT2G28000.1 | ACAGGCCCATA | Encodes chaperonin-60 alpha, a molecular chaperone involved in Rubisco folding. Mutants display aberrant chloroplast and embryo development.  |
AT2G28290 | AT2G28290.1 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  |
AT2G28290.2 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  | |
AT2G28290.3 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  | |
AT2G28480 | AT2G28480.1 | ATAATGGGCCTGT | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 212 Blast hits to 192 proteins in 26 species: Archae - 0; Bacteria - 3; Metazoa - 27; Fungi - 0; Plants - 169; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT2G29360 | AT2G29360.1 | GAGGCCCATTT | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29150.1); Has 83809 Blast hits to 83613 proteins in 2239 species: Archae - 475; Bacteria - 45716; Metazoa - 5149; Fungi - 4359; Plants - 1662; Viruses - 5; Other Eukaryotes - 26443 (source: NCBI BLink).  |
AT2G31370 | AT2G31370.1 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  |
AT2G31370.1 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.2 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.2 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.3 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.3 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.4 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.4 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.5 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.5 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G32380 | AT2G32380.1 | TTATGGGCCTAAGGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 102 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 9; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G32415 | AT2G32415.1 | AAATGGGCCTGT | 3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae - 0; Bacteria - 1374; Metazoa - 367; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 953 (source: NCBI BLink).  |
AT2G32480 | AT2G32480.1 | CAAGGCCCATA | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink).  |
AT2G32480.2 | CAAGGCCCATA | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink).  | |
AT2G33220 | AT2G33220.1 | ATATGGGCCTTTTAAAGCCCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, plastid, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: MEE4 (maternal effect embryo arrest 4) (TAIR:AT1G04630.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT2G33370 | AT2G33370.1 | CATGGGCCTAAAAGGCCTTTT | 60S ribosomal protein L23 (RPL23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14b/L23e (InterPro:IPR000218); BEST Arabidopsis thaliana protein match is: emb2171 (embryo defective 2171); structural constituent of ribosome (TAIR:AT3G04400.1); Has 6297 Blast hits to 6297 proteins in 1833 species: Archae - 236; Bacteria - 2977; Metazoa - 280; Fungi - 176; Plants - 586; Viruses - 0; Other Eukaryotes - 2042 (source: NCBI BLink).  |
AT2G33730 | AT2G33730.1 | CTAATGGGCCTAAA | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G28180.1); Has 105850 Blast hits to 52945 proteins in 1991 species: Archae - 661; Bacteria - 41429; Metazoa - 30663; Fungi - 9349; Plants - 3951; Viruses - 317; Other Eukaryotes - 19480 (source: NCBI BLink).  |
AT2G33730.1 | CTAATGGGCCTAAA | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G28180.1); Has 105850 Blast hits to 52945 proteins in 1991 species: Archae - 661; Bacteria - 41429; Metazoa - 30663; Fungi - 9349; Plants - 3951; Viruses - 317; Other Eukaryotes - 19480 (source: NCBI BLink).  | |
AT2G33840 | AT2G33840.1 | CTAATGGGCCTTT | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tyrosine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, tyrosyl-tRNA aminoacylation; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosine tRNA ligase, archaeal/eukaryotic (InterPro:IPR016485), Tyrosyl-tRNA synthetase, class Ib, archaeal/eukaryotic cytosolic (InterPro:IPR015624), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); BEST Arabidopsis thaliana protein match is: ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase (TAIR:AT1G28350.1); Has 3646 Blast hits to 3629 proteins in 1010 species: Archae - 254; Bacteria - 1669; Metazoa - 303; Fungi - 167; Plants - 79; Viruses - 5; Other Eukaryotes - 1169 (source: NCBI BLink).  |
AT2G33840.1 | TTAAGGCCCATA | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tyrosine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, tyrosyl-tRNA aminoacylation; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosine tRNA ligase, archaeal/eukaryotic (InterPro:IPR016485), Tyrosyl-tRNA synthetase, class Ib, archaeal/eukaryotic cytosolic (InterPro:IPR015624), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); BEST Arabidopsis thaliana protein match is: ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase (TAIR:AT1G28350.1); Has 3646 Blast hits to 3629 proteins in 1010 species: Archae - 254; Bacteria - 1669; Metazoa - 303; Fungi - 167; Plants - 79; Viruses - 5; Other Eukaryotes - 1169 (source: NCBI BLink).  | |
AT2G34940 | AT2G34940.1 | TTAATGGGCTAATGAGGCCCATTAAG | vacuolar sorting receptor, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: protein targeting to vacuole; LOCATED IN: integral to plasma membrane, Golgi transport complex; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), EGF-like calcium-binding, conserved site (InterPro:IPR018097), EGF-like calcium-binding (InterPro:IPR001881), Growth factor, receptor (InterPro:IPR009030); BEST Arabidopsis thaliana protein match is: vacuolar sorting receptor, putative (TAIR:AT1G30900.1); Has 9390 Blast hits to 4743 proteins in 196 species: Archae - 0; Bacteria - 100; Metazoa - 8560; Fungi - 5; Plants - 215; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink).  |
AT2G35320 | AT2G35320.1 | ATAATGGGCCTTTAATTGGGCCGA | homologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent.  |
AT2G35490 | AT2G35490.1 | ATAATGGGCCTGG | plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae - 0; Bacteria - 78; Metazoa - 1; Fungi - 0; Plants - 205; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT2G35490.1 | TCAGGCCCATTAG | plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae - 0; Bacteria - 78; Metazoa - 1; Fungi - 0; Plants - 205; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT2G35500 | AT2G35500.1 | CCAGGCCCATT | shikimate kinase-related; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); Has 282 Blast hits to 282 proteins in 67 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink).  |
AT2G35500.1 | CTAATGGGCCTGA | shikimate kinase-related; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); Has 282 Blast hits to 282 proteins in 67 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink).  | |
AT2G35720 | AT2G35720.1 | TTAAGGCCCATTAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT3G47940.1); Has 15787 Blast hits to 15749 proteins in 1885 species: Archae - 105; Bacteria - 5397; Metazoa - 3297; Fungi - 1386; Plants - 1147; Viruses - 13; Other Eukaryotes - 4442 (source: NCBI BLink).  |
AT2G36070 | AT2G36070.1 | TATATGGGCCTAAA | One of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP.  |
AT2G36485 | AT2G36485.1 | TAAATGGGCCTAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: PCFS4 (PCF11P-SIMILAR PROTEIN 4); zinc ion binding (TAIR:AT4G04885.1); Has 87 Blast hits to 87 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 33; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G36485.1 | TGATGGGCCTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: PCFS4 (PCF11P-SIMILAR PROTEIN 4); zinc ion binding (TAIR:AT4G04885.1); Has 87 Blast hits to 87 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 33; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G36620 | AT2G36620.1 | AAAAGGCCCATTAA | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020).  |
AT2G36680 | AT2G36680.1 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  |
AT2G36680.2 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  | |
AT2G36680.3 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  | |
AT2G36680.4 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  | |
AT2G36900 | AT2G36900.1 | ATATGGGCCTAAC | member of Membrin Gene Family  |
AT2G36900.1 | TCAGGCCCATAA | member of Membrin Gene Family  | |
AT2G36900.2 | ATATGGGCCTAAC | member of Membrin Gene Family  | |
AT2G36900.2 | TCAGGCCCATAA | member of Membrin Gene Family  | |
AT2G36930 | AT2G36930.1 | TAAATGGGCCTTG | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type (InterPro:IPR007087); Has 506 Blast hits to 289 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 257; Fungi - 153; Plants - 39; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  |
AT2G36930.1 | TTAATGGGCCTAT | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type (InterPro:IPR007087); Has 506 Blast hits to 289 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 257; Fungi - 153; Plants - 39; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  | |
AT2G37160 | AT2G37160.1 | TAATGGGCCTATA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae - 36; Bacteria - 3543; Metazoa - 4573; Fungi - 2572; Plants - 1053; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink).  |
AT2G37160.2 | TAATGGGCCTATA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae - 36; Bacteria - 3543; Metazoa - 4573; Fungi - 2572; Plants - 1053; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink).  | |
AT2G37230 | AT2G37230.1 | CTAGGCCCATCT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02060.1); Has 17936 Blast hits to 5762 proteins in 186 species: Archae - 4; Bacteria - 20; Metazoa - 375; Fungi - 355; Plants - 16510; Viruses - 0; Other Eukaryotes - 672 (source: NCBI BLink).  |
AT2G37340 | AT2G37340.1 | TAAATGGGCCTTAT | encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks.  |
AT2G39445 | AT2G39445.1 | TTAAAGGCCCATTCGAGGCCCAACA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: PIG-P (InterPro:IPR013717), Phosphatidylinositol N-acetylglucosaminyltransferase, GPI19/PIG-P subunit (InterPro:IPR016542); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61280.1); Has 228 Blast hits to 228 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 60; Plants - 24; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT2G39460 | AT2G39460.1 | AAAAGGCCCATTAT | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.  |
AT2G39460.1 | AAAAGGCCCATTTA | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.  | |
AT2G39460.2 | AAAAGGCCCATTAT | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.  | |
AT2G39460.2 | AAAAGGCCCATTTA | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.  | |
AT2G39805 | AT2G39805.1 | ATATGGGCCTTT | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT2G39805.1 | ATATGGGCCTTTG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G39805.2 | ATATGGGCCTTT | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G39805.2 | ATATGGGCCTTTG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G40113 | AT2G40113.1 | GAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47635.1); Has 27 Blast hits to 27 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G40205 | AT2G40205.1 | AAAAGGCCCATAT | 60S ribosomal protein L41 (RPL41C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT2G40205.1 | AAAAGGCCCATATA | 60S ribosomal protein L41 (RPL41C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT2G40316 | AT2G40316.1 | AAGGCCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT2G40316.2 | AAGGCCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT2G40380 | AT2G40380.1 | TATAGGCCCATAA | PRENYLATED RAB ACCEPTOR 1.B2 (PRA1.B2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 382 Blast hits to 382 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 64; Plants - 187; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
AT2G40600 | AT2G40600.1 | TCAGGCCCATAA | appr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT1G69340.1); Has 2324 Blast hits to 2216 proteins in 788 species: Archae - 117; Bacteria - 1020; Metazoa - 576; Fungi - 86; Plants - 56; Viruses - 292; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT2G40650 | AT2G40650.1 | ATAATGGGCCTAG | pre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae - 56; Bacteria - 20349; Metazoa - 26407; Fungi - 5687; Plants - 2913; Viruses - 323; Other Eukaryotes - 11922 (source: NCBI BLink).  |
AT2G40660 | AT2G40660.1 | CTAGGCCCATTAT | tRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae - 158; Bacteria - 2173; Metazoa - 404; Fungi - 148; Plants - 87; Viruses - 1; Other Eukaryotes - 649 (source: NCBI BLink).  |
AT2G40830 | AT2G40830.1 | ACAGGCCCATC | Encodes a putative RING-H2 finger protein RHC1a.  |
AT2G40830.1 | ACAGGCCCATCA | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G40830.1 | CAAGGCCCATAA | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G40830.2 | ACAGGCCCATC | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G40830.2 | ACAGGCCCATCA | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G40830.2 | CAAGGCCCATAA | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G40830.3 | ACAGGCCCATC | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G40830.3 | ACAGGCCCATCA | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G40830.3 | CAAGGCCCATAA | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G41060 | AT2G41060.1 | TATATGGGCCTCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UBP1 interacting protein 2a (UBA2a) (TAIR:AT3G56860.3); Has 17419 Blast hits to 11431 proteins in 532 species: Archae - 0; Bacteria - 698; Metazoa - 10129; Fungi - 1624; Plants - 2756; Viruses - 123; Other Eukaryotes - 2089 (source: NCBI BLink).  |
AT2G41060.2 | TATATGGGCCTCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UBP1 interacting protein 2a (UBA2a) (TAIR:AT3G56860.3); Has 17419 Blast hits to 11431 proteins in 532 species: Archae - 0; Bacteria - 698; Metazoa - 10129; Fungi - 1624; Plants - 2756; Viruses - 123; Other Eukaryotes - 2089 (source: NCBI BLink).  | |
AT2G41840 | AT2G41840.1 | TCAGGCCCATTTAAGCCCACT | 40S ribosomal protein S2 (RPS2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 9044 Blast hits to 7622 proteins in 1716 species: Archae - 183; Bacteria - 3055; Metazoa - 2026; Fungi - 746; Plants - 385; Viruses - 17; Other Eukaryotes - 2632 (source: NCBI BLink).  |
AT2G42160 | AT2G42160.1 | CTAAGGCCCATTAA | zinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae - 0; Bacteria - 7; Metazoa - 531; Fungi - 172; Plants - 57; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink).  |
AT2G42370 | AT2G42370.1 | ATATGGGCCTCT | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58110.1); Has 174 Blast hits to 159 proteins in 47 species: Archae - 3; Bacteria - 17; Metazoa - 67; Fungi - 5; Plants - 22; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT2G43640 | AT2G43640.1 | TACTGGGCCTAATAAGGCCCATTAT | signal recognition particle 14 kDa family protein / SRP14 family protein; FUNCTIONS IN: 7S RNA binding, protein binding, endoplasmic reticulum signal peptide binding, RNA binding; INVOLVED IN: negative regulation of translational elongation, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP14 subunit (InterPro:IPR003210), Signal recognition particle, SRP9/SRP14 subunit (InterPro:IPR009018); Has 170 Blast hits to 170 proteins in 73 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 27; Plants - 26; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT2G43640.2 | TACTGGGCCTAATAAGGCCCATTAT | signal recognition particle 14 kDa family protein / SRP14 family protein; FUNCTIONS IN: 7S RNA binding, protein binding, endoplasmic reticulum signal peptide binding, RNA binding; INVOLVED IN: negative regulation of translational elongation, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP14 subunit (InterPro:IPR003210), Signal recognition particle, SRP9/SRP14 subunit (InterPro:IPR009018); Has 170 Blast hits to 170 proteins in 73 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 27; Plants - 26; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  | |
AT2G44640 | AT2G44640.1 | AAAAGGCCCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT2G44640.1 | CAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT2G44680 | AT2G44680.1 | ATAAGGCCCATC | Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock.  |
AT2G44680.2 | ATAAGGCCCATC | Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock.  | |
AT2G45530 | AT2G45530.1 | GTAGGCCCATTTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G37950.1); Has 621 Blast hits to 621 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 262; Fungi - 5; Plants - 312; Viruses - 3; Other Eukaryotes - 39 (source: NCBI BLink).  |
AT2G45640 | AT2G45640.1 | AAAAGGCCCATTAG | Involved in the regulation of salt stress. Expression of AtSAP18 is induced by NaCl, cold, drought, ABA, and ethylene treatment. AtSAP18 and HDA19 associate with ERF3 and ERF4 both in vitro and in vivo.  |
AT2G46180 | AT2G46180.1 | CTAGGCCCATAT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein.  |
AT2G46180.1 | TAAAGGCCCATCT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein.  | |
AT2G46230 | AT2G46230.1 | ATTAGGCCCATTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT2G46230.2 | ATTAGGCCCATTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT2G46470 | AT2G46470.1 | TTAAGGCCCATTAAG | INNER MEMBRANE PROTEIN OXA1-LIKE (OXA1L); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein import into mitochondrial inner membrane; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 60 kDa inner membrane insertion protein (InterPro:IPR001708); BEST Arabidopsis thaliana protein match is: OXA1; P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT5G62050.1); Has 4383 Blast hits to 4383 proteins in 1328 species: Archae - 0; Bacteria - 2560; Metazoa - 212; Fungi - 138; Plants - 111; Viruses - 0; Other Eukaryotes - 1362 (source: NCBI BLink).  |
AT2G46580 | AT2G46580.1 | ATAAGGCCTAATGGGCCTCA | pyridoxine 5'-phosphate oxidase-related; FUNCTIONS IN: FMN binding, pyridoxamine-phosphate oxidase activity; INVOLVED IN: pyridoxine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxamine 5'-phosphate oxidase (InterPro:IPR000659), FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002); Has 1089 Blast hits to 1089 proteins in 214 species: Archae - 0; Bacteria - 365; Metazoa - 49; Fungi - 36; Plants - 20; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink).  |
AT2G47120 | AT2G47120.1 | AGAGGCCCATTAA | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G47130.1); Has 80311 Blast hits to 80158 proteins in 2201 species: Archae - 468; Bacteria - 43770; Metazoa - 4463; Fungi - 4181; Plants - 1494; Viruses - 4; Other Eukaryotes - 25931 (source: NCBI BLink).  |
AT2G47840 | AT2G47840.1 | TATAGGCCCATTTA | tic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT2G47940 | AT2G47940.1 | AATAGGCCCATTAA | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.  |
AT2G47940.2 | AATAGGCCCATTAA | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.  | |
AT2G48100 | AT2G48100.1 | AAATGGGCCTTTAA | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  |
AT2G48100.2 | AAATGGGCCTTTAA | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  | |
AT2G48100.3 | AAATGGGCCTTTAA | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  | |
AT2G48100.4 | AAATGGGCCTTTAA | exonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  | |
AT2G48160 | AT2G48160.1 | CTAATGGGCCTCA | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G63070.1); Has 1292 Blast hits to 1135 proteins in 175 species: Archae - 2; Bacteria - 174; Metazoa - 679; Fungi - 194; Plants - 113; Viruses - 2; Other Eukaryotes - 128 (source: NCBI BLink).  |
AT3G01100 | AT3G01100.1 | TTAATGGGCCTTTT | unknown protein, has cDNAs and ESTs associated to it  |
AT3G01100.2 | TTAATGGGCCTTTT | unknown protein, has cDNAs and ESTs associated to it  | |
AT3G01130 | AT3G01130.1 | ATATGGGCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G01130.1 | TAAAGGCCCATATAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G01130.2 | ATATGGGCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G01130.2 | TAAAGGCCCATATAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G01320 | AT3G01320.1 | TAAATGGGCCTATT | Encodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190).  |
AT3G01370 | AT3G01370.1 | ATATGGGCCTAC | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing.  |
AT3G01540 | AT3G01540.1 | ATAATGGGCCTAG | RNA HELICASE DRH1  |
AT3G01540.2 | ATAATGGGCCTAG | RNA HELICASE DRH1  | |
AT3G01540.3 | ATAATGGGCCTAG | RNA HELICASE DRH1  | |
AT3G01540.4 | ATAATGGGCCTAG | RNA HELICASE DRH1  | |
AT3G02050 | AT3G02050.1 | AGCCCATAATGGGCCTGA | potassium transporter KUP3p (KUP3)  |
AT3G02050.1 | TAAATGGGCCTTG | potassium transporter KUP3p (KUP3)  | |
AT3G02080 | AT3G02080.1 | ATTAGGCCCATTAG | 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT3G02090 | AT3G02090.1 | CTAATGGGCCTAAT | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink).  |
AT3G02090.2 | CTAATGGGCCTAAT | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink).  | |
AT3G02450 | AT3G02450.1 | AAAAGGCCCATG | cell division protein ftsH, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH6 (FTSH PROTEASE 6); ATP-dependent peptidase/ ATPase/ metallopeptidase/ peptidase/ zinc ion binding (TAIR:AT5G15250.1); Has 29914 Blast hits to 28201 proteins in 1898 species: Archae - 923; Bacteria - 10733; Metazoa - 4167; Fungi - 2480; Plants - 1767; Viruses - 20; Other Eukaryotes - 9824 (source: NCBI BLink).  |
AT3G02540 | AT3G02540.1 | TTATGGGCCTAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  |
AT3G02540.2 | TTATGGGCCTAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  | |
AT3G02630 | AT3G02630.1 | TTATGGGCCTTAC | acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT5G16240.1); Has 567 Blast hits to 564 proteins in 126 species: Archae - 0; Bacteria - 200; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT3G03130 | AT3G03130.1 | ATAGGCCCATCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17160.1); Has 6511 Blast hits to 3260 proteins in 393 species: Archae - 10; Bacteria - 2333; Metazoa - 1613; Fungi - 601; Plants - 171; Viruses - 56; Other Eukaryotes - 1727 (source: NCBI BLink).  |
AT3G03130.1 | TTTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17160.1); Has 6511 Blast hits to 3260 proteins in 393 species: Archae - 10; Bacteria - 2333; Metazoa - 1613; Fungi - 601; Plants - 171; Viruses - 56; Other Eukaryotes - 1727 (source: NCBI BLink).  | |
AT3G03341 | AT3G03341.1 | TTAAGGCCCATCT | unknown protein; Has 48 Blast hits to 48 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 10; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G03920 | AT3G03920.1 | TGAGGCCCATTAG | Gar1 RNA-binding region family protein; FUNCTIONS IN: RNA binding, rRNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast thylakoid membrane, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gar1 protein RNA-binding region (InterPro:IPR007504); BEST Arabidopsis thaliana protein match is: Gar1 RNA-binding region family protein (TAIR:AT5G18180.1); Has 26246 Blast hits to 8264 proteins in 726 species: Archae - 15; Bacteria - 4613; Metazoa - 10704; Fungi - 2027; Plants - 5901; Viruses - 362; Other Eukaryotes - 2624 (source: NCBI BLink).  |
AT3G04160 | AT3G04160.1 | CTAATGGGCCTAATTAAATGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 1599 Blast hits to 1235 proteins in 157 species: Archae - 0; Bacteria - 45; Metazoa - 652; Fungi - 193; Plants - 164; Viruses - 0; Other Eukaryotes - 545 (source: NCBI BLink).  |
AT3G04230 | AT3G04230.1 | TTATGGGCCTT | 40S ribosomal protein S16 (RPS16B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16C) (TAIR:AT5G18380.1); Has 4667 Blast hits to 4667 proteins in 1442 species: Archae - 152; Bacteria - 2454; Metazoa - 279; Fungi - 125; Plants - 110; Viruses - 0; Other Eukaryotes - 1547 (source: NCBI BLink).  |
AT3G04560 | AT3G04560.1 | AAAAGGCCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 174 Blast hits to 172 proteins in 62 species: Archae - 0; Bacteria - 13; Metazoa - 84; Fungi - 25; Plants - 27; Viruses - 2; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT3G04620 | AT3G04620.1 | CTTAGGCCCATTTA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G29250.1); Has 89 Blast hits to 89 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT3G04620.1 | TCAGGCCCATTTA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G29250.1); Has 89 Blast hits to 89 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  | |
AT3G04920 | AT3G04920.1 | TGAGGCCCATA | 40S ribosomal protein S24 (RPS24A); FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S24e (InterPro:IPR001976), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal S24e conserved site (InterPro:IPR018098); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S24 (RPS24B) (TAIR:AT5G28060.1); Has 643 Blast hits to 643 proteins in 254 species: Archae - 56; Bacteria - 0; Metazoa - 305; Fungi - 103; Plants - 74; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT3G05060 | AT3G05060.1 | TCAGGCCCATTAA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein  |
AT3G05070 | AT3G05070.1 | TTAATGGGCCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink).  |
AT3G05590 | AT3G05590.1 | CAAGGCCCATCT | Encodes cytoplasmic ribosomal protein L18.  |
AT3G05730 | AT3G05730.1 | AGATGGGCCTTTAAAGGC | Encodes a defensin-like (DEFL) family protein.  |
AT3G05810 | AT3G05810.1 | TTAATGGGCTAGGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26800.1); Has 32 Blast hits to 32 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G06030 | AT3G06030.1 | AAAAAGCCCAATAAGAAGGCCCATTAAG | NPK1-related protein kinase 3  |
AT3G06270 | AT3G06270.1 | GGGCCTTAGGCCCATTAG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae - 2; Bacteria - 83; Metazoa - 1132; Fungi - 383; Plants - 1219; Viruses - 4; Other Eukaryotes - 863 (source: NCBI BLink).  |
AT3G06420 | AT3G06420.1 | AGAGGCCCATA | autophagy 8h (ATG8H); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8H (AUTOPHAGY 8H); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase/ microtubule binding (TAIR:AT3G15580.1); Has 1119 Blast hits to 1117 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 577; Fungi - 124; Plants - 171; Viruses - 3; Other Eukaryotes - 244 (source: NCBI BLink).  |
AT3G06470 | AT3G06470.1 | CAATGGGCCTAT | GNS1/SUR4 membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GNS1/SUR4 membrane protein (InterPro:IPR002076); BEST Arabidopsis thaliana protein match is: GNS1/SUR4 membrane family protein (TAIR:AT3G06460.1); Has 1723 Blast hits to 1718 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1179; Fungi - 248; Plants - 58; Viruses - 13; Other Eukaryotes - 225 (source: NCBI BLink).  |
AT3G06540 | AT3G06540.1 | CTTAGGCCCATTA | GDP dissociation inhibitor family protein / Rab GTPase activator family protein; FUNCTIONS IN: RAB GDP-dissociation inhibitor activity; INVOLVED IN: intracellular protein transport, regulation of GTPase activity, protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rab GTPase activator (InterPro:IPR002005), Rab protein geranylgeranyltransferase component A, eukaryota (InterPro:IPR016664), Yeast Mrs6p protein (InterPro:IPR000632), GDP dissociation inhibitor (InterPro:IPR018203); BEST Arabidopsis thaliana protein match is: ATGDI1 (ARABIDOPSIS THALIANA GUANOSINE NUCLEOTIDE DIPHOSPHATE DISSOCIATION INHIBITOR 1); RAB GDP-dissociation inhibitor (TAIR:AT2G44100.2); Has 948 Blast hits to 858 proteins in 184 species: Archae - 0; Bacteria - 2; Metazoa - 512; Fungi - 195; Plants - 103; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).  |
AT3G06700 | AT3G06700.1 | AGAGGCCCATATA | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
AT3G06700.2 | AGAGGCCCATATA | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  | |
AT3G06700.3 | AGAGGCCCATATA | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  | |
AT3G06710 | AT3G06710.1 | TATATGGGCCTCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G07110 | AT3G07110.1 | AGATGGGCCTGA | 60S ribosomal protein L13A (RPL13aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1890 Blast hits to 1890 proteins in 584 species: Archae - 212; Bacteria - 573; Metazoa - 292; Fungi - 125; Plants - 164; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink).  |
AT3G07110.2 | AGATGGGCCTGA | 60S ribosomal protein L13A (RPL13aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1890 Blast hits to 1890 proteins in 584 species: Archae - 212; Bacteria - 573; Metazoa - 292; Fungi - 125; Plants - 164; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink).  | |
AT3G07150 | AT3G07150.1 | ACAGGCCCATCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G07200 | AT3G07200.1 | CAAAGCCCATGGGCCTTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink).  |
AT3G07200.2 | CAAAGCCCATGGGCCTTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G48655.3); Has 4419 Blast hits to 4404 proteins in 583 species: Archae - 0; Bacteria - 0; Metazoa - 3082; Fungi - 473; Plants - 291; Viruses - 27; Other Eukaryotes - 546 (source: NCBI BLink).  | |
AT3G07568 | AT3G07568.1 | AAAGGCCCATCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G07568.1 | TAAAGGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G07590 | AT3G07590.1 | TTATGGGCCTTAC | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).  |
AT3G07630 | AT3G07630.1 | TTATGGGCCTTAG | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  |
AT3G07630.2 | TTATGGGCCTTAG | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  | |
AT3G09030 | AT3G09030.1 | ACAGGCCCATATA | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT5G41330.1); Has 1331 Blast hits to 1319 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 1177; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).  |
AT3G09080 | AT3G09080.1 | TATATGGGCCTGAAAAGCCCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 11046 Blast hits to 7089 proteins in 331 species: Archae - 36; Bacteria - 2713; Metazoa - 3924; Fungi - 1952; Plants - 817; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink).  |
AT3G09085 | AT3G09085.1 | GTGGGCTTTTCAGGCCCATATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2253, membrane (InterPro:IPR018722); Has 550 Blast hits to 550 proteins in 186 species: Archae - 0; Bacteria - 294; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G09200 | AT3G09200.1 | TAAATGGGCCTAAT | 60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).  |
AT3G09200.2 | TAAATGGGCCTAAT | 60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).  | |
AT3G09470 | AT3G09470.1 | AAAAGGCCAAGGCCCATTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
AT3G09470.2 | AAAAGGCCAAGGCCCATTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  | |
AT3G09480 | AT3G09480.1 | AAAAGGCCAAGGCCCATTAG | histone H2B, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT5G02570.1); Has 2678 Blast hits to 2678 proteins in 284 species: Archae - 0; Bacteria - 0; Metazoa - 1868; Fungi - 162; Plants - 357; Viruses - 0; Other Eukaryotes - 291 (source: NCBI BLink).  |
AT3G09490 | AT3G09490.1 | CTAATGGGCCTTGGCCTTTT | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 637 Blast hits to 548 proteins in 146 species: Archae - 92; Bacteria - 301; Metazoa - 8; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink).  |
AT3G09500 | AT3G09500.1 | ATGGGCTAAGGCCCATTAAG | 60S ribosomal protein L35 (RPL35A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 829 Blast hits to 829 proteins in 305 species: Archae - 115; Bacteria - 131; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).  |
AT3G09720 | AT3G09720.1 | ATTTGGGCTTTAATAGGCCCATTTA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae - 599; Bacteria - 13582; Metazoa - 5089; Fungi - 3376; Plants - 1453; Viruses - 31; Other Eukaryotes - 7222 (source: NCBI BLink).  |
AT3G09970 | AT3G09970.1 | CAAAGGCCCATG | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT3G09960.1); Has 715 Blast hits to 715 proteins in 245 species: Archae - 8; Bacteria - 389; Metazoa - 26; Fungi - 8; Plants - 74; Viruses - 11; Other Eukaryotes - 199 (source: NCBI BLink).  |
AT3G10110 | AT3G10110.1 | CTAATGGGCCTAAA | maternal effect embryo arrest 67 (MEE67); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: embryonic development ending in seed dormancy, protein transport; LOCATED IN: mitochondrial inner membrane, chloroplast, mitochondrial inner membrane presequence translocase complex; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT1G18320.1); Has 509 Blast hits to 509 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 226; Fungi - 159; Plants - 86; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT3G10300 | AT3G10300.1 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink).  |
AT3G10300.2 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink).  | |
AT3G10300.3 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink).  | |
AT3G10300.4 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink).  | |
AT3G10630 | AT3G10630.1 | CTTAATGGGCCTCT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 2500 Blast hits to 2492 proteins in 519 species: Archae - 97; Bacteria - 1438; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 3; Other Eukaryotes - 935 (source: NCBI BLink).  |
AT3G11090 | AT3G11090.1 | AATAGGCCCATG | LOB DOMAIN-CONTAINING PROTEIN 21 (LBD21); INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: LBD25 (LOB DOMAIN-CONTAINING PROTEIN 25) (TAIR:AT3G27650.1); Has 584 Blast hits to 581 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 584; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G11270 | AT3G11270.1 | TTTAGGCCCATATAATTGGGCTTTAT | maternal effect embryo arrest 34 (MEE34); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: RPN8A (RP NON-ATPASE SUBUNIT 8A) (TAIR:AT5G05780.1); Has 981 Blast hits to 977 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 210; Plants - 166; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT3G11450 | AT3G11450.1 | TATGGGCCTGTAGCCCAAA | DNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT5G06110.1); Has 51717 Blast hits to 34681 proteins in 2122 species: Archae - 166; Bacteria - 8879; Metazoa - 19405; Fungi - 4515; Plants - 2164; Viruses - 194; Other Eukaryotes - 16394 (source: NCBI BLink).  |
AT3G12260 | AT3G12260.1 | CTTAGGCCCATAAAAAGCCCATTAG | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT3G12870 | AT3G12870.1 | ATATGGGCCTAAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56120.1); Has 45 Blast hits to 45 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G12930 | AT3G12930.1 | ACAGGCCCATTT | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Iojap-related protein (InterPro:IPR004394); Has 2517 Blast hits to 2517 proteins in 833 species: Archae - 0; Bacteria - 1551; Metazoa - 22; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink).  |
AT3G13050 | AT3G13050.1 | AAATGGGCCTTAC | transporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtOCT4 (Arabidopsis thaliana ORGANIC CATION/CARNITINE TRANSPORTER4); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G20660.1); Has 24061 Blast hits to 23627 proteins in 1387 species: Archae - 383; Bacteria - 12067; Metazoa - 4488; Fungi - 4369; Plants - 1324; Viruses - 0; Other Eukaryotes - 1430 (source: NCBI BLink).  |
AT3G13120 | AT3G13120.1 | ATATGGGCCTAATGGG | 30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink).  |
AT3G13190 | AT3G13190.1 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink).  |
AT3G13190.2 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink).  | |
AT3G13190.3 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink).  | |
AT3G13275 | AT3G13275.1 | TTAATGGGCCTTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 13 Blast hits to 13 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G13360 | AT3G13360.1 | TTAATGGGCCTTAT | WPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae - 0; Bacteria - 7; Metazoa - 18; Fungi - 8; Plants - 43; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
AT3G13470 | AT3G13470.1 | TAATGGGCCTATT | chaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24486 Blast hits to 24452 proteins in 5132 species: Archae - 390; Bacteria - 14009; Metazoa - 1525; Fungi - 954; Plants - 450; Viruses - 2; Other Eukaryotes - 7156 (source: NCBI BLink).  |
AT3G13860 | AT3G13860.1 | ATAATGGGCCTAAG | HEAT SHOCK PROTEIN 60-3A (HSP60-3A); FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: HSP60 (HEAT SHOCK PROTEIN 60); ATP binding (TAIR:AT3G23990.1); Has 24236 Blast hits to 24217 proteins in 5120 species: Archae - 378; Bacteria - 14012; Metazoa - 1390; Fungi - 947; Plants - 418; Viruses - 2; Other Eukaryotes - 7089 (source: NCBI BLink).  |
AT3G13930 | AT3G13930.1 | ATTAGGCCCATTAA | dihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae - 43; Bacteria - 6315; Metazoa - 646; Fungi - 315; Plants - 198; Viruses - 0; Other Eukaryotes - 7611 (source: NCBI BLink).  |
AT3G14190 | AT3G14190.1 | TGATGGGCCTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12360.1); Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G14290 | AT3G14290.1 | TTTAGGCCCATTAA | Encodes 20S proteasome subunit PAE2 (PAE2).  |
AT3G14400 | AT3G14400.1 | AGATGGGCCTAAAAAGCCCAGTA | Encodes a ubiquitin-specific protease.  |
AT3G14730 | AT3G14730.1 | TAAATGGGCCTATT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 14433 Blast hits to 4909 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 53; Fungi - 48; Plants - 14121; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink).  |
AT3G14830 | AT3G14830.1 | AGAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53450.2); Has 41 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G14830.2 | AGAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53450.2); Has 41 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G14860 | AT3G14860.1 | CTTAATGGGCCTATTATAAGGCCCATAA | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink).  |
AT3G14860.2 | CTTAATGGGCCTATTATAAGGCCCATAA | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink).  | |
AT3G15180 | AT3G15180.1 | CTAATGGGCCTTAT | proteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae - 0; Bacteria - 1; Metazoa - 56; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT3G15280 | AT3G15280.1 | ATAATGGGCCTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G15290 | AT3G15290.1 | TTTAGGCCCATTAT | 3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink).  |
AT3G15352 | AT3G15352.1 | AAATGGGCCTAGCCCACT | Encodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex.  |
AT3G15460 | AT3G15460.1 | CGTGTCATTAAGGCCCATG | brix domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: brix domain-containing protein (TAIR:AT1G52930.1); Has 299 Blast hits to 299 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 88; Plants - 33; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  |
AT3G16080 | AT3G16080.1 | CAAAGGCCCATG | 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT3G16080.1 | CCAGGCCCATTTA | 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  | |
AT3G16260 | AT3G16260.1 | CAAAGGCCCATGGGCTAA | Encodes a tRNase Z.  |
AT3G16480 | AT3G16480.1 | ATATGGGCCTAT | mitochondrial processing peptidase alpha subunit (MPPalpha); FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 4301 Blast hits to 4224 proteins in 886 species: Archae - 10; Bacteria - 2091; Metazoa - 526; Fungi - 394; Plants - 137; Viruses - 3; Other Eukaryotes - 1140 (source: NCBI BLink).  |
AT3G16780 | AT3G16780.1 | GTAGGCCCATTTA | 60S ribosomal protein L19 (RPL19B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 106; Plants - 93; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink).  |
AT3G17430 | AT3G17430.1 | TATAGGCCCATAAAGCCCAAT | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT1G48230.1); Has 1446 Blast hits to 1445 proteins in 173 species: Archae - 0; Bacteria - 5; Metazoa - 374; Fungi - 259; Plants - 650; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).  |
AT3G17668 | AT3G17668.1 | AGATGGGCCTTAGGCCC | ENHANCER OF ATNSI ACTIVITY (ENA); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 103 Blast hits to 95 proteins in 30 species: Archae - 2; Bacteria - 13; Metazoa - 34; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT3G17780 | AT3G17780.1 | CAATTGGGCCGTAAAAAGGCCCATCA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48440.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G18130 | AT3G18130.1 | AGAGGCCCATTTA | Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1C has no phenotype on its own and probably acts redundantly with RACK1A and RACK1B.  |
AT3G18190 | AT3G18190.1 | ACAGGCCCATTTA | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, delta subunit (InterPro:IPR012717); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 14434 Blast hits to 14373 proteins in 2596 species: Archae - 394; Bacteria - 6460; Metazoa - 1798; Fungi - 981; Plants - 478; Viruses - 2; Other Eukaryotes - 4321 (source: NCBI BLink).  |
AT3G18380 | AT3G18380.1 | AAATGGGCCTTTAATGGG | sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G18380.2 | AAATGGGCCTTTAATGGG | sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G18390 | AT3G18390.1 | CCCATTAAAGGCCCATTT | embryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae - 5; Bacteria - 10; Metazoa - 293; Fungi - 119; Plants - 305; Viruses - 46; Other Eukaryotes - 371 (source: NCBI BLink).  |
AT3G18410 | AT3G18410.1 | TTTAGGCCCATA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT1G49140.1); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G18410.2 | TTTAGGCCCATA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT1G49140.1); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G18420 | AT3G18420.1 | TTAAAGGCCCATAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 2006 Blast hits to 1561 proteins in 415 species: Archae - 271; Bacteria - 982; Metazoa - 160; Fungi - 19; Plants - 64; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink).  |
AT3G18430 | AT3G18430.1 | TTATGGGCCTTTAA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: CAM9 (CALMODULIN 9); calcium ion binding (TAIR:AT3G51920.1); Has 3772 Blast hits to 3771 proteins in 389 species: Archae - 0; Bacteria - 11; Metazoa - 2178; Fungi - 257; Plants - 701; Viruses - 0; Other Eukaryotes - 625 (source: NCBI BLink).  |
AT3G19508 | AT3G19508.1 | TTAAAGGCCCATTAAG | unknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G19760 | AT3G19760.1 | ATATGGGCCTAAC | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: nucleolus, nucleus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative (TAIR:AT1G51380.1); Has 32402 Blast hits to 31825 proteins in 1817 species: Archae - 512; Bacteria - 14379; Metazoa - 5291; Fungi - 3422; Plants - 1433; Viruses - 38; Other Eukaryotes - 7327 (source: NCBI BLink).  |
AT3G21790 | AT3G21790.1 | CTAATGGGCCTTAA | UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B8 (UDP-GLUCOSYL TRANSFERASE 71B8); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 4'-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT3G21800.1); Has 4493 Blast hits to 4475 proteins in 265 species: Archae - 0; Bacteria - 82; Metazoa - 1698; Fungi - 10; Plants - 2668; Viruses - 11; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT3G22150 | AT3G22150.1 | AGAGGCCCATAA | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink).  |
AT3G22230 | AT3G22230.1 | CATGGGCCTTTT | 60S ribosomal protein L27 (RPL27B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27C) (TAIR:AT4G15000.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).  |
AT3G22630 | AT3G22630.1 | TAAATGGGCCTTAT | Encodes 20S proteasome beta subunit PBD1 (PBD1).  |
AT3G22780 | AT3G22780.1 | GAATGGGCCTGA | putative DNA binding protein (tso1) mRNA, tso1-3 allele,  |
AT3G23390 | AT3G23390.1 | TATATGGGCCTTAT | 60S ribosomal protein L36a/L44 (RPL36aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aB) (TAIR:AT4G14320.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT3G24820 | AT3G24820.1 | CCAGGCCCATTT | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 97 Blast hits to 97 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT3G24830 | AT3G24830.1 | AAATGGGCCTGG | 60S ribosomal protein L13A (RPL13aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aA) (TAIR:AT3G07110.1); Has 1473 Blast hits to 1473 proteins in 438 species: Archae - 212; Bacteria - 283; Metazoa - 292; Fungi - 127; Plants - 164; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink).  |
AT3G25040 | AT3G25040.1 | AGCCCAAAACTAGGCCCATAA | ER lumen protein retaining receptor, putative / HDEL receptor, putative; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ERD2 (ENDOPLASMIC RETICULUM RETENTION DEFECTIVE 2); KDEL sequence binding / receptor (TAIR:AT1G29330.1); Has 642 Blast hits to 641 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 121; Plants - 119; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  |
AT3G25220 | AT3G25220.1 | ATAGGCCCATTA | immunophilin (FKBP15-1)  |
AT3G25520 | AT3G25520.1 | TAAAAGCCCATAGGCCCATTAA | Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2.  |
AT3G27110 | AT3G27110.1 | CTAAGGCCCATG | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink).  |
AT3G27110.2 | CTAAGGCCCATG | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink).  | |
AT3G27160 | AT3G27160.1 | ATAATGGGCCTTAT | GHS1 encodes plastid ribosomal protein S21  |
AT3G27430 | AT3G27430.1 | AAAAGGCCCATTTA | Encodes 20S proteasome beta subunit PBB1 (PBB1).  |
AT3G27430.2 | AAAAGGCCCATTTA | Encodes 20S proteasome beta subunit PBB1 (PBB1).  | |
AT3G27630 | AT3G27630.1 | GTAAGGCCCATATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40460.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G28500 | AT3G28500.1 | AAAAGGCCCATTAA | 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae - 48; Bacteria - 1; Metazoa - 282; Fungi - 204; Plants - 184; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink).  |
AT3G28500.1 | ATAAGGCCCATTAA | 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae - 48; Bacteria - 1; Metazoa - 282; Fungi - 204; Plants - 184; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink).  | |
AT3G43230 | AT3G43230.1 | CAAGGCCCATTGGGCCCT | zinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: phosphoinositide binding / zinc ion binding (TAIR:AT1G29800.2); Has 3031 Blast hits to 2947 proteins in 232 species: Archae - 0; Bacteria - 157; Metazoa - 1828; Fungi - 464; Plants - 196; Viruses - 3; Other Eukaryotes - 383 (source: NCBI BLink).  |
AT3G43850 | AT3G43850.1 | GAATGGGCCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G21940.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 124; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G44990 | AT3G44990.1 | AGAGGCCCATC | xyloglucan endo-transglycosylase  |
AT3G45030 | AT3G45030.1 | CAAGGCCCATATTGGCCCAAG | 40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  |
AT3G46040 | AT3G46040.1 | AAATGGGCCTAAT | Regulated by TCP20.  |
AT3G46040.1 | ATAATGGGCCTAG | Regulated by TCP20.  | |
AT3G46060 | AT3G46060.1 | AAAAGGCCCATAA | small GTP-binding protein (ara-3)  |
AT3G46060.2 | AAAAGGCCCATAA | small GTP-binding protein (ara-3)  | |
AT3G46060.3 | AAAAGGCCCATAA | small GTP-binding protein (ara-3)  | |
AT3G46230 | AT3G46230.1 | TTAAGGCCCATTAA | member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds  |
AT3G46310 | AT3G46310.1 | TAAATGGGCCTAAGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46300.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G46310.1 | TTTAGGCCCATCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46300.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G46790 | AT3G46790.1 | AAGGCCCATTT | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation.  |
AT3G46790.1 | ATATGGGCCTAAT | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation.  | |
AT3G47120 | AT3G47120.1 | TAAATGGGCCTCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae - 10; Bacteria - 1203; Metazoa - 11844; Fungi - 2178; Plants - 3009; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink).  |
AT3G47960 | AT3G47960.1 | AAATGGGCCTAC | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT5G62680.1); Has 2355 Blast hits to 2218 proteins in 361 species: Archae - 0; Bacteria - 385; Metazoa - 535; Fungi - 246; Plants - 1124; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
AT3G48380 | AT3G48380.1 | ATATTGGGCTAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT3G48380.2 | ATATTGGGCTAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  | |
AT3G48680 | AT3G48680.1 | CTAATGGGCCTCT | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex.  |
AT3G49500 | AT3G49500.1 | TAAATGGGCCTAT | Encodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance.  |
AT3G49910 | AT3G49910.1 | AGAGGCCCATTAT | 60S ribosomal protein L26 (RPL26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, translation; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), KOW (InterPro:IPR005824), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26B) (TAIR:AT5G67510.1); Has 870 Blast hits to 870 proteins in 315 species: Archae - 232; Bacteria - 6; Metazoa - 311; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).  |
AT3G50360 | AT3G50360.1 | ATTAGGCCCATCT | CENTRIN2 (ATCEN2); FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: caltractin, putative / centrin, putative (TAIR:AT4G37010.2); Has 25773 Blast hits to 16030 proteins in 1342 species: Archae - 0; Bacteria - 125; Metazoa - 11739; Fungi - 5407; Plants - 4427; Viruses - 2; Other Eukaryotes - 4073 (source: NCBI BLink).  |
AT3G50360.1 | TTATGGGCCTT | CENTRIN2 (ATCEN2); FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: caltractin, putative / centrin, putative (TAIR:AT4G37010.2); Has 25773 Blast hits to 16030 proteins in 1342 species: Archae - 0; Bacteria - 125; Metazoa - 11739; Fungi - 5407; Plants - 4427; Viruses - 2; Other Eukaryotes - 4073 (source: NCBI BLink).  | |
AT3G50590 | AT3G50590.1 | CCCATTTAGGCCCATAA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G50590.1 | TTAAAGCCCATTTAGGCCCATTAAACGACA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).  | |
AT3G50920 | AT3G50920.1 | TATATGGGCCTCA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT3G50920.2 | TATATGGGCCTCA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  | |
AT3G51010 | AT3G51010.1 | TATAGGCCCATAAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G51420 | AT3G51420.1 | TTTAGGCCCATATA | STRICTOSIDINE SYNTHASE-LIKE 4 (SSL4); FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 925 Blast hits to 920 proteins in 207 species: Archae - 3; Bacteria - 290; Metazoa - 196; Fungi - 4; Plants - 277; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT3G51880 | AT3G51880.1 | TCAGGCCCATATA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  |
AT3G51880.2 | TCAGGCCCATATA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  | |
AT3G51880.3 | TCAGGCCCATATA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  | |
AT3G51940 | AT3G51940.1 | ATTAGGCCCATTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03990.1); Has 134 Blast hits to 107 proteins in 33 species: Archae - 0; Bacteria - 32; Metazoa - 27; Fungi - 16; Plants - 34; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT3G52120 | AT3G52120.1 | ATATGGGCCTC | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / D111/G-patch domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 1163 Blast hits to 1052 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 893; Fungi - 94; Plants - 131; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
AT3G52120.2 | ATATGGGCCTC | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / D111/G-patch domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 1163 Blast hits to 1052 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 893; Fungi - 94; Plants - 131; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  | |
AT3G52220 | AT3G52220.1 | CTAATGGGCCTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae - 10; Bacteria - 152; Metazoa - 4787; Fungi - 1223; Plants - 656; Viruses - 23; Other Eukaryotes - 2756 (source: NCBI BLink).  |
AT3G52230 | AT3G52230.1 | TTTAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G52750 | AT3G52750.1 | TATAGGCCCATTTA | Nuclear gene that encodes a plastidial division protein (FtsZ2-2).  |
AT3G52960 | AT3G52960.1 | GTAGGCCCATTAAGGCCCAATAACGGCGT | peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink).  |
AT3G53020 | AT3G53020.1 | TGATGGGCCTATTTAGTGGGCTTA | RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20.  |
AT3G53020.1 | TTATGGGCCTATT | RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20.  | |
AT3G53030 | AT3G53030.1 | AATAGGCCCATAA | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31.  |
AT3G53030.1 | TAAGCCCACTAAATAGGCCCATCA | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31.  | |
AT3G53120 | AT3G53120.1 | ATATGGGCCTC | VPS37-1; LOCATED IN: ESCRT I complex; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36680.1); Has 356 Blast hits to 356 proteins in 75 species: Archae - 0; Bacteria - 4; Metazoa - 251; Fungi - 14; Plants - 42; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
AT3G53320 | AT3G53320.1 | TTAAGGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37070.1); Has 10077 Blast hits to 5050 proteins in 411 species: Archae - 0; Bacteria - 1106; Metazoa - 4046; Fungi - 1512; Plants - 226; Viruses - 108; Other Eukaryotes - 3079 (source: NCBI BLink).  |
AT3G54210 | AT3G54210.1 | TATAGGCCCATTAAGGCCCATCA | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5385 Blast hits to 5385 proteins in 1530 species: Archae - 0; Bacteria - 3017; Metazoa - 102; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2110 (source: NCBI BLink).  |
AT3G54360 | AT3G54360.1 | CAGGCCCATTTA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 679 Blast hits to 624 proteins in 99 species: Archae - 16; Bacteria - 83; Metazoa - 469; Fungi - 12; Plants - 26; Viruses - 8; Other Eukaryotes - 65 (source: NCBI BLink).  |
AT3G54440 | AT3G54440.1 | ATATGGGCCTGT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  |
AT3G54440.2 | ATATGGGCCTGT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  | |
AT3G54860 | AT3G54860.1 | TGAGGCCCATTA | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.  |
AT3G54860.1 | TGAGGCCCATTTCTAAGCCCATTTA | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.  | |
AT3G54860.2 | TGAGGCCCATTA | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.  | |
AT3G54860.2 | TGAGGCCCATTTCTAAGCCCATTTA | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.  | |
AT3G54920 | AT3G54920.1 | GATGGGCCTGGTTATGGGCCTAAC | Powdery mildew resistant mutant encodes a pectate lyase-like protein  |
AT3G55170 | AT3G55170.1 | TGAGGCCCATTTA | 60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae - 116; Bacteria - 162; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT3G55170.1 | TTAAGGCCCATTTA | 60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae - 116; Bacteria - 162; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  | |
AT3G55170.2 | TGAGGCCCATTTA | 60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae - 116; Bacteria - 162; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  | |
AT3G55170.2 | TTAAGGCCCATTTA | 60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae - 116; Bacteria - 162; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  | |
AT3G55200 | AT3G55200.1 | AATAGGCCCATG | splicing factor, putative; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage and polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: splicing factor, putative (TAIR:AT3G55220.1); Has 768 Blast hits to 695 proteins in 165 species: Archae - 0; Bacteria - 2; Metazoa - 341; Fungi - 160; Plants - 119; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT3G55440 | AT3G55440.1 | TTAATGGGCCTAAAGCCCATA | Encodes triosephosphate isomerase.  |
AT3G56020 | AT3G56020.1 | AGATGGGCCTTAAAGGCCCAATAT | 60S ribosomal protein L41 (RPL41G); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G56030 | AT3G56030.1 | ATATTGGGCCTTTAAGGCCCATCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G40240.1); Has 6707 Blast hits to 2251 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 13; Plants - 6562; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).  |
AT3G56210 | AT3G56210.1 | AAGGCCCATTAG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G56210.2 | AAGGCCCATTAG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G56210.4 | AAGGCCCATTAG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G56440 | AT3G56440.1 | AGAGGCCCATTAAG | AtATG18d; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18c (TAIR:AT2G40810.2); Has 1093 Blast hits to 1046 proteins in 176 species: Archae - 0; Bacteria - 24; Metazoa - 508; Fungi - 305; Plants - 110; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT3G56990 | AT3G56990.1 | AATAGGCCCATTAAG | embryo sac development arrest 7 (EDA7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: megagametogenesis; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NUC153 (InterPro:IPR012580), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 3435 Blast hits to 2597 proteins in 327 species: Archae - 0; Bacteria - 215; Metazoa - 1552; Fungi - 648; Plants - 432; Viruses - 52; Other Eukaryotes - 536 (source: NCBI BLink).  |
AT3G57000 | AT3G57000.1 | CTTAATGGGCCTATT | nucleolar essential protein-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis, methyltransferase, EMG1/NEP1 (InterPro:IPR005304); Has 1252 Blast hits to 912 proteins in 202 species: Archae - 94; Bacteria - 9; Metazoa - 674; Fungi - 138; Plants - 36; Viruses - 2; Other Eukaryotes - 299 (source: NCBI BLink).  |
AT3G57440 | AT3G57440.1 | CATGGGCCTAATATATGGGCTCA | unknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G57480 | AT3G57480.1 | TAAATGGGCCTGT | zinc finger (C2H2 type, AN1-like) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type, AN1-like) family protein (TAIR:AT2G41835.1); Has 368 Blast hits to 368 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
AT3G57890 | AT3G57890.1 | AAATGGGCCTCT | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT2G42230.2); Has 286 Blast hits to 286 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT3G58600 | AT3G58600.1 | AAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 43; Plants - 52; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT3G58600.1 | ATAATGGGCCTAGGCCTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 43; Plants - 52; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  | |
AT3G58610 | AT3G58610.1 | AATAGGCCTAGGCCCATTAT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink).  |
AT3G58610.1 | TTAATGGGCCTTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink).  | |
AT3G58610.2 | AATAGGCCTAGGCCCATTAT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink).  | |
AT3G58610.2 | TTAATGGGCCTTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink).  | |
AT3G59280 | AT3G59280.1 | AGATGGGCCTGA | mutant exhibited resistance to growth on media containing thaxtomin due to a difference in the rate of uptake of the toxin.We proposed that TXR1 is a component of, or regulator of, a dispensable transport mechanism.  |
AT3G59340 | AT3G59340.1 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF914, eukaryotic (InterPro:IPR009262); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59310.1); Has 715 Blast hits to 712 proteins in 169 species: Archae - 7; Bacteria - 146; Metazoa - 153; Fungi - 87; Plants - 74; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink).  |
AT3G59540 | AT3G59540.1 | TTAATGGGCCTAAGGGGT | 60S ribosomal protein L38 (RPL38B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38A) (TAIR:AT2G43460.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT3G59990 | AT3G59990.1 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase  |
AT3G59990.2 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase  | |
AT3G59990.3 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase  | |
AT3G60245 | AT3G60245.1 | CAAAGGCCCATAT | 60S ribosomal protein L37a (RPL37aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae (InterPro:IPR002674), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37a (RPL37aB) (TAIR:AT3G10950.1); Has 762 Blast hits to 762 proteins in 273 species: Archae - 200; Bacteria - 0; Metazoa - 221; Fungi - 91; Plants - 82; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink).  |
AT3G60640 | AT3G60640.1 | TTATGGGCCTTAG | AUTOPHAGY 8G (ATG8G); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: ATG8F (autophagy 8f); microtubule binding (TAIR:AT4G16520.2); Has 1156 Blast hits to 1154 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 574; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink).  |
AT3G60820 | AT3G60820.1 | CAAAGCCCAAATAAGGCCCATTATAAAGCC | Encodes 20S proteasome beta subunit PBF1 (PBF1).  |
AT3G60820.2 | CAAAGCCCAAATAAGGCCCATTATAAAGCC | Encodes 20S proteasome beta subunit PBF1 (PBF1).  | |
AT3G61790 | AT3G61790.1 | TTAGGCCCATCT | seven in absentia (SINA) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; INVOLVED IN: multicellular organismal development, ubiquitin-dependent protein catabolic process, protein ubiquitination; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), TRAF-like (InterPro:IPR008974), Seven in absentia protein, TRAF-like domain (InterPro:IPR018121), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, SIAH-type (InterPro:IPR013010), Seven In Absentia Homolog-type (InterPro:IPR013323), Seven in absentia protein (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: seven in absentia (SINA) family protein (TAIR:AT4G27880.1); Has 1422 Blast hits to 1414 proteins in 637 species: Archae - 0; Bacteria - 0; Metazoa - 1099; Fungi - 9; Plants - 250; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT3G61860 | AT3G61860.1 | AAGGCCCATTAT | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined.  |
AT3G61870 | AT3G61870.1 | ATAATGGGCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT3G61870.2 | ATAATGGGCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  | |
AT3G62080 | AT3G62080.1 | TTAATGGGCCTGG | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).  |
AT3G62400 | AT3G62400.1 | TCAGGCCCATG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G62400.2 | TCAGGCCCATG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G62680 | AT3G62680.1 | TTAATGGGCCTAT | Proline-rich protein  |
AT3G63370 | AT3G63370.1 | ATATGGGCCTGG | pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16480 Blast hits to 4859 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 46; Plants - 16142; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink).  |
AT3G63400 | AT3G63400.1 | CAAAGGCCCATCGGGCTTTT | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, RNA splicing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase (TAIR:AT2G21130.1); Has 47527 Blast hits to 29594 proteins in 1838 species: Archae - 95; Bacteria - 7193; Metazoa - 22003; Fungi - 4320; Plants - 2499; Viruses - 348; Other Eukaryotes - 11069 (source: NCBI BLink).  |
AT3G63400.2 | CAAAGGCCCATCGGGCTTTT | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, RNA splicing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase (TAIR:AT2G21130.1); Has 47527 Blast hits to 29594 proteins in 1838 species: Archae - 95; Bacteria - 7193; Metazoa - 22003; Fungi - 4320; Plants - 2499; Viruses - 348; Other Eukaryotes - 11069 (source: NCBI BLink).  | |
AT3G63500 | AT3G63500.2 | TGATGGGCCTTAC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1423, plant (InterPro:IPR004082); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14740.1); Has 2817 Blast hits to 2297 proteins in 310 species: Archae - 8; Bacteria - 278; Metazoa - 1232; Fungi - 288; Plants - 201; Viruses - 10; Other Eukaryotes - 800 (source: NCBI BLink).  |
AT4G00090 | AT4G00090.1 | TTAAGGCCCATAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink).  |
AT4G00500 | AT4G00500.1 | TTAATGGGCCTATA | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  |
AT4G00500.2 | TTAATGGGCCTATA | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  | |
AT4G00520 | AT4G00520.2 | TATAGGCCCATTAA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink).  |
AT4G00520.3 | TATAGGCCCATTAA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink).  | |
AT4G00585 | AT4G00585.1 | TAAATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 29 Blast hits to 29 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 6; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT4G00590 | AT4G00590.1 | TTAAGGCCCATTTA | asparaginase 2 family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase T2, asparaginase 2 (InterPro:IPR000246); BEST Arabidopsis thaliana protein match is: L-asparaginase, putative / L-asparagine amidohydrolase, putative (TAIR:AT3G16150.1); Has 2162 Blast hits to 2119 proteins in 522 species: Archae - 71; Bacteria - 869; Metazoa - 420; Fungi - 151; Plants - 90; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink).  |
AT4G00810 | AT4G00810.1 | CAATGGGCCTTT | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink).  |
AT4G00810.2 | CAATGGGCCTTT | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink).  | |
AT4G00840 | AT4G00840.1 | TTATTGGGCCTGTTAATGGGCCTTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G60800.1); Has 3992 Blast hits to 3990 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1955; Fungi - 533; Plants - 396; Viruses - 0; Other Eukaryotes - 1108 (source: NCBI BLink).  |
AT4G00850 | AT4G00850.1 | ATAAGGCCCATTAACAGGCCCAATAA | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA  |
AT4G00895 | AT4G00895.1 | ATTAGGCCCATTTA | ATP synthase delta chain-related; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: proton-transporting ATP synthase complex, catalytic core F(1), chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); Has 40 Blast hits to 40 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G01010 | AT4G01010.1 | GTTAGGCCCATCA | member of Cyclic nucleotide gated channel family  |
AT4G01150 | AT4G01150.1 | AGATGGGCCTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT4G01150.2 | AGATGGGCCTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT4G01310 | AT4G01310.1 | TTTAGGCCCATAT | ribosomal protein L5 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); Has 6408 Blast hits to 6408 proteins in 1765 species: Archae - 218; Bacteria - 2994; Metazoa - 181; Fungi - 187; Plants - 230; Viruses - 0; Other Eukaryotes - 2598 (source: NCBI BLink).  |
AT4G01320 | AT4G01320.1 | ATATGGGCCTAAA | CAAX protease with broad substrate specificity. Localized exclusively to the endoplasmic reticulum.  |
AT4G01560 | AT4G01560.1 | ATAGGCCCATTT | maternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
AT4G01570 | AT4G01570.1 | AAATGGGCCTAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink).  |
AT4G01590 | AT4G01590.1 | CTAAGGCCCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink).  |
AT4G01590.2 | CTAAGGCCCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink).  | |
AT4G01660 | AT4G01660.1 | AGCCCAATGGGCCTTAT | Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant  |
AT4G02195 | AT4G02195.1 | TAAATGGGCCTAAAAAGGCCCAAAT | member of SYP4 Gene Family  |
AT4G02250 | AT4G02250.1 | GTAGGCCCATCA | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G55770.1); Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02580 | AT4G02580.1 | AAATGGGCCTTTAA | NADH-ubiquinone oxidoreductase 24 kDa subunit, putative; FUNCTIONS IN: electron carrier activity, NAD or NADH binding, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: response to oxidative stress, mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), NADH dehydrogenase (ubiquinone), 24 kDa subunit (InterPro:IPR002023), Thioredoxin-like fold (InterPro:IPR012336); Has 4003 Blast hits to 4003 proteins in 890 species: Archae - 12; Bacteria - 1956; Metazoa - 160; Fungi - 76; Plants - 28; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).  |
AT4G02580.1 | CAGGCCCATA | NADH-ubiquinone oxidoreductase 24 kDa subunit, putative; FUNCTIONS IN: electron carrier activity, NAD or NADH binding, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: response to oxidative stress, mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), NADH dehydrogenase (ubiquinone), 24 kDa subunit (InterPro:IPR002023), Thioredoxin-like fold (InterPro:IPR012336); Has 4003 Blast hits to 4003 proteins in 890 species: Archae - 12; Bacteria - 1956; Metazoa - 160; Fungi - 76; Plants - 28; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).  | |
AT4G02580.1 | TATGGGCCTTTAA | NADH-ubiquinone oxidoreductase 24 kDa subunit, putative; FUNCTIONS IN: electron carrier activity, NAD or NADH binding, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: response to oxidative stress, mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), NADH dehydrogenase (ubiquinone), 24 kDa subunit (InterPro:IPR002023), Thioredoxin-like fold (InterPro:IPR012336); Has 4003 Blast hits to 4003 proteins in 890 species: Archae - 12; Bacteria - 1956; Metazoa - 160; Fungi - 76; Plants - 28; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).  | |
AT4G02590 | AT4G02590.1 | AAGGCCCATAT | unfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02590.2 | AAGGCCCATAT | unfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G02590.3 | AAGGCCCATAT | unfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G03260 | AT4G03260.1 | GTAAGGCCCATTTA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink).  |
AT4G03260.2 | GTAAGGCCCATTTA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink).  | |
AT4G05190 | AT4G05190.1 | TGATGGGCCTGA | ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts.  |
AT4G05190.1 | TGATGGGCCTGA | ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts.  | |
AT4G07950 | AT4G07950.1 | AAATGGGCCTTAA | DNA-directed RNA polymerase III family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15 kDa subunit (InterPro:IPR001529); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase III family protein (TAIR:AT1G01210.1); Has 795 Blast hits to 795 proteins in 228 species: Archae - 146; Bacteria - 0; Metazoa - 234; Fungi - 176; Plants - 62; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT4G09730 | AT4G09730.1 | ATATGGGCCTTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT3G06980.1); Has 26614 Blast hits to 26065 proteins in 1716 species: Archae - 427; Bacteria - 10484; Metazoa - 4922; Fungi - 3195; Plants - 1331; Viruses - 9; Other Eukaryotes - 6246 (source: NCBI BLink).  |
AT4G10050 | AT4G10050.1 | ATATGGGCCTAAAATGGCCCAACA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073), Protein phosphatase methylesterase, eukaryotic (InterPro:IPR016812); Has 5040 Blast hits to 5015 proteins in 887 species: Archae - 30; Bacteria - 3229; Metazoa - 308; Fungi - 169; Plants - 67; Viruses - 7; Other Eukaryotes - 1230 (source: NCBI BLink).  |
AT4G10180 | AT4G10180.1 | TCAGGCCCATTAA | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling.  |
AT4G10480 | AT4G10480.1 | CTAAGGCCCATTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink).  |
AT4G10480.2 | CTAAGGCCCATTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink).  | |
AT4G10710 | AT4G10710.1 | CATGGGCCTTTA | encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SPT16.  |
AT4G11150 | AT4G11150.1 | CTAAGGCCCATAA | Encodes a vacuolar H+-ATPase subunit E isoform 1 which is required for Golgi organization and vacuole function in embryogenesis.  |
AT4G13200 | AT4G13200.1 | TATATGGGCCTTTTAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G13720 | AT4G13720.1 | CAATGGGCCTAAA | inosine triphosphate pyrophosphatase, putative / HAM1 family protein; FUNCTIONS IN: hydrolase activity, pyrophosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ham1-like protein (InterPro:IPR002637); Has 4493 Blast hits to 4493 proteins in 1469 species: Archae - 141; Bacteria - 2387; Metazoa - 137; Fungi - 111; Plants - 30; Viruses - 1; Other Eukaryotes - 1686 (source: NCBI BLink).  |
AT4G14320 | AT4G14320.1 | AGATGGGCCTGA | 60S ribosomal protein L36a/L44 (RPL36aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aA) (TAIR:AT3G23390.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT4G14330 | AT4G14330.1 | TCAGGCCCATCT | phragmoplast-associated kinesin-related protein 2 (PAKRP2); FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: phragmoplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATK1 (ARABIDOPSIS THALIANA KINESIN 1); microtubule motor/ minus-end-directed microtubule motor (TAIR:AT4G21270.1); Has 19997 Blast hits to 14982 proteins in 632 species: Archae - 102; Bacteria - 784; Metazoa - 9932; Fungi - 1679; Plants - 1066; Viruses - 71; Other Eukaryotes - 6363 (source: NCBI BLink).  |
AT4G14430 | AT4G14430.1 | CCGGCCCATGGGCCTTTA | Encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation. This enzyme might also be involved in the conversion of indole-3-butyric acid to indole-3-acetic acid via a beta-oxidation-like pathway.  |
AT4G14490 | AT4G14490.1 | TAAAAGCCCATTTAAGGCCCATTAA | forkhead-associated domain-containing protein / FHA domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253); BEST Arabidopsis thaliana protein match is: forkhead-associated domain-containing protein / FHA domain-containing protein / AT hook motif-containing protein (TAIR:AT3G02400.1); Has 1075 Blast hits to 1048 proteins in 243 species: Archae - 14; Bacteria - 671; Metazoa - 68; Fungi - 54; Plants - 81; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).  |
AT4G14870 | AT4G14870.1 | ATTTGGGCTTTATAAGGCCCATAA | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecE subunit of protein translocation complex (InterPro:IPR005807); Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT4G14905 | AT4G14905.1 | AAATGGGCTTTATAGGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT4G14905.2 | AAATGGGCTTTATAGGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink).  | |
AT4G15910 | AT4G15910.1 | GTAAGGCCCATGAGCCCAAAT | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants.  |
AT4G15930 | AT4G15930.1 | ATAATGGGCCTGA | microtubule motor; FUNCTIONS IN: microtubule motor activity; INVOLVED IN: microtubule-based process; LOCATED IN: microtubule associated complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dynein light chain, type 1 and 2 (InterPro:IPR001372); BEST Arabidopsis thaliana protein match is: dynein light chain, putative (TAIR:AT5G20110.1); Has 980 Blast hits to 980 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 538; Fungi - 74; Plants - 124; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink).  |
AT4G16695 | AT4G16695.1 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G16695.1 | CAAAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G16695.2 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G16695.2 | CAAAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G16695.3 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G16695.3 | CAAAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G16720 | AT4G16720.1 | TTATGGGCCTTTA | 60S ribosomal protein L15 (RPL15A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15B) (TAIR:AT4G17390.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  |
AT4G16770 | AT4G16770.1 | TTATGGGCCTAAAGCCCAGTA | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G16765.2); Has 6031 Blast hits to 6015 proteins in 680 species: Archae - 0; Bacteria - 734; Metazoa - 132; Fungi - 691; Plants - 2939; Viruses - 0; Other Eukaryotes - 1535 (source: NCBI BLink).  |
AT4G16970 | AT4G16970.1 | AAATGGGCCTGT | ATP binding / kinase/ protein kinase/ protein serine/threonine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: casein kinase II alpha chain, putative (TAIR:AT2G23070.1); Has 28325 Blast hits to 23063 proteins in 766 species: Archae - 4; Bacteria - 1025; Metazoa - 12500; Fungi - 3604; Plants - 4846; Viruses - 36; Other Eukaryotes - 6310 (source: NCBI BLink).  |
AT4G17020 | AT4G17020.1 | ATAGGCCCATTAG | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT4G17020.1 | CAAGGCCCATTAA | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  | |
AT4G17020.2 | ATAGGCCCATTAG | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  | |
AT4G17020.2 | CAAGGCCCATTAA | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  | |
AT4G17300 | AT4G17300.1 | TGATGGGCCTCT | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis.  |
AT4G17530 | AT4G17530.1 | ATTAGGCCCATTAT | ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae - 17; Bacteria - 111; Metazoa - 13220; Fungi - 2827; Plants - 2160; Viruses - 19; Other Eukaryotes - 5239 (source: NCBI BLink).  |
AT4G17530.1 | TTAATGGGCCTTAG | ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae - 17; Bacteria - 111; Metazoa - 13220; Fungi - 2827; Plants - 2160; Viruses - 19; Other Eukaryotes - 5239 (source: NCBI BLink).  | |
AT4G17540 | AT4G17540.1 | ATAATGGGCCTAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae - 4; Bacteria - 22; Metazoa - 9; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT4G17540.1 | CTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae - 4; Bacteria - 22; Metazoa - 9; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT4G17620 | AT4G17620.1 | AAATGGGCCTTTAA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).  |
AT4G17620.2 | AAATGGGCCTTTAA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).  | |
AT4G18140 | AT4G18140.1 | ATATGGGCCTAAGCCCATTAT | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G18140.2 | ATATGGGCCTAAGCCCATTAT | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G18975 | AT4G18975.1 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G18975.2 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G18975.3 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G19130 | AT4G19130.1 | AAATGGGCCTATA | DNA binding / nucleic acid binding / zinc ion binding; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Replication factor-A, C-terminal (InterPro:IPR013955), Replication factor-a protein 1 Rpa1 (InterPro:IPR004591), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Zinc finger, CCHC-type (InterPro:IPR001878), Replication factor-A protein 1, N-terminal (InterPro:IPR007199); BEST Arabidopsis thaliana protein match is: replication protein, putative (TAIR:AT5G45400.1); Has 609 Blast hits to 584 proteins in 169 species: Archae - 16; Bacteria - 0; Metazoa - 189; Fungi - 98; Plants - 176; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).  |
AT4G19140 | AT4G19140.1 | TATAGGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G20010 | AT4G20010.1 | TGAGGCCCATACAAGGCCCAAA | PLASTID TRANSCRIPTIONALLY ACTIVE 9 (PTAC9); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: OSB3 (ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3); single-stranded DNA binding (TAIR:AT5G44785.1); Has 116 Blast hits to 66 proteins in 12 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G20010.2 | TGAGGCCCATACAAGGCCCAAA | PLASTID TRANSCRIPTIONALLY ACTIVE 9 (PTAC9); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: OSB3 (ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3); single-stranded DNA binding (TAIR:AT5G44785.1); Has 116 Blast hits to 66 proteins in 12 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G20330 | AT4G20330.1 | TGATGGGCCTAAC | transcription initiation factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor TFIIE, beta subunit (InterPro:IPR016656), Transcription factor TFIIE beta subunit-like, DNA-binding (InterPro:IPR017935); BEST Arabidopsis thaliana protein match is: transcription initiation factor-related (TAIR:AT4G21010.1); Has 212 Blast hits to 212 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 68; Plants - 35; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT4G20480 | AT4G20480.1 | GTAGGCCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G06810.1); Has 76 Blast hits to 74 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G21190 | AT4G21190.1 | TTAATGGGCCTATT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT4G21190.1 | TTAATGGGCCTATT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT4G21190.1 | TTAATGGGCCTTAT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT4G21192 | AT4G21192.1 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G21192.1 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21192.1 | ATAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21192.2 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21192.2 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21192.2 | ATAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21300 | AT4G21300.1 | AGAGGCCCATG | pentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G03580.1); Has 19749 Blast hits to 5268 proteins in 182 species: Archae - 1; Bacteria - 4; Metazoa - 89; Fungi - 126; Plants - 19072; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink).  |
AT4G21660 | AT4G21660.1 | TATATGGGCCTTAT | proline-rich spliceosome-associated (PSP) family protein; INVOLVED IN: mRNA processing; LOCATED IN: nucleus, chloroplast; CONTAINS InterPro DOMAIN/s: PSP, proline-rich (InterPro:IPR006568), Protein of unknown function DUF382 (InterPro:IPR007180); BEST Arabidopsis thaliana protein match is: pliceosome associated protein-related (TAIR:AT1G11520.1); Has 12288 Blast hits to 5916 proteins in 388 species: Archae - 20; Bacteria - 224; Metazoa - 7139; Fungi - 832; Plants - 388; Viruses - 239; Other Eukaryotes - 3446 (source: NCBI BLink).  |
AT4G22240 | AT4G22240.1 | GAGGCCCATTTA | plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: fruit, guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: FIB (FIBRILLIN); structural molecule (TAIR:AT4G04020.1); Has 296 Blast hits to 296 proteins in 63 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 219; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G22720 | AT4G22720.1 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink).  |
AT4G22720.2 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink).  | |
AT4G22910 | AT4G22910.1 | TTTAGGCCCATCT | FIZZY-RELATED 2 (FZR2); FUNCTIONS IN: signal transducer activity; INVOLVED IN: trichome branching, signal transduction, DNA endoreduplication, cell growth; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: CCS52A2; signal transducer (TAIR:AT4G11920.1); Has 32185 Blast hits to 17091 proteins in 521 species: Archae - 40; Bacteria - 4571; Metazoa - 14163; Fungi - 6386; Plants - 2781; Viruses - 0; Other Eukaryotes - 4244 (source: NCBI BLink).  |
AT4G23710 | AT4G23710.1 | ATTAGGCCCATAA | VAG2; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances; INVOLVED IN: proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar (H+)-ATPase G subunit (InterPro:IPR005124); BEST Arabidopsis thaliana protein match is: VMA10 (VACUOLAR MEMBRANE ATPASE 10); hydrogen ion transporting ATP synthase, rotational mechanism (TAIR:AT3G01390.2); Has 470 Blast hits to 470 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 268; Fungi - 80; Plants - 75; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
AT4G23710.1 | TTAATGGGCCTGA | VAG2; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances; INVOLVED IN: proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar (H+)-ATPase G subunit (InterPro:IPR005124); BEST Arabidopsis thaliana protein match is: VMA10 (VACUOLAR MEMBRANE ATPASE 10); hydrogen ion transporting ATP synthase, rotational mechanism (TAIR:AT3G01390.2); Has 470 Blast hits to 470 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 268; Fungi - 80; Plants - 75; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  | |
AT4G23890 | AT4G23890.1 | CTAGGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 252 Blast hits to 252 proteins in 67 species: Archae - 0; Bacteria - 101; Metazoa - 15; Fungi - 4; Plants - 21; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).  |
AT4G24440 | AT4G24440.1 | TATATGGGCCTTGTGTTGGGCCTT | transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT4G24440.2 | TATATGGGCCTTGTGTTGGGCCTT | transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  | |
AT4G24550 | AT4G24550.1 | AATAGGCCCATATA | clathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT5G46630.1); Has 1549 Blast hits to 1524 proteins in 208 species: Archae - 0; Bacteria - 0; Metazoa - 875; Fungi - 294; Plants - 96; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink).  |
AT4G24550.2 | AATAGGCCCATATA | clathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT5G46630.1); Has 1549 Blast hits to 1524 proteins in 208 species: Archae - 0; Bacteria - 0; Metazoa - 875; Fungi - 294; Plants - 96; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink).  | |
AT4G25550 | AT4G25550.1 | TAAATGGGCCTAAA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 53; Plants - 42; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT4G25570 | AT4G25570.1 | ATAATGGGCCTTAA | Encodes cytochrome b561.  |
AT4G26190 | AT4G26190.1 | TATATGGGCCTAAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36550.1); Has 24148 Blast hits to 14674 proteins in 713 species: Archae - 56; Bacteria - 1518; Metazoa - 9576; Fungi - 1916; Plants - 955; Viruses - 87; Other Eukaryotes - 10040 (source: NCBI BLink).  |
AT4G26230 | AT4G26230.1 | AAAGGCCCATAA | 60S ribosomal protein L31 (RPL31B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31C) (TAIR:AT5G56710.1); Has 865 Blast hits to 865 proteins in 270 species: Archae - 110; Bacteria - 2; Metazoa - 389; Fungi - 91; Plants - 124; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink).  |
AT4G26310 | AT4G26310.1 | TTAAGGCCCATTAT | elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink).  |
AT4G26600 | AT4G26600.1 | TCAGGCCCATTAG | nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink).  |
AT4G27320 | AT4G27320.1 | ATATGGGCCTTAA | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase.  |
AT4G27370 | AT4G27370.1 | TAAAGGCCCATTTA | member of Myosin-like proteins  |
AT4G27380 | AT4G27380.1 | TAAATGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G27740 | AT4G27740.1 | AAATGGGCCTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27745.1); Has 684 Blast hits to 682 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT4G28010 | AT4G28010.1 | ATATGGGCCTAAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62670.1); Has 27713 Blast hits to 6108 proteins in 193 species: Archae - 5; Bacteria - 29; Metazoa - 747; Fungi - 685; Plants - 24892; Viruses - 0; Other Eukaryotes - 1355 (source: NCBI BLink).  |
AT4G28060 | AT4G28060.1 | CTTAGGCCCATTAG | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT5G57815.1); Has 406 Blast hits to 406 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 235; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G28360 | AT4G28360.1 | ATAGGCCCATAA | ribosomal protein L22 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22, bacterial-type (InterPro:IPR005727); BEST Arabidopsis thaliana protein match is: ribosomal protein L22 family protein (TAIR:AT1G52370.3); Has 5503 Blast hits to 5503 proteins in 1687 species: Archae - 0; Bacteria - 3089; Metazoa - 109; Fungi - 48; Plants - 431; Viruses - 0; Other Eukaryotes - 1826 (source: NCBI BLink).  |
AT4G28540 | AT4G28540.1 | GTTAGGCCCATTTA | CASEIN KINASE I-LIKE 6 (CKL6); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasmodesma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ADK1 (dual specificity kinase 1); kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT1G03930.1); Has 46100 Blast hits to 45721 proteins in 1424 species: Archae - 12; Bacteria - 5612; Metazoa - 19980; Fungi - 4668; Plants - 5911; Viruses - 338; Other Eukaryotes - 9579 (source: NCBI BLink).  |
AT4G28730 | AT4G28730.1 | TATAGGCCCATTAAG | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae - 0; Bacteria - 1253; Metazoa - 362; Fungi - 221; Plants - 386; Viruses - 107; Other Eukaryotes - 817 (source: NCBI BLink).  |
AT4G28830 | AT4G28830.1 | AAAGCCCAATGGGCCTGA | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase small (InterPro:IPR007848), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 2052 Blast hits to 2052 proteins in 760 species: Archae - 135; Bacteria - 1556; Metazoa - 106; Fungi - 2; Plants - 24; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).  |
AT4G28830.2 | AAAGCCCAATGGGCCTGA | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase small (InterPro:IPR007848), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 2052 Blast hits to 2052 proteins in 760 species: Archae - 135; Bacteria - 1556; Metazoa - 106; Fungi - 2; Plants - 24; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).  | |
AT4G29040 | AT4G29040.1 | TATATGGGCCTTAG | 26S proteasome AAA-ATPase subunit RPT2a (RPT2a) mRNA,  |
AT4G29060 | AT4G29060.1 | TGATGGGCCTTAG | embryo defective 2726 (emb2726); FUNCTIONS IN: RNA binding, translation elongation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational elongation, response to cadmium ion; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), S1, RNA binding (InterPro:IPR003029), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor Ts, conserved site (InterPro:IPR018101), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: translation elongation factor Ts (EF-Ts), putative (TAIR:AT4G11120.1); Has 50675 Blast hits to 27365 proteins in 1859 species: Archae - 185; Bacteria - 24529; Metazoa - 6031; Fungi - 1971; Plants - 899; Viruses - 119; Other Eukaryotes - 16941 (source: NCBI BLink).  |
AT4G29060.2 | TGATGGGCCTTAG | embryo defective 2726 (emb2726); FUNCTIONS IN: RNA binding, translation elongation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational elongation, response to cadmium ion; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), S1, RNA binding (InterPro:IPR003029), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor Ts, conserved site (InterPro:IPR018101), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: translation elongation factor Ts (EF-Ts), putative (TAIR:AT4G11120.1); Has 50675 Blast hits to 27365 proteins in 1859 species: Archae - 185; Bacteria - 24529; Metazoa - 6031; Fungi - 1971; Plants - 899; Viruses - 119; Other Eukaryotes - 16941 (source: NCBI BLink).  | |
AT4G29390 | AT4G29390.1 | TATAGGCCCATTAAG | 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT4G29400 | AT4G29400.1 | CTTAATGGGCCTATA | unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink).  |
AT4G29520 | AT4G29520.1 | TTAATGGGCCTTAC | LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 120 Blast hits to 120 proteins in 43 species: Archae - 2; Bacteria - 0; Metazoa - 42; Fungi - 10; Plants - 19; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT4G29530 | AT4G29530.1 | GTAAGGCCCATTAA | 2,3-diketo-5-methylthio-1-phosphopentane phosphatase family; FUNCTIONS IN: phosphatase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G17710.1); Has 269 Blast hits to 267 proteins in 80 species: Archae - 0; Bacteria - 19; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT4G29820 | AT4G29820.1 | ACAGGCCCATTA | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit.  |
AT4G29820.1 | TAAAGGCCCATTAA | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit.  | |
AT4G29830 | AT4G29830.1 | TTAATGGGCCTGT | The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin.  |
AT4G29830.1 | TTAATGGGCCTTTA | The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin.  | |
AT4G30220 | AT4G30220.1 | ATAATGGGCCTTAT | SMALL NUCLEAR RIBONUCLEOPROTEIN F (RUXF); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small nuclear ribonucleoprotein SmF (InterPro:IPR016487), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14285.1); Has 865 Blast hits to 865 proteins in 209 species: Archae - 256; Bacteria - 0; Metazoa - 220; Fungi - 185; Plants - 64; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).  |
AT4G30220.1 | CAGGCCCATTAT | SMALL NUCLEAR RIBONUCLEOPROTEIN F (RUXF); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small nuclear ribonucleoprotein SmF (InterPro:IPR016487), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14285.1); Has 865 Blast hits to 865 proteins in 209 species: Archae - 256; Bacteria - 0; Metazoa - 220; Fungi - 185; Plants - 64; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).  | |
AT4G30500 | AT4G30500.1 | TTATGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23940.1); Has 218 Blast hits to 218 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 72; Plants - 29; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT4G30660 | AT4G30660.1 | CCAGGCCCATTTA | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT4G30660.2 | CCAGGCCCATTTA | hydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  | |
AT4G31010 | AT4G31010.1 | GTTAGGCCCATG | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G31010.2 | GTTAGGCCCATG | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G31150 | AT4G31150.1 | ATAATGGGCCTTTTAAAGGCCC | endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT4G31150.2 | ATAATGGGCCTTTTAAAGGCCC | endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT4G31560 | AT4G31560.1 | TTAATGGGCCTC | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane.  |
AT4G31985 | AT4G31985.1 | CATGGGCCTTGGGCCGAA | 60S ribosomal protein L39 (RPL39C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39B) (TAIR:AT3G02190.1); Has 591 Blast hits to 591 proteins in 225 species: Archae - 151; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).  |
AT4G32820 | AT4G32820.1 | AATAGGCCCATTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026).  |
AT4G32820.2 | AATAGGCCCATTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026).  | |
AT4G33865 | AT4G33865.1 | ATAAGGCCCATATA | 40S ribosomal protein S29 (RPS29C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S14 (InterPro:IPR001209); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S29 (RPS29B) (TAIR:AT3G44010.1); Has 694 Blast hits to 694 proteins in 260 species: Archae - 152; Bacteria - 0; Metazoa - 229; Fungi - 88; Plants - 102; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink).  |
AT4G33865.1 | TTTAGGCCCATATA | 40S ribosomal protein S29 (RPS29C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S14 (InterPro:IPR001209); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S29 (RPS29B) (TAIR:AT3G44010.1); Has 694 Blast hits to 694 proteins in 260 species: Archae - 152; Bacteria - 0; Metazoa - 229; Fungi - 88; Plants - 102; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink).  | |
AT4G34140 | AT4G34140.1 | TGATGGGCCTAAA | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT3G54230.1); Has 432 Blast hits to 428 proteins in 79 species: Archae - 0; Bacteria - 2; Metazoa - 338; Fungi - 40; Plants - 36; Viruses - 3; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT4G34700 | AT4G34700.1 | CAAAGGCCCATTT | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 51; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT4G35220 | AT4G35220.1 | TCAGGCCCATAA | cyclase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Putative cyclase (InterPro:IPR007325); BEST Arabidopsis thaliana protein match is: cyclase family protein (TAIR:AT4G34180.1); Has 778 Blast hits to 778 proteins in 304 species: Archae - 55; Bacteria - 578; Metazoa - 30; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  |
AT4G35850 | AT4G35850.1 | CAAGGCCCATA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink).  |
AT4G36280 | AT4G36280.1 | AAATGGGCCTATA | ATP-binding region, ATPase-like domain-containing protein; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: ATP-binding region, ATPase-like domain-containing protein (TAIR:AT4G36290.1); Has 306 Blast hits to 292 proteins in 51 species: Archae - 0; Bacteria - 16; Metazoa - 167; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT4G36420 | AT4G36420.1 | ATAGGCCCATAAAGGCCCATTT | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5784 Blast hits to 5784 proteins in 1564 species: Archae - 0; Bacteria - 3201; Metazoa - 134; Fungi - 85; Plants - 177; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink).  |
AT4G36480 | AT4G36480.1 | CATTGGGCCTCTAGGCCCATAT | Encodes the LCB1 subunit of serine palmitoyltransferase. Together with the LCB2 subunit, forms a functional serine palmitoyltransferase complex, which catalyzes the first reaction of sphingolipid biosynthesis. Knockout of LCB1 was embryo lethal. Partial suppression of LCB1 expression led to smaller plants due to reduced cell expansion.  |
AT4G36480.2 | CATTGGGCCTCTAGGCCCATAT | Encodes the LCB1 subunit of serine palmitoyltransferase. Together with the LCB2 subunit, forms a functional serine palmitoyltransferase complex, which catalyzes the first reaction of sphingolipid biosynthesis. Knockout of LCB1 was embryo lethal. Partial suppression of LCB1 expression led to smaller plants due to reduced cell expansion.  | |
AT4G36690 | AT4G36690.1 | ATAATGGGCCTTAT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink).  |
AT4G36690.2 | ATAATGGGCCTTAT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink).  | |
AT4G36690.3 | ATAATGGGCCTTAT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink).  | |
AT4G36800 | AT4G36800.1 | AAATGGGCCTAACGGGCTTTAATGGGCCAA | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.  |
AT4G36800.2 | AAATGGGCCTAACGGGCTTTAATGGGCCAA | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.  | |
AT4G36810 | AT4G36810.1 | CAAGGCCCATTC | Encodes a protein with geranylgeranyl pyrophosphate synthase activity involved in isoprenoid biosynthesis. The enzyme appears to be targeted to the chloroplast in epidermal cells and guard cells of leaves, and in etioplasts in roots.  |
AT4G37460 | AT4G37460.1 | AGTGGGCTAGGCCCATATA | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms.Involved in mediating effector-triggered immunity.  |
AT4G37660 | AT4G37660.1 | TTATGGGCCTTAT | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5731 Blast hits to 5731 proteins in 1563 species: Archae - 0; Bacteria - 3202; Metazoa - 131; Fungi - 85; Plants - 177; Viruses - 0; Other Eukaryotes - 2136 (source: NCBI BLink).  |
AT4G37830 | AT4G37830.1 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT4G37830.2 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT4G38180 | AT4G38180.1 | GAATGGGCCTTAT | FAR1-related sequence 5 (FRS5); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS3 (FAR1-related sequence 3); zinc ion binding (TAIR:AT2G27110.2); Has 1009 Blast hits to 905 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 1; Fungi - 125; Plants - 879; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G38180.1 | GAATGGGCCTTG | FAR1-related sequence 5 (FRS5); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS3 (FAR1-related sequence 3); zinc ion binding (TAIR:AT2G27110.2); Has 1009 Blast hits to 905 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 1; Fungi - 125; Plants - 879; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G38180.1 | GATGGGCCTTAT | FAR1-related sequence 5 (FRS5); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS3 (FAR1-related sequence 3); zinc ion binding (TAIR:AT2G27110.2); Has 1009 Blast hits to 905 proteins in 33 species: Archae - 2; Bacteria - 0; Metazoa - 1; Fungi - 125; Plants - 879; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G38210 | AT4G38210.1 | AGATGGGCCTGG | expansin -like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.  |
AT4G38225 | AT4G38225.1 | ATTAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G38225.2 | ATTAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G38225.3 | ATTAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G38280 | AT4G38280.1 | ATAATGGGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45250.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G38280.1 | ATATGGGCCTTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45250.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G38380 | AT4G38380.1 | AAAAGGCCCATTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink).  |
AT4G38490 | AT4G38490.1 | TGAGCCCAAAAAAGGCCCATA | unknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G38790 | AT4G38790.1 | CATGGGCCTTTT | ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT2G21190.1); Has 626 Blast hits to 626 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 114; Plants - 120; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  |
AT4G38790.1 | TTATGGGCCTAAT | ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT2G21190.1); Has 626 Blast hits to 626 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 114; Plants - 120; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  | |
AT4G38920 | AT4G38920.1 | TAGTGGGCCGTATGATGGGCCTAAG | VACUOLAR-TYPE H(+)-ATPASE C3 (ATVHA-C3); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: AVA-P1; ATPase/ proton-transporting ATPase, rotational mechanism (TAIR:AT4G34720.1); Has 1818 Blast hits to 1637 proteins in 400 species: Archae - 127; Bacteria - 312; Metazoa - 519; Fungi - 315; Plants - 225; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink).  |
AT4G39210 | AT4G39210.1 | AAATGGGCCTGG | Encodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots.  |
AT4G39235 | AT4G39235.1 | AAAGGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G05570.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G39240 | AT4G39240.1 | ATATGGGCCTAAGCCCATCA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT4G39240.1 | ATATGGGCCTAAGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink).  | |
AT4G39460 | AT4G39460.1 | TATAGGCCCATTAG | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway.  |
AT4G39520 | AT4G39520.1 | TATATGGGCCTAAA | GTP-binding protein, putative; FUNCTIONS IN: GTP binding; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), TGS (InterPro:IPR004095), GTP1/OBG (InterPro:IPR006073), GTP1/OBG, conserved site (InterPro:IPR006074), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: developmentally regulated GTP-binding protein, putative (TAIR:AT1G72660.3); Has 12043 Blast hits to 12023 proteins in 1588 species: Archae - 468; Bacteria - 6069; Metazoa - 728; Fungi - 429; Plants - 176; Viruses - 0; Other Eukaryotes - 4173 (source: NCBI BLink).  |
AT4G39550 | AT4G39550.1 | TGAGGCCCATTG | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2334 Blast hits to 1835 proteins in 108 species: Archae - 6; Bacteria - 90; Metazoa - 1470; Fungi - 6; Plants - 681; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink).  |
AT4G39560 | AT4G39560.1 | TGAGGCCCATTAAG | kelch repeat-containing F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), EF-HAND 1 (InterPro:IPR018247), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2608 Blast hits to 2033 proteins in 134 species: Archae - 4; Bacteria - 110; Metazoa - 1739; Fungi - 7; Plants - 628; Viruses - 37; Other Eukaryotes - 83 (source: NCBI BLink).  |
AT4G39560.2 | TGAGGCCCATTAAG | kelch repeat-containing F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), EF-HAND 1 (InterPro:IPR018247), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2608 Blast hits to 2033 proteins in 134 species: Archae - 4; Bacteria - 110; Metazoa - 1739; Fungi - 7; Plants - 628; Viruses - 37; Other Eukaryotes - 83 (source: NCBI BLink).  | |
AT4G39880 | AT4G39880.1 | TTCGGCCCATTAAGGCCCATTAA | ribosomal protein L23 family protein; FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L23/L15e, core (InterPro:IPR012678), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal protein L25/L23 (InterPro:IPR013025); Has 2011 Blast hits to 2011 proteins in 690 species: Archae - 0; Bacteria - 1392; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 592 (source: NCBI BLink).  |
AT4G40042 | AT4G40042.1 | ATAAGGCCCATTG | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, integral to membrane, signal peptidase complex; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT2G22425.2); Has 218 Blast hits to 218 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 56; Plants - 39; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT5G01020 | AT5G01020.1 | AAAAGGCCCATAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G05940.1); Has 84930 Blast hits to 83819 proteins in 2999 species: Archae - 48; Bacteria - 7829; Metazoa - 37401; Fungi - 6493; Plants - 18635; Viruses - 347; Other Eukaryotes - 14177 (source: NCBI BLink).  |
AT5G01020.1 | ATAATGGGCCTAG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G05940.1); Has 84930 Blast hits to 83819 proteins in 2999 species: Archae - 48; Bacteria - 7829; Metazoa - 37401; Fungi - 6493; Plants - 18635; Viruses - 347; Other Eukaryotes - 14177 (source: NCBI BLink).  | |
AT5G01350 | AT5G01350.1 | AGATGGGCCTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G01650 | AT5G01650.1 | TTAAGGCCCATTT | macrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1).  |
AT5G01650.2 | TTAAGGCCCATTT | macrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1).  | |
AT5G01780 | AT5G01780.1 | GAGGCCCATGGGCCCATG | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase (TAIR:AT3G14160.1); Has 755 Blast hits to 755 proteins in 354 species: Archae - 0; Bacteria - 517; Metazoa - 77; Fungi - 32; Plants - 43; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT5G01960 | AT5G01960.1 | ATAAGGCCCATAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G65040.3); Has 3886 Blast hits to 3874 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 2090; Fungi - 415; Plants - 660; Viruses - 46; Other Eukaryotes - 675 (source: NCBI BLink).  |
AT5G02470 | AT5G02470.1 | AAAAGGCCCATTTA | core cell cycle genes  |
AT5G02470.2 | AAAAGGCCCATTTA | core cell cycle genes  | |
AT5G02470.3 | AAAAGGCCCATTTA | core cell cycle genes  | |
AT5G02530 | AT5G02530.1 | AAAAGGCCCATTAAG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G59950.4); Has 10734 Blast hits to 7876 proteins in 597 species: Archae - 2; Bacteria - 1111; Metazoa - 4776; Fungi - 1622; Plants - 1564; Viruses - 50; Other Eukaryotes - 1609 (source: NCBI BLink).  |
AT5G02960 | AT5G02960.1 | CTTAATGGGCCTAC | 40S ribosomal protein S23 (RPS23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S23, eukaryotic/archaeal (InterPro:IPR005680), Ribosomal protein S12/S23 (InterPro:IPR006032), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S23 (RPS23A) (TAIR:AT3G09680.1); Has 6124 Blast hits to 6121 proteins in 1817 species: Archae - 180; Bacteria - 2807; Metazoa - 329; Fungi - 198; Plants - 755; Viruses - 0; Other Eukaryotes - 1855 (source: NCBI BLink).  |
AT5G03160 | AT5G03160.1 | GTTAGGCCCATAT | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast.  |
AT5G03880 | AT5G03880.1 | TTAAGGCCCAAAAGTAAGGCCCATTAAG | electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae - 48; Bacteria - 196; Metazoa - 1; Fungi - 33; Plants - 60; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT5G03880.1 | TTAAGGCCCAAAATTAAGGCCCATTAT | electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae - 48; Bacteria - 196; Metazoa - 1; Fungi - 33; Plants - 60; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  | |
AT5G05090 | AT5G05090.1 | CTAAGGCCCATAT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G10760.1); Has 890 Blast hits to 890 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 877; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT5G05310 | AT5G05310.1 | GATGGGCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  |
AT5G05310.2 | GATGGGCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  | |
AT5G05310.3 | GATGGGCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  | |
AT5G05370 | AT5G05370.1 | AAAAGGCCCATAT | ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G05380 | AT5G05380.1 | ATATGGGCCTTTT | PRENYLATED RAB ACCEPTOR 1.B3 (PRA1.B3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 371 Blast hits to 371 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 59; Plants - 178; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
AT5G05540 | AT5G05540.1 | CAAGGCCCATAA | SMALL RNA DEGRADING NUCLEASE 2 (SDN2); FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding (TAIR:AT5G67240.1); Has 1287 Blast hits to 1276 proteins in 177 species: Archae - 0; Bacteria - 12; Metazoa - 608; Fungi - 388; Plants - 159; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  |
AT5G05540.2 | CAAGGCCCATAA | SMALL RNA DEGRADING NUCLEASE 2 (SDN2); FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding (TAIR:AT5G67240.1); Has 1287 Blast hits to 1276 proteins in 177 species: Archae - 0; Bacteria - 12; Metazoa - 608; Fungi - 388; Plants - 159; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  | |
AT5G05610 | AT5G05610.1 | GATGGGCCATGGGCCAGGCCCATTT | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  |
AT5G05610.2 | GATGGGCCATGGGCCAGGCCCATTT | AL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  | |
AT5G05780 | AT5G05780.1 | TCAGGCCCATCATATTGGGCTTA | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity.  |
AT5G06110 | AT5G06110.1 | ATATGGGCCTAAT | DNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT3G11450.1); Has 30941 Blast hits to 21178 proteins in 1608 species: Archae - 101; Bacteria - 5693; Metazoa - 11416; Fungi - 3019; Plants - 1271; Viruses - 136; Other Eukaryotes - 9305 (source: NCBI BLink).  |
AT5G06210 | AT5G06210.1 | CCAGGCCCATAT | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP5 (glycine-rich RNA-binding protein 5); ATP binding / RNA binding (TAIR:AT1G74230.1); Has 20400 Blast hits to 15032 proteins in 629 species: Archae - 10; Bacteria - 1085; Metazoa - 11634; Fungi - 2516; Plants - 3112; Viruses - 0; Other Eukaryotes - 2043 (source: NCBI BLink).  |
AT5G06260 | AT5G06260.1 | CATGGGCCTT | nucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink).  |
AT5G07090 | AT5G07090.1 | AAATGGGCCTAT | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  |
AT5G07090.2 | AAATGGGCCTAT | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  | |
AT5G07920 | AT5G07920.1 | TAATGGGCCTGGGCCCT | diacylglycerol kinase  |
AT5G08270 | AT5G08270.1 | CCATTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23200.1); Has 51 Blast hits to 51 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G08270.1 | TTAAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23200.1); Has 51 Blast hits to 51 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  | |
AT5G08530 | AT5G08530.1 | AGAGGCCCATAA | 51 kDa subunit of complex I (CI51); FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, NAD or NADH binding, FMN binding, NADH dehydrogenase (ubiquinone) activity, oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NADH-ubiquinone oxidoreductase, 51 kDa subunit, conserved site (InterPro:IPR001949), NADH-ubiquinone oxidoreductase, 51 kDa subunit (InterPro:IPR011538), NADH-ubiquinone oxidoreductase, F subunit (InterPro:IPR011537); Has 6830 Blast hits to 6821 proteins in 987 species: Archae - 16; Bacteria - 2579; Metazoa - 179; Fungi - 80; Plants - 67; Viruses - 0; Other Eukaryotes - 3909 (source: NCBI BLink).  |
AT5G08535 | AT5G08535.1 | TTATGGGCCTCT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 689 Blast hits to 689 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 494; Fungi - 66; Plants - 91; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT5G08535.2 | TTATGGGCCTCT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 689 Blast hits to 689 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 494; Fungi - 66; Plants - 91; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  | |
AT5G08540 | AT5G08540.1 | AAAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G09390 | AT5G09390.1 | TTAAGGCCCATTT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).  |
AT5G09390.2 | TTAAGGCCCATTT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).  | |
AT5G09500 | AT5G09500.1 | TATATGGGCCTCA | 40S ribosomal protein S15 (RPS15C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15, eukaryotic/archaeal (InterPro:IPR005713), Ribosomal protein S19/S15 (InterPro:IPR002222); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S15 (RPS15E) (TAIR:AT5G43640.1); Has 4939 Blast hits to 4939 proteins in 1445 species: Archae - 179; Bacteria - 2209; Metazoa - 207; Fungi - 132; Plants - 460; Viruses - 0; Other Eukaryotes - 1752 (source: NCBI BLink).  |
AT5G09660 | AT5G09660.1 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.  |
AT5G09660.2 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.  | |
AT5G09660.3 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.  | |
AT5G09660.4 | TATGGGCCTTTAGTGGGCTTC | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.  | |
AT5G09740 | AT5G09740.1 | CTAATGGGCCTGA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.  |
AT5G09740.2 | CTAATGGGCCTGA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.  | |
AT5G09880 | AT5G09880.1 | TAAATGGGCCTTTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G16940.1); Has 75114 Blast hits to 36610 proteins in 1254 species: Archae - 65; Bacteria - 4369; Metazoa - 40620; Fungi - 8054; Plants - 5837; Viruses - 419; Other Eukaryotes - 15750 (source: NCBI BLink).  |
AT5G10100 | AT5G10100.1 | GTAGGCCCATTTA | trehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: embryo, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT5G65140.1); Has 1468 Blast hits to 1466 proteins in 515 species: Archae - 29; Bacteria - 765; Metazoa - 195; Fungi - 100; Plants - 258; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT5G10110 | AT5G10110.1 | TCAGGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G10160 | AT5G10160.1 | AAAAGGCCCATATA | beta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink).  |
AT5G10160.1 | AAAGGCCCATATA | beta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink).  | |
AT5G10560 | AT5G10560.1 | TAAAGGCCCATAA | glycosyl hydrolase family 3 protein; FUNCTIONS IN: xylan 1,4-beta-xylosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT1G78060.1); Has 5112 Blast hits to 4512 proteins in 661 species: Archae - 16; Bacteria - 2460; Metazoa - 12; Fungi - 920; Plants - 292; Viruses - 0; Other Eukaryotes - 1412 (source: NCBI BLink).  |
AT5G10740 | AT5G10740.1 | AATAGGCCCATTAGCCCAATTG | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae - 9; Bacteria - 1045; Metazoa - 1489; Fungi - 552; Plants - 1360; Viruses - 11; Other Eukaryotes - 1165 (source: NCBI BLink).  |
AT5G10745 | AT5G10745.1 | CAATTGGGCTAATGGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G10780 | AT5G10780.1 | TAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
AT5G10780.2 | TAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  | |
AT5G10840 | AT5G10840.1 | GTTAGGCCCATTG | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G25100.1); Has 1057 Blast hits to 1040 proteins in 178 species: Archae - 0; Bacteria - 38; Metazoa - 446; Fungi - 142; Plants - 235; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  |
AT5G11150 | AT5G11150.1 | ATAATGGGCCTTG | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family.  |
AT5G11170 | AT5G11170.1 | TTTAGGCCCATTAA | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus; EXPRESSED IN: guard cell, root, cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G11200.1); Has 28546 Blast hits to 28139 proteins in 1749 species: Archae - 514; Bacteria - 11832; Metazoa - 5046; Fungi - 3322; Plants - 1384; Viruses - 50; Other Eukaryotes - 6398 (source: NCBI BLink).  |
AT5G11200 | AT5G11200.1 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  |
AT5G11200.2 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  | |
AT5G11200.3 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  | |
AT5G11580 | AT5G11580.1 | TATAGGCCCATG | UVB-resistance protein-related / regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: chromatin binding, Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15654 Blast hits to 4338 proteins in 271 species: Archae - 65; Bacteria - 1617; Metazoa - 6245; Fungi - 716; Plants - 1411; Viruses - 0; Other Eukaryotes - 5600 (source: NCBI BLink).  |
AT5G11580.1 | TTAATGGGCCTATT | UVB-resistance protein-related / regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: chromatin binding, Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15654 Blast hits to 4338 proteins in 271 species: Archae - 65; Bacteria - 1617; Metazoa - 6245; Fungi - 716; Plants - 1411; Viruses - 0; Other Eukaryotes - 5600 (source: NCBI BLink).  | |
AT5G12020 | AT5G12020.1 | GAATGGGCCTTG | 17.6 KDA CLASS II HEAT SHOCK PROTEIN (HSP17.6II); INVOLVED IN: response to heat; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 4227 Blast hits to 4227 proteins in 942 species: Archae - 102; Bacteria - 2394; Metazoa - 83; Fungi - 183; Plants - 932; Viruses - 0; Other Eukaryotes - 533 (source: NCBI BLink).  |
AT5G12030 | AT5G12030.1 | ATATGGGCCTGA | Encodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development.  |
AT5G12040 | AT5G12040.1 | TCAGGCCCATAT | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink).  |
AT5G12040.2 | TCAGGCCCATAT | carbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink).  | |
AT5G12410 | AT5G12410.1 | CAAGCCCAATAGGCCCATTC | THUMP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: THUMP (InterPro:IPR004114); Has 2926 Blast hits to 1988 proteins in 205 species: Archae - 10; Bacteria - 67; Metazoa - 1296; Fungi - 226; Plants - 118; Viruses - 74; Other Eukaryotes - 1135 (source: NCBI BLink).  |
AT5G13010 | AT5G13010.1 | AAAAGGCCCATAT | embryo defective 3011 (EMB3011); FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 7285 Blast hits to 6618 proteins in 979 species: Archae - 6; Bacteria - 1991; Metazoa - 2135; Fungi - 867; Plants - 393; Viruses - 401; Other Eukaryotes - 1492 (source: NCBI BLink).  |
AT5G13190 | AT5G13190.1 | AAAAGGCCCATTAAG | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LPS-induced tumor necrosis factor alpha factor (InterPro:IPR006629); Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G13310 | AT5G13310.1 | CCATTAAGCCAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13970.1); Has 356 Blast hits to 305 proteins in 95 species: Archae - 0; Bacteria - 44; Metazoa - 138; Fungi - 38; Plants - 34; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT5G14030 | AT5G14030.1 | GTAGGCCCATTAT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT5G14030.2 | GTAGGCCCATTAT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14030.3 | GTAGGCCCATTAT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14030.4 | GTAGGCCCATTAT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14100 | AT5G14100.1 | AAAAGCCCAATTAAGGCCCATTC | member of NAP subfamily  |
AT5G14220 | AT5G14220.1 | ATAATGGGCCTGA | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development.  |
AT5G14260 | AT5G14260.1 | TCAGGCCCATTC | SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT5G14260.2 | TCAGGCCCATTC | SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT5G14260.3 | TCAGGCCCATTC | SET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT5G14430 | AT5G14430.1 | ACAGGCCCATTTA | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G14430.2 | ACAGGCCCATTTA | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT5G14440 | AT5G14440.1 | TAAAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink).  |
AT5G14440.2 | TAAAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink).  | |
AT5G15020 | AT5G15020.1 | TTAATGGGCCTAAT | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190).  |
AT5G15320 | AT5G15320.1 | AGAGGCCCATTTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G15320.2 | AGAGGCCCATTTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G15750 | AT5G15750.1 | ATGGGCTTCTCAGGCCCATAA | RNA-binding S4 domain-containing protein; FUNCTIONS IN: RNA binding, rRNA binding; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), RNA-binding S4 (InterPro:IPR002942); Has 877 Blast hits to 877 proteins in 267 species: Archae - 114; Bacteria - 0; Metazoa - 268; Fungi - 193; Plants - 105; Viruses - 0; Other Eukaryotes - 197 (source: NCBI BLink).  |
AT5G16240 | AT5G16240.1 | CGGCCCATGGGCCTCT | acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT3G02630.1); Has 575 Blast hits to 572 proteins in 129 species: Archae - 0; Bacteria - 208; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT5G16610 | AT5G16610.1 | TATGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT5G16610.2 | TATGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  | |
AT5G16710 | AT5G16710.1 | TGAGGCCCATG | The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.  |
AT5G17190 | AT5G17190.1 | AATAGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G17610 | AT5G17610.1 | TATAGGCCCATGTAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 44 Blast hits to 44 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G17790 | AT5G17790.1 | TTATGGGCCTAT | Encodes a 85.9 kDa protein containing novel repeats and zinc fingers described as protein interaction domains. VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development. Mutants display a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells.  |
AT5G17900 | AT5G17900.1 | ATAGGCCCATGAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink).  |
AT5G18110 | AT5G18110.1 | CCCAATAAGGCCCATAT | NOVEL CAP-BINDING PROTEIN (NCBP); FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 4E (eIF-4E) (InterPro:IPR001040); BEST Arabidopsis thaliana protein match is: EIF4E (EUKARYOTIC TRANSLATION INITATION FACTOR 4E); RNA binding / RNA cap binding / protein binding / translation initiation factor (TAIR:AT4G18040.1); Has 1298 Blast hits to 1298 proteins in 204 species: Archae - 0; Bacteria - 0; Metazoa - 608; Fungi - 226; Plants - 212; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink).  |
AT5G18110.1 | CTAAGGCCCATTTA | NOVEL CAP-BINDING PROTEIN (NCBP); FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 4E (eIF-4E) (InterPro:IPR001040); BEST Arabidopsis thaliana protein match is: EIF4E (EUKARYOTIC TRANSLATION INITATION FACTOR 4E); RNA binding / RNA cap binding / protein binding / translation initiation factor (TAIR:AT4G18040.1); Has 1298 Blast hits to 1298 proteins in 204 species: Archae - 0; Bacteria - 0; Metazoa - 608; Fungi - 226; Plants - 212; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink).  | |
AT5G18120 | AT5G18120.1 | TAAATGGGCCTTAG | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group.  |
AT5G18140 | AT5G18140.1 | TAAAGGCCCATAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G22360.1); Has 15420 Blast hits to 15415 proteins in 1898 species: Archae - 116; Bacteria - 5110; Metazoa - 3216; Fungi - 1289; Plants - 1204; Viruses - 8; Other Eukaryotes - 4477 (source: NCBI BLink).  |
AT5G18620 | AT5G18620.1 | GCCCATGGGCCTTTAAAGCCC | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).  |
AT5G18620.2 | GCCCATGGGCCTTTAAAGCCC | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).  | |
AT5G18630 | AT5G18630.1 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  |
AT5G18630.2 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  | |
AT5G18630.3 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  | |
AT5G19300 | AT5G19300.1 | TGAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Protein of unknown function DUF171 (InterPro:IPR003750); Has 4766 Blast hits to 2044 proteins in 217 species: Archae - 72; Bacteria - 102; Metazoa - 2264; Fungi - 372; Plants - 195; Viruses - 4; Other Eukaryotes - 1757 (source: NCBI BLink).  |
AT5G19370 | AT5G19370.1 | AGAGGCCCATAT | rhodanese-like domain-containing protein / PPIC-type PPIASE domain-containing protein; FUNCTIONS IN: isomerase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763), Peptidyl-prolyl cis-trans isomerase, PpiC-type (InterPro:IPR000297); BEST Arabidopsis thaliana protein match is: CNX5 (CO-FACTOR FOR NITRATE, REDUCTASE AND XANTHINE DEHYDROGENASE 5); Mo-molybdopterin cofactor sulfurase (TAIR:AT5G55130.2); Has 6697 Blast hits to 6647 proteins in 1168 species: Archae - 22; Bacteria - 4699; Metazoa - 128; Fungi - 99; Plants - 68; Viruses - 0; Other Eukaryotes - 1681 (source: NCBI BLink).  |
AT5G19510 | AT5G19510.1 | AAGGCCCATAAATAAGCCCAAAT | elongation factor 1B alpha-subunit 2 (eEF1Balpha2); FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation, defense response to bacterium; LOCATED IN: apoplast, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1B alpha-subunit 1 (eEF1Balpha1) (TAIR:AT5G12110.1); Has 715 Blast hits to 715 proteins in 199 species: Archae - 0; Bacteria - 2; Metazoa - 371; Fungi - 103; Plants - 110; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).  |
AT5G19930 | AT5G19930.1 | CTATTGGGTCAGCCCATTTGAGGCCCATG | integral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink).  |
AT5G19940 | AT5G19940.1 | CATGGGCCTCAAATGGGCTGACCCAATAG | plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G19940.2 | CATGGGCCTCAAATGGGCTGACCCAATAG | plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT5G20140 | AT5G20140.1 | GAATGGGCCTC | SOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae - 10; Bacteria - 204; Metazoa - 88; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink).  |
AT5G20160 | AT5G20160.1 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
AT5G20160.2 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G20160.3 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G20480 | AT5G20480.1 | AAAGGCCCATCA | Encodes a predicted leucine-rich repeat receptor kinase (LRR-RLK). Functions as the receptor for bacterial PAMP (pathogen associated molecular patterns) EF-Tu.  |
AT5G22330 | AT5G22330.1 | TAAAGGCCCATTG | RESISTANCE TO PSEUDOMONAS SYRINGAE PV MACULICOLA INTERACTOR 1 (RIN1); FUNCTIONS IN: protein binding; INVOLVED IN: defense response to fungus, incompatible interaction, meristem development; LOCATED IN: nucleolus, nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TIP49, C-terminal (InterPro:IPR010339), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: DNA helicase, putative (TAIR:AT5G67630.1); Has 2675 Blast hits to 2634 proteins in 789 species: Archae - 254; Bacteria - 1222; Metazoa - 326; Fungi - 290; Plants - 78; Viruses - 0; Other Eukaryotes - 505 (source: NCBI BLink).  |
AT5G22340 | AT5G22340.1 | CAATGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G22340.2 | CAATGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT5G23200 | AT5G23200.1 | TTTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G23230 | AT5G23230.1 | CTAGGCCCATTT | NICOTINAMIDASE 2 (NIC2); FUNCTIONS IN: nicotinamidase activity, catalytic activity; INVOLVED IN: NAD metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); BEST Arabidopsis thaliana protein match is: NIC3 (NICOTINAMIDASE 3); catalytic/ nicotinamidase (TAIR:AT5G23220.1); Has 4281 Blast hits to 4279 proteins in 809 species: Archae - 137; Bacteria - 3598; Metazoa - 0; Fungi - 94; Plants - 51; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink).  |
AT5G23250 | AT5G23250.1 | CAATGGGCCTTAA | succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (ADP-forming) activity, succinate-CoA ligase (GDP-forming) activity, binding, ATP citrate synthase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G08300.1); Has 7114 Blast hits to 7113 proteins in 1234 species: Archae - 196; Bacteria - 2692; Metazoa - 350; Fungi - 188; Plants - 87; Viruses - 0; Other Eukaryotes - 3601 (source: NCBI BLink).  |
AT5G23250.2 | CAATGGGCCTTAA | succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative; FUNCTIONS IN: succinate-CoA ligase (ADP-forming) activity, succinate-CoA ligase (GDP-forming) activity, binding, ATP citrate synthase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Succinyl-CoA ligase, alpha subunit (InterPro:IPR005810), ATP-citrate lyase/succinyl-CoA ligase (InterPro:IPR005811), NAD(P)-binding (InterPro:IPR016040), CoA-binding (InterPro:IPR003781), ATP-citrate lyase/succinyl-CoA ligase, active site (InterPro:IPR017440), Succinyl-CoA synthetase-like (InterPro:IPR016102); BEST Arabidopsis thaliana protein match is: succinyl-CoA ligase (GDP-forming) alpha-chain, mitochondrial, putative / succinyl-CoA synthetase, alpha chain, putative / SCS-alpha, putative (TAIR:AT5G08300.1); Has 7114 Blast hits to 7113 proteins in 1234 species: Archae - 196; Bacteria - 2692; Metazoa - 350; Fungi - 188; Plants - 87; Viruses - 0; Other Eukaryotes - 3601 (source: NCBI BLink).  | |
AT5G23290 | AT5G23290.1 | TAAATGGGCCAATATGGGCCTTAT | PREFOLDIN 5 (PDF5); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin alpha subunit (InterPro:IPR011599); Has 365 Blast hits to 365 proteins in 170 species: Archae - 46; Bacteria - 3; Metazoa - 137; Fungi - 83; Plants - 26; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT5G23420 | AT5G23420.1 | ATAATGGGCCTCA | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain.  |
AT5G23900 | AT5G23900.1 | CCAGGCCCATTTA | 60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 98; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT5G24520 | AT5G24520.1 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes.  |
AT5G24520.2 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes.  | |
AT5G24520.3 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes.  | |
AT5G24970 | AT5G24970.1 | ATATGGGCCTAAG | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink).  |
AT5G24970.1 | TTAATGGGCCTGA | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink).  | |
AT5G24980 | AT5G24980.1 | CTTAGGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G24980.1 | TCAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G25070 | AT5G25070.1 | TTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 81684 Blast hits to 44791 proteins in 1880 species: Archae - 1252; Bacteria - 11295; Metazoa - 39436; Fungi - 6166; Plants - 3117; Viruses - 367; Other Eukaryotes - 20051 (source: NCBI BLink).  |
AT5G25080 | AT5G25080.1 | TTAATGGGCCTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146), Exosome-associated factor Rrp47/DNA strand repair C1D (InterPro:IPR011082); Has 137 Blast hits to 137 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 42; Plants - 16; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT5G25100 | AT5G25100.1 | ATTAGGCCCATTTA | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G10840.1); Has 1029 Blast hits to 1012 proteins in 169 species: Archae - 0; Bacteria - 14; Metazoa - 445; Fungi - 142; Plants - 236; Viruses - 0; Other Eukaryotes - 192 (source: NCBI BLink).  |
AT5G25475 | AT5G25475.1 | TAAATGGGCCTTATTCGGCCCGTTA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G25475.2 | TAAATGGGCCTTATTCGGCCCGTTA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G25475.3 | TAAATGGGCCTTATTCGGCCCGTTA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G25510 | AT5G25510.1 | TAAATGGGCCTTAG | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: ATB' GAMMA; poly(U) binding / protein phosphatase type 2A regulator (TAIR:AT4G15415.2); Has 855 Blast hits to 848 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 492; Fungi - 97; Plants - 156; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT5G25520 | AT5G25520.1 | CTAAGGCCCATTTA | transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink).  |
AT5G25520.2 | CTAAGGCCCATTTA | transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink).  | |
AT5G26360 | AT5G26360.1 | TTAATGGGCCTTAG | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, gamma subunit (InterPro:IPR012719), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G11830.1); Has 12411 Blast hits to 12269 proteins in 2241 species: Archae - 394; Bacteria - 5329; Metazoa - 1841; Fungi - 951; Plants - 480; Viruses - 2; Other Eukaryotes - 3414 (source: NCBI BLink).  |
AT5G26680 | AT5G26680.1 | CATGGGCCTTAA | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink).  |
AT5G26680.1 | TGATGGGCCTTAA | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink).  | |
AT5G26680.2 | CATGGGCCTTAA | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink).  | |
AT5G26680.2 | TGATGGGCCTTAA | endonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink).  | |
AT5G26880 | AT5G26880.1 | GAATGGGCCTAAA | tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 3878 Blast hits to 3878 proteins in 1119 species: Archae - 0; Bacteria - 2309; Metazoa - 3; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 1546 (source: NCBI BLink).  |
AT5G27400 | AT5G27400.1 | TATAGGCCCATTAGGCCCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 806 Blast hits to 806 proteins in 171 species: Archae - 0; Bacteria - 62; Metazoa - 389; Fungi - 161; Plants - 105; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).  |
AT5G27700 | AT5G27700.1 | CATGGGCCTT | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e, conserved site (InterPro:IPR018279), Ribosomal protein S21e (InterPro:IPR001931); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S21 (RPS21B) (TAIR:AT3G53890.2); Has 477 Blast hits to 477 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT5G27700.1 | GATGGGCCTGA | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e, conserved site (InterPro:IPR018279), Ribosomal protein S21e (InterPro:IPR001931); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S21 (RPS21B) (TAIR:AT3G53890.2); Has 477 Blast hits to 477 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  | |
AT5G35530 | AT5G35530.1 | AAATGGGCCTTAAAAGGCCGGGCCTTG | 40S ribosomal protein S3 (RPS3C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3A) (TAIR:AT2G31610.1); Has 3856 Blast hits to 3855 proteins in 1171 species: Archae - 174; Bacteria - 1930; Metazoa - 296; Fungi - 95; Plants - 109; Viruses - 0; Other Eukaryotes - 1252 (source: NCBI BLink).  |
AT5G38110 | AT5G38110.1 | TTAGCCCATGGGCCTTAA | This gene is predicted to encode a silencing group A protein. Plant lines expressing RNAi constructs directed against SGA1 have reduced levels of agrobacterium-mediated root transformation.  |
AT5G38480 | AT5G38480.1 | TAAAGGCCCATAA | general regulatory factor, a 14-3-3 gene  |
AT5G38480.2 | TAAAGGCCCATAA | general regulatory factor, a 14-3-3 gene  | |
AT5G38650 | AT5G38650.1 | AAAAGCCCAAATGGGCCTTG | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT1G67250.1); Has 161 Blast hits to 161 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT5G40200 | AT5G40200.1 | TCAGGCCCATTT | Encodes a putative DegP protease.  |
AT5G40810 | AT5G40810.1 | ATTAGGCCCATG | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink).  |
AT5G40810.2 | ATTAGGCCCATG | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink).  | |
AT5G41190 | AT5G41190.1 | ATTTGGGCCTTGTGAGGCCCATTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nin one binding (NOB1) Zn-ribbon like (InterPro:IPR014881), D-site 20S pre-rRNA nuclease (InterPro:IPR017117); Has 855 Blast hits to 653 proteins in 196 species: Archae - 53; Bacteria - 16; Metazoa - 335; Fungi - 168; Plants - 29; Viruses - 10; Other Eukaryotes - 244 (source: NCBI BLink).  |
AT5G41600 | AT5G41600.1 | TAAATGGGCCTTAA | VIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 648; Fungi - 2; Plants - 271; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT5G41760 | AT5G41760.1 | CAAGGCCCATAA | nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  |
AT5G41760.2 | CAAGGCCCATAA | nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  | |
AT5G41940 | AT5G41940.1 | AAGGCCCATTAA | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3483 Blast hits to 2868 proteins in 186 species: Archae - 2; Bacteria - 83; Metazoa - 1894; Fungi - 490; Plants - 337; Viruses - 5; Other Eukaryotes - 672 (source: NCBI BLink).  |
AT5G41970 | AT5G41970.1 | TTAAGGCCCATGGGCCTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metal-dependent protein hydrolase (InterPro:IPR003226); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49320.1); Has 464 Blast hits to 461 proteins in 209 species: Archae - 0; Bacteria - 122; Metazoa - 131; Fungi - 87; Plants - 29; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  |
AT5G42000 | AT5G42000.1 | TAATGGGCCTCT | ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G42000.2 | TAATGGGCCTCT | ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  | |
AT5G44320 | AT5G44320.1 | AAAAGCCCATTGAGGCCCATTAAG | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 40; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT5G45990 | AT5G45990.1 | TTTAGGCCCATTAAG | crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink).  |
AT5G46030 | AT5G46030.1 | TAAATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF701, zinc-binding putative (InterPro:IPR007808); Has 2456 Blast hits to 1418 proteins in 196 species: Archae - 2; Bacteria - 26; Metazoa - 1582; Fungi - 186; Plants - 111; Viruses - 40; Other Eukaryotes - 509 (source: NCBI BLink).  |
AT5G46030.1 | TATGGGCCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF701, zinc-binding putative (InterPro:IPR007808); Has 2456 Blast hits to 1418 proteins in 196 species: Archae - 2; Bacteria - 26; Metazoa - 1582; Fungi - 186; Plants - 111; Viruses - 40; Other Eukaryotes - 509 (source: NCBI BLink).  | |
AT5G46630 | AT5G46630.1 | ACAGGCCCATAA | clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family; similar to micro-adaptins of clathrin coated vesicle adaptor complexes  |
AT5G46630.2 | ACAGGCCCATAA | clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family; similar to micro-adaptins of clathrin coated vesicle adaptor complexes  | |
AT5G47580 | AT5G47580.1 | ATTAGGCCCATG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17250.1); Has 17 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G47690 | AT5G47690.1 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  |
AT5G47690.2 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  | |
AT5G47690.3 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  | |
AT5G47700 | AT5G47700.1 | TAAATGGGCCTAAT | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink).  |
AT5G47700.2 | TAAATGGGCCTAAT | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink).  | |
AT5G47880 | AT5G47880.1 | TACTGGGCTTAGGCCCATTAA | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.  |
AT5G47880.2 | TACTGGGCTTAGGCCCATTAA | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.  | |
AT5G49000 | AT5G49000.1 | ATAAGGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink).  |
AT5G49000.2 | ATAAGGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink).  | |
AT5G49200 | AT5G49200.1 | TGATGGGCCTAAA | WD-40 repeat family protein / zfwd4 protein (ZFWD4); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / zfwd3 protein (ZFWD3) (TAIR:AT5G40880.1); Has 25041 Blast hits to 14412 proteins in 471 species: Archae - 20; Bacteria - 3252; Metazoa - 10699; Fungi - 5302; Plants - 2300; Viruses - 0; Other Eukaryotes - 3468 (source: NCBI BLink).  |
AT5G49510 | AT5G49510.1 | TAATGGGCCTG | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT5G49510.2 | TAATGGGCCTG | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT5G49610 | AT5G49610.1 | ATAATGGGCCTTGGGCCTAG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G33530.1); Has 993 Blast hits to 986 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 981; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT5G50870 | AT5G50870.1 | ATAATGGGCCTAG | ubiquitin-conjugating enzyme 27 (UBC27); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: UBC8 (UBIQUITIN CONJUGATING ENZYME 8); protein binding / ubiquitin-protein ligase (TAIR:AT5G41700.4); Has 7501 Blast hits to 7499 proteins in 306 species: Archae - 0; Bacteria - 0; Metazoa - 3692; Fungi - 1438; Plants - 1085; Viruses - 19; Other Eukaryotes - 1267 (source: NCBI BLink).  |
AT5G50960 | AT5G50960.1 | ATAAGGCCCATG | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal.  |
AT5G51910 | AT5G51910.1 | ACAGGCCCATAT | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G51910.1 | CAAGGCCCATTAG | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G51910.2 | ACAGGCCCATAT | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G51910.2 | CAAGGCCCATTAG | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G52380 | AT5G52380.1 | AATAGGCCCATTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G43590.1); Has 2838 Blast hits to 1585 proteins in 218 species: Archae - 0; Bacteria - 0; Metazoa - 882; Fungi - 700; Plants - 374; Viruses - 490; Other Eukaryotes - 392 (source: NCBI BLink).  |
AT5G52840 | AT5G52840.1 | ATAAGGCCCATTAT | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, chloroplast, respiratory chain complex I, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ETC complex I subunit (InterPro:IPR006806); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28005.1); Has 272 Blast hits to 272 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 69; Plants - 31; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT5G52840.1 | ATTAGGCCCATTAA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, chloroplast, respiratory chain complex I, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ETC complex I subunit (InterPro:IPR006806); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28005.1); Has 272 Blast hits to 272 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 69; Plants - 31; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  | |
AT5G53330 | AT5G53330.1 | TATGGGCCTTAATGGCCCAATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940); Has 28 Blast hits to 28 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G54080 | AT5G54080.1 | TTATGGGCCTAAT | homogentisate 1,2-dioxygenase  |
AT5G54080.2 | TTATGGGCCTAAT | homogentisate 1,2-dioxygenase  | |
AT5G54680 | AT5G54680.1 | TGATGGGCCTTG | iaa-leucine resistant3 (ILR3); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G51070.1); Has 563 Blast hits to 555 proteins in 74 species: Archae - 4; Bacteria - 10; Metazoa - 69; Fungi - 13; Plants - 431; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).  |
AT5G54940 | AT5G54940.1 | CTTAATGGGCCTAC | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT5G54940.2 | CTTAATGGGCCTAC | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink).  | |
AT5G55310 | AT5G55310.1 | AAATGGGCCTT | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality.  |
AT5G55510 | AT5G55510.1 | TGAGGCCCATAA | P-P-bond-hydrolysis-driven protein transmembrane transporter/ protein transporter; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT4G26670.1); Has 385 Blast hits to 385 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 135; Plants - 78; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT5G55610 | AT5G55610.1 | TTAATGGGCCTTAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G55610.2 | TTAATGGGCCTTAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G56360 | AT5G56360.1 | CTAATGGGCCTATT | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink).  |
AT5G56360.1 | TATAGGCCCATTAG | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink).  | |
AT5G56700 | AT5G56700.1 | TGATGGGCCTATA | F-box protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G60610.1); Has 668 Blast hits to 656 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 666; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G56710 | AT5G56710.1 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  |
AT5G56710.2 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  | |
AT5G57040 | AT5G57040.1 | CTAGGCCCATC | lactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 744 Blast hits to 744 proteins in 277 species: Archae - 0; Bacteria - 578; Metazoa - 2; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
AT5G57290 | AT5G57290.1 | TCAGGCCCATCT | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  |
AT5G57290.2 | TCAGGCCCATCT | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  | |
AT5G57290.3 | TCAGGCCCATCT | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink).  | |
AT5G57300 | AT5G57300.1 | ATAATGGGCCTTTT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink).  |
AT5G57300.2 | ATAATGGGCCTTTT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink).  | |
AT5G57490 | AT5G57490.1 | GAATGGGCCTCA | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol.  |
AT5G57590 | AT5G57590.1 | CCAGGCCCATTAG | Mutant complemented by E coli Bio A gene encoding 7,8-diaminopelargonic acid aminotransferase.  |
AT5G57930 | AT5G57930.1 | GCCCATTAAAGGCCCATTAT | ACCUMULATION OF PHOTOSYSTEM ONE 2  |
AT5G57930.2 | GCCCATTAAAGGCCCATTAT | ACCUMULATION OF PHOTOSYSTEM ONE 2  | |
AT5G58090 | AT5G58090.1 | ATATGGGCCTGT | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT4G31140.1); Has 1739 Blast hits to 1690 proteins in 137 species: Archae - 0; Bacteria - 12; Metazoa - 0; Fungi - 53; Plants - 1666; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT5G58100 | AT5G58100.1 | ACAGGCCCATAT | unknown protein; INVOLVED IN: pollen exine formation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28720.1); Has 82 Blast hits to 62 proteins in 14 species: Archae - 2; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT5G58130 | AT5G58130.1 | CTAATGGGCCTTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G50690.1); Has 13214 Blast hits to 6289 proteins in 622 species: Archae - 145; Bacteria - 5890; Metazoa - 2525; Fungi - 1196; Plants - 360; Viruses - 129; Other Eukaryotes - 2969 (source: NCBI BLink).  |
AT5G58140 | AT5G58140.1 | ATAAGGCCCATTAG | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.  |
AT5G58140.2 | ATAAGGCCCATTAG | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.  | |
AT5G58140.3 | ATAAGGCCCATTAG | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.  | |
AT5G58140.4 | ATAAGGCCCATTAG | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.  | |
AT5G58220 | AT5G58220.1 | AAAAGGCCCATTT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink).  |
AT5G58220.2 | AAAAGGCCCATTT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink).  | |
AT5G58220.3 | AAAAGGCCCATTT | Transthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink).  | |
AT5G58230 | AT5G58230.1 | AAATGGGCCTTTT | Encodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1.  |
AT5G58290 | AT5G58290.1 | AAAAGGCCCATTTA | 26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA,  |
AT5G58420 | AT5G58420.1 | TAAATGGGCCTCT | 40S ribosomal protein S4 (RPS4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 941 Blast hits to 941 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).  |
AT5G58440 | AT5G58440.1 | CTAATGGGCCTAAACAAGCCCAT | SORTING NEXIN 2a (SNX2a); FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2b (SORTING NEXIN 2b); phosphoinositide binding / protein binding (TAIR:AT5G07120.1); Has 1775 Blast hits to 1763 proteins in 175 species: Archae - 7; Bacteria - 6; Metazoa - 1144; Fungi - 391; Plants - 81; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT5G59140 | AT5G59140.1 | ATAATGGGCCTC | SKP1 family protein; FUNCTIONS IN: protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); Has 313 Blast hits to 313 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 77; Plants - 28; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT5G59210 | AT5G59210.1 | CCATGGGCCTATT | myosin heavy chain-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 52386 Blast hits to 29309 proteins in 1451 species: Archae - 516; Bacteria - 4841; Metazoa - 28674; Fungi - 3719; Plants - 1637; Viruses - 146; Other Eukaryotes - 12853 (source: NCBI BLink).  |
AT5G59210.2 | CCATGGGCCTATT | myosin heavy chain-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 52386 Blast hits to 29309 proteins in 1451 species: Archae - 516; Bacteria - 4841; Metazoa - 28674; Fungi - 3719; Plants - 1637; Viruses - 146; Other Eukaryotes - 12853 (source: NCBI BLink).  | |
AT5G59500 | AT5G59500.1 | TTAGCCCATAGGCCCATTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 491 Blast hits to 491 proteins in 204 species: Archae - 22; Bacteria - 353; Metazoa - 4; Fungi - 21; Plants - 20; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
AT5G60140 | AT5G60140.1 | TTAAGGCCCATTT | transcriptional factor B3 family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: transcriptional factor B3 family protein (TAIR:AT5G60130.1); Has 35622 Blast hits to 9758 proteins in 600 species: Archae - 149; Bacteria - 18835; Metazoa - 6044; Fungi - 2604; Plants - 1070; Viruses - 420; Other Eukaryotes - 6500 (source: NCBI BLink).  |
AT5G60620 | AT5G60620.1 | ATAATGGGCCTGA | phospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: triglyceride biosynthetic process, diacylglycerol biosynthetic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: phospholipid/glycerol acyltransferase family protein (TAIR:AT1G80950.1); Has 820 Blast hits to 786 proteins in 139 species: Archae - 0; Bacteria - 81; Metazoa - 535; Fungi - 2; Plants - 72; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).  |
AT5G60940 | AT5G60940.1 | ATAGGCCCATTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink).  |
AT5G60940.1 | CAAAGGCCCATTAG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink).  | |
AT5G60940.2 | ATAGGCCCATTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink).  | |
AT5G60940.2 | CAAAGGCCCATTAG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink).  | |
AT5G61170 | AT5G61170.1 | ATAGGCCCATA | 40S ribosomal protein S19 (RPS19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 883 Blast hits to 883 proteins in 288 species: Archae - 134; Bacteria - 5; Metazoa - 345; Fungi - 97; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT5G61865 | AT5G61865.1 | TATATGGGCCTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; Has 51 Blast hits to 51 proteins in 26 species: Archae - 3; Bacteria - 6; Metazoa - 23; Fungi - 3; Plants - 4; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G61970 | AT5G61970.1 | AGAGGCCCATATA | signal recognition particle-related / SRP-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 286 Blast hits to 286 proteins in 120 species: Archae - 2; Bacteria - 4; Metazoa - 134; Fungi - 62; Plants - 27; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  |
AT5G61970.1 | TAAATGGGCCTGG | signal recognition particle-related / SRP-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 286 Blast hits to 286 proteins in 120 species: Archae - 2; Bacteria - 4; Metazoa - 134; Fungi - 62; Plants - 27; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  | |
AT5G62070 | AT5G62070.1 | TCAGGCCCATTGACTTTAACCG | IQ-domain 23 (IQD23); FUNCTIONS IN: calmodulin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD24 (IQ-domain 24); calmodulin binding (TAIR:AT5G07240.1); Has 462 Blast hits to 452 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 4; Plants - 406; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT5G63080 | AT5G63080.1 | ATAATGGGCCTATAAATGGGCCGTA | transcription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT1G78280.1); Has 1321 Blast hits to 1316 proteins in 215 species: Archae - 0; Bacteria - 213; Metazoa - 766; Fungi - 131; Plants - 81; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).  |
AT5G63460 | AT5G63460.1 | TTAAGGCCCATATA | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
AT5G63460.1 | TTAAGGCCTAATAAGGCCCATAT | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  | |
AT5G63460.2 | TTAAGGCCCATATA | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  | |
AT5G63460.2 | TTAAGGCCTAATAAGGCCCATAT | SAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  | |
AT5G63520 | AT5G63520.1 | ATAATGGGCCTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FIST domain, N-terminal (InterPro:IPR013702); Has 96 Blast hits to 96 proteins in 46 species: Archae - 0; Bacteria - 72; Metazoa - 6; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G63840 | AT5G63840.1 | TTTGGGCTATGGGCCTT | radial swelling mutant shown to be specifically impaired in cellulose production. Encodes the alpha-subunit of a glucosidase II enzyme.  |
AT5G63890 | AT5G63890.1 | AAAGGCCCATTC | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  |
AT5G63890.1 | ATTAGGCCCATAA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  | |
AT5G63890.2 | AAAGGCCCATTC | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  | |
AT5G63890.2 | ATTAGGCCCATAA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  | |
AT5G64350 | AT5G64350.1 | ATAATGGGCCTAAA | FK506-BINDING PROTEIN (FKBP12); FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin-related / FKBP-type peptidyl-prolyl cis-trans isomerase-related (TAIR:AT4G25340.1); Has 5723 Blast hits to 5615 proteins in 1032 species: Archae - 25; Bacteria - 2709; Metazoa - 1179; Fungi - 351; Plants - 350; Viruses - 0; Other Eukaryotes - 1109 (source: NCBI BLink).  |
AT5G64680 | AT5G64680.1 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  |
AT5G64680.2 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  | |
AT5G64680.3 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  | |
AT5G65260 | AT5G65260.1 | AATTGGGCCTTATTAGGCCCATTAAG | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G10350.1); Has 5533 Blast hits to 5115 proteins in 414 species: Archae - 6; Bacteria - 543; Metazoa - 2461; Fungi - 1041; Plants - 837; Viruses - 0; Other Eukaryotes - 645 (source: NCBI BLink).  |
AT5G65270 | AT5G65270.1 | CTTAATGGGCCTAATAAGGCCCAATT | Arabidopsis Rab GTPase homolog A4a (AtRABA4a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RABA4B (RAB GTPASE HOMOLOG A4B); GTP binding (TAIR:AT4G39990.1); Has 23029 Blast hits to 22998 proteins in 639 species: Archae - 17; Bacteria - 108; Metazoa - 12691; Fungi - 2978; Plants - 2157; Viruses - 19; Other Eukaryotes - 5059 (source: NCBI BLink).  |
AT5G65400 | AT5G65400.1 | TTATGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24380.1); Has 479 Blast hits to 479 proteins in 121 species: Archae - 0; Bacteria - 2; Metazoa - 88; Fungi - 285; Plants - 66; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT5G65720 | AT5G65720.1 | TATAGGCCCATTAT | cysteine desulfurase whose activity is dependent on AtSufE activation.  |
AT5G65720.2 | TATAGGCCCATTAT | cysteine desulfurase whose activity is dependent on AtSufE activation.  | |
AT5G65910 | AT5G65910.1 | AGATGGGCCTTAG | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT3G49800.1); Has 402 Blast hits to 370 proteins in 82 species: Archae - 0; Bacteria - 12; Metazoa - 122; Fungi - 40; Plants - 133; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  |
AT5G65950 | AT5G65950.1 | AGTGGGCTTATAATGGGCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT5G66010 | AT5G66010.1 | TATATGGGCCTCA | RNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G20890.1); Has 2870 Blast hits to 1043 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 2605; Fungi - 10; Plants - 100; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT5G66030 | AT5G66030.1 | ATAATGGGCCTAAG | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization.  |
AT5G66030.2 | ATAATGGGCCTAAG | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization.  | |
AT5G66040 | AT5G66040.2 | CTTAGGCCCATTAT | SULFURTRANSFERASE PROTEIN 16 (STR16); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: SEN1 (SENESCENCE 1) (TAIR:AT4G35770.1); Has 2229 Blast hits to 2226 proteins in 583 species: Archae - 32; Bacteria - 1489; Metazoa - 53; Fungi - 31; Plants - 139; Viruses - 0; Other Eukaryotes - 485 (source: NCBI BLink).  |
AT5G66055 | AT5G66055.1 | GTAAGGCCCATTAG | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink).  |
AT5G66055.1 | TCAGGCCCATAT | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink).  | |
AT5G66055.1 | TGAGGCCCATTG | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink).  | |
AT5G66055.2 | GTAAGGCCCATTAG | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink).  | |
AT5G66055.2 | TCAGGCCCATAT | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink).  | |
AT5G66055.2 | TGAGGCCCATTG | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink).  | |
AT5G66060 | AT5G66060.1 | ATATGGGCCTGA | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae - 0; Bacteria - 195; Metazoa - 891; Fungi - 57; Plants - 219; Viruses - 14; Other Eukaryotes - 403 (source: NCBI BLink).  |
AT5G66060.1 | CAATGGGCCTCA | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae - 0; Bacteria - 195; Metazoa - 891; Fungi - 57; Plants - 219; Viruses - 14; Other Eukaryotes - 403 (source: NCBI BLink).  | |
AT5G66060.1 | CTAATGGGCCTTAC | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae - 0; Bacteria - 195; Metazoa - 891; Fungi - 57; Plants - 219; Viruses - 14; Other Eukaryotes - 403 (source: NCBI BLink).  | |
AT5G66140 | AT5G66140.1 | ATAAGGCCCATTTA | Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation.  |
AT5G66140.1 | TTAATGGGCCTGT | Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation.  | |
AT5G66190 | AT5G66190.1 | AGAGGCCCATCA | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane.  |
AT5G66190.2 | AGAGGCCCATCA | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane.  | |
AT5G66450 | AT5G66450.1 | CAATGGGCCTATT | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
AT5G66450.2 | CAATGGGCCTATT | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  | |
AT5G66590 | AT5G66590.1 | TTAATGGGCCTGA | allergen V5/Tpx-1-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: allergen V5/Tpx-1-related family protein (TAIR:AT5G57625.1); Has 1763 Blast hits to 1704 proteins in 235 species: Archae - 0; Bacteria - 47; Metazoa - 893; Fungi - 192; Plants - 589; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
AT5G66910 | AT5G66910.1 | CAATGGGCCTGA | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae - 22; Bacteria - 1182; Metazoa - 2936; Fungi - 103; Plants - 14487; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink).  |
AT5G67100 | AT5G67100.1 | GTAAGGCCCATTAAG | Encodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering.  |
AT5G67150 | AT5G67150.1 | ATAATGGGCCTAG | transferase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G50280.1); Has 1367 Blast hits to 1362 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 151; Plants - 1216; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G67320 | AT5G67320.1 | ATAGGCCCATTA | Encodes a WD-40 protein involved in histone deacetylation in response to abiotic stress.Identified in a screen for mutations with altered expression of stress induced genes. Functions as a repressor of cold tolerance induced genes. Loss of function mutants are hypersensitive to freezing.  |