| Locus | Gene model | Sequence | Description |
| AT1G01100 | AT1G01100.1 | AAGGCCCAATA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.2 | AAGGCCCAATA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.3 | AAGGCCCAATA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01100.4 | AAGGCCCAATA | 60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G01130 | AT1G01130.1 | GCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47170.1); Has 104 Blast hits to 104 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G01210 | AT1G01210.1 | TTTAGGCCCAATAA | DNA-directed RNA polymerase III family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15 kDa subunit (InterPro:IPR001529); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase III family protein (TAIR:AT4G07950.1); Has 790 Blast hits to 790 proteins in 227 species: Archae - 146; Bacteria - 0; Metazoa - 227; Fungi - 178; Plants - 60; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). |
| AT1G01630 | AT1G01630.1 | ATAAGGCCCAATA | SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink). |
| AT1G01630.1 | GAGCCCAATAG | SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink). |
| AT1G01970 | AT1G01970.1 | GAGGCCCAATAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: NFD5 (NUCLEAR FUSION DEFECTIVE 5) (TAIR:AT1G19520.1); Has 7256 Blast hits to 3017 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 83; Fungi - 5; Plants - 6997; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink). |
| AT1G02080 | AT1G02080.1 | AAGGCCCAATAA | transcriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink). |
| AT1G02130 | AT1G02130.1 | TTATTGGGCCTC | Belongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation. |
| AT1G02130.1 | TTATTGGGCCTT | Belongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation. |
| AT1G02140 | AT1G02140.1 | TGGCCCAATAT | MAGO NASHI (MAGO); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube guidance, sex determination; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mago nashi protein (InterPro:IPR004023); Has 348 Blast hits to 348 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 64; Plants - 47; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT1G02145 | AT1G02145.1 | ATATTGGGCCA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.2 | ATATTGGGCCA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.3 | ATATTGGGCCA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.4 | ATATTGGGCCA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02180 | AT1G02180.1 | CAAAGCCCAATAA | ferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02405 | AT1G02405.1 | TTGGCCCAATAAAGCCCAAAT | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G70990.1); Has 43114 Blast hits to 16780 proteins in 897 species: Archae - 84; Bacteria - 5479; Metazoa - 15161; Fungi - 3897; Plants - 10314; Viruses - 1979; Other Eukaryotes - 6200 (source: NCBI BLink). |
| AT1G02410 | AT1G02410.1 | ATTTGGGCTTTATTGGGCCAA | cytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink). |
| AT1G02690 | AT1G02690.1 | CTAAGCCCAATAT | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT1G02690.1 | GTTGGGCCGATATTGGGCTAA | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT1G02690.2 | CTAAGCCCAATAT | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT1G02690.2 | GTTGGGCCGATATTGGGCTAA | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT1G02780 | AT1G02780.1 | TTAAAGCCCAATAT | embryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink). |
| AT1G03310 | AT1G03310.1 | TTATTGGGCCTATGGGCTCGGCCCAGA | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
| AT1G03310.2 | TTATTGGGCCTATGGGCTCGGCCCAGA | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
| AT1G03630 | AT1G03630.1 | TTAAAGCCCATCTCAAGGCCCAATAA | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT1G03630.2 | TTAAAGCCCATCTCAAGGCCCAATAA | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT1G03680 | AT1G03680.1 | CGGCCCAATAG | encodes a chloroplast thioredoxin similar to prokaryotic thioredoxins. |
| AT1G03687 | AT1G03687.1 | CTATTGGGCCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G03687.1 | TTAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G03687.2 | CTATTGGGCCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G03687.2 | TTAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G04190 | AT1G04190.1 | TTATTGGGCTTTT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 15524 Blast hits to 9686 proteins in 698 species: Archae - 779; Bacteria - 4552; Metazoa - 3572; Fungi - 847; Plants - 951; Viruses - 0; Other Eukaryotes - 4823 (source: NCBI BLink). |
| AT1G04790 | AT1G04790.1 | TTAGCCCAATAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink). |
| AT1G04950 | AT1G04950.1 | CTTATTGGGCCTTGGCCCAAAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04950.2 | CTTATTGGGCCTTGGCCCAAAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04950.3 | CTTATTGGGCCTTGGCCCAAAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT1G04985 | AT1G04985.1 | TTATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G05940 | AT1G05940.1 | TTGGCCCAATAT | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT1G06190 | AT1G06190.1 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). |
| AT1G06190.2 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink). |
| AT1G07110 | AT1G07110.1 | ATAGGCCCAATAA | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. |
| AT1G07820 | AT1G07820.1 | GGGCCCAATA | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07820.1 | TTATTGGGCCA | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07820.2 | GGGCCCAATA | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07820.2 | TTATTGGGCCA | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT1G07830 | AT1G07830.1 | TATTGGGCCCTA | ribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G07830.1 | TGGCCCAATAA | ribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G07840 | AT1G07840.1 | CTTATTGGGCCCTA | leucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT1G07840.2 | CTTATTGGGCCCTA | leucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT1G07840.3 | CTTATTGGGCCCTA | leucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT1G07950 | AT1G07950.1 | TTTAGGCCCAATA | surfeit locus protein 5 family protein / SURF5 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Surfeit locus 5 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: surfeit locus protein 5 family protein / SURF5 family protein (TAIR:AT1G16430.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 139; Fungi - 8; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G07960 | AT1G07960.1 | TATTGGGCCTAAA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G07960.2 | TATTGGGCCTAAA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G07960.3 | TATTGGGCCTAAA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G08040 | AT1G08040.1 | AGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G08040.2 | AGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G08460 | AT1G08460.1 | CCAGGCCCAATAAG | HDA08; FUNCTIONS IN: histone deacetylase activity; INVOLVED IN: histone deacetylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylase superfamily (InterPro:IPR000286); BEST Arabidopsis thaliana protein match is: HDA15; histone deacetylase (TAIR:AT3G18520.2); Has 6845 Blast hits to 6725 proteins in 846 species: Archae - 124; Bacteria - 2006; Metazoa - 1106; Fungi - 418; Plants - 273; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink). |
| AT1G08700 | AT1G08700.1 | TTATTGGGCCTAATGGGCT | Encodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation. |
| AT1G08710 | AT1G08710.1 | AGCCCATTAGGCCCAATAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G08710.2 | AGCCCATTAGGCCCAATAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G09330 | AT1G09330.1 | TTATTGGGCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF846, eukaryotic (InterPro:IPR008564); Has 381 Blast hits to 381 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 100; Plants - 39; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). |
| AT1G09340 | AT1G09340.1 | TGGCCCAATAA | Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes. |
| AT1G09520 | AT1G09520.1 | TTATTGGGCCTTAC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G09660 | AT1G09660.1 | GAAGCCCAATAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G09660.2 | GAAGCCCAATAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G09830 | AT1G09830.1 | TATTGGGCCTTAT | glycinamide ribonucleotide synthetase (GAR synthetase) that catalyzes the conversion of phosphoribosyl amine to phosphoribosyl glycineamide |
| AT1G10280 | AT1G10280.1 | TGGGCCCTCCGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21310.1); Has 332 Blast hits to 332 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT1G12800 | AT1G12800.1 | CTATTGGGCCAATTTTAGGCCCATG | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink). |
| AT1G12810 | AT1G12810.1 | ATAGGCCCAATAG | proline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages. |
| AT1G12810.2 | ATAGGCCCAATAG | proline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages. |
| AT1G13060 | AT1G13060.1 | AGCCCAATAT | Encodes 20S proteasome beta subunit PBE1 (PBE1). |
| AT1G13690 | AT1G13690.1 | TTATTGGGCCAAT | AtE1 - stimulates the ATPase activity of DnaK/DnaJ |
| AT1G13690.1 | TTATTGGGCCGACCCG | AtE1 - stimulates the ATPase activity of DnaK/DnaJ |
| AT1G13900 | AT1G13900.1 | GTAAGGCCCATAATATTGGGCTTAGATAGGCCCATATA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G13910 | AT1G13910.1 | TATATGGGCCTATCTAAGCCCAATATTATGGGCCTTAC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink). |
| AT1G14140 | AT1G14140.1 | TTAAAGCCCAATAT | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink). |
| AT1G14770 | AT1G14770.1 | CCAGGCCCAATAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G14770.1 | TACGGCCCAATAT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G14770.2 | CCAGGCCCAATAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G14770.2 | TACGGCCCAATAT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G14990 | AT1G14990.1 | TTATTGGGCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15000 | AT1G15000.1 | TTCGGCCCAATAA | serine carboxypeptidase-like 50 (scpl50); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2538 Blast hits to 2426 proteins in 320 species: Archae - 0; Bacteria - 215; Metazoa - 624; Fungi - 565; Plants - 842; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink). |
| AT1G16430 | AT1G16430.1 | TTAAGGCCCAATAG | surfeit locus protein 5 family protein / SURF5 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Surfeit locus 5 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: surfeit locus protein 5 family protein / SURF5 family protein (TAIR:AT1G07950.1); Has 176 Blast hits to 176 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 4; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G16445 | AT1G16445.1 | ATAAAGCCCAATAT | methylase-related; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Putative rRNA methylase (InterPro:IPR010719); Has 531 Blast hits to 531 proteins in 250 species: Archae - 2; Bacteria - 482; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G16445.1 | CTATTGGGCCGAA | methylase-related; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Putative rRNA methylase (InterPro:IPR010719); Has 531 Blast hits to 531 proteins in 250 species: Archae - 2; Bacteria - 482; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G16810 | AT1G16810.1 | ATATTGGGCCCTATTGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT1G16810.2 | ATATTGGGCCCTATTGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT1G16920 | AT1G16920.1 | ACACGCGCCCAATAG | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
| AT1G16970 | AT1G16970.1 | GTGGCCCAATAA | Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. |
| AT1G16970.1 | TTGGCCCAATAA | Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. |
| AT1G17210 | AT1G17210.1 | CTATTGGGCTC | zinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). |
| AT1G17220 | AT1G17220.1 | GAGCCCAATAG | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. |
| AT1G17690 | AT1G17690.1 | ATATTGGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae - 70; Bacteria - 4843; Metazoa - 8327; Fungi - 2833; Plants - 863; Viruses - 487; Other Eukaryotes - 7064 (source: NCBI BLink). |
| AT1G18540 | AT1G18540.1 | TTAAAGCCCAATAT | 60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT1G19800 | AT1G19800.1 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. |
| AT1G19800.2 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. |
| AT1G19800.3 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. |
| AT1G20370 | AT1G20370.1 | ATTTGGGCTTAAAGGCCCAATAT | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G76120.1); Has 2413 Blast hits to 2196 proteins in 790 species: Archae - 88; Bacteria - 1223; Metazoa - 281; Fungi - 214; Plants - 87; Viruses - 0; Other Eukaryotes - 520 (source: NCBI BLink). |
| AT1G20430 | AT1G20430.1 | CTTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G20770 | AT1G20770.1 | GGGCTATTGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G21190 | AT1G21190.1 | ATATTGGGCCGAT | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G76860.1); Has 924 Blast hits to 924 proteins in 209 species: Archae - 244; Bacteria - 0; Metazoa - 275; Fungi - 141; Plants - 102; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT1G21200 | AT1G21200.1 | ATCGGCCCAATAT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76870.1); Has 251 Blast hits to 233 proteins in 48 species: Archae - 2; Bacteria - 24; Metazoa - 66; Fungi - 2; Plants - 75; Viruses - 9; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT1G21350 | AT1G21350.1 | ATATTGGGCT | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). |
| AT1G21350.2 | ATATTGGGCT | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). |
| AT1G21350.3 | ATATTGGGCT | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). |
| AT1G21580 | AT1G21580.1 | GTGGCCCAATAAG | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 5883 Blast hits to 3865 proteins in 351 species: Archae - 2; Bacteria - 340; Metazoa - 2117; Fungi - 809; Plants - 1304; Viruses - 149; Other Eukaryotes - 1162 (source: NCBI BLink). |
| AT1G21720 | AT1G21720.1 | GAAGCCCAATAA | 20S proteasome beta subunit PBC1 truncated protein (PBC1) |
| AT1G22450 | AT1G22450.1 | CTTATTGGGCCTAAA | subunit 6b of cytochrome c oxidase |
| AT1G22520 | AT1G22520.1 | ATAAGGCCCATTAATCGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). |
| AT1G22520.2 | ATAAGGCCCATTAATCGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). |
| AT1G23360 | AT1G23360.1 | CTTATTGGGCCTAAAATCGGCCCAATAT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). |
| AT1G23360.2 | CTTATTGGGCCTAAAATCGGCCCAATAT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). |
| AT1G23360.3 | CTTATTGGGCCTAAAATCGGCCCAATAT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). |
| AT1G24040 | AT1G24040.1 | TATATGGGCCATAAGGGCCCAATAA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G24040.2 | TATATGGGCCATAAGGGCCCAATAA | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G24050 | AT1G24050.1 | TTATTGGGCCCTTATGGCCCATATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT1G26300 | AT1G26300.1 | TTATTGGGCCCT | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G26300.2 | TTATTGGGCCCT | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT1G26370 | AT1G26370.1 | ATATTGGGCCAT | RNA helicase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 6916 Blast hits to 6404 proteins in 949 species: Archae - 2; Bacteria - 1916; Metazoa - 1973; Fungi - 797; Plants - 383; Viruses - 390; Other Eukaryotes - 1455 (source: NCBI BLink). |
| AT1G26540 | AT1G26540.1 | GTTGGGCTATTAGGCCCAATAAG | agenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395), Protein of unknown function DUF724 (InterPro:IPR007930); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT2G47230.1); Has 651 Blast hits to 562 proteins in 98 species: Archae - 0; Bacteria - 24; Metazoa - 210; Fungi - 27; Plants - 225; Viruses - 3; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT1G26550 | AT1G26550.1 | CTTATTGGGCCTAATAGCCCAAC | peptidyl-prolyl cis-trans isomerase PPIC-type family protein; FUNCTIONS IN: isomerase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, PpiC-type (InterPro:IPR000297); BEST Arabidopsis thaliana protein match is: PIN1AT (PEPTIDYLPROLYL CIS/TRANS ISOMERASE, NIMA-INTERACTING 1); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G18040.1); Has 4470 Blast hits to 4300 proteins in 976 species: Archae - 12; Bacteria - 3095; Metazoa - 206; Fungi - 127; Plants - 110; Viruses - 0; Other Eukaryotes - 920 (source: NCBI BLink). |
| AT1G26640 | AT1G26640.1 | GTTAGGCCCAATAA | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT1G26650 | AT1G26650.1 | TTATTGGGCCTAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G26940 | AT1G26940.1 | CATTGGGCCCAATA | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink). |
| AT1G27540 | AT1G27540.1 | GACGTCGTATATTGGGCCATA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27540.2 | GACGTCGTATATTGGGCCATA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G28090 | AT1G28090.1 | GGGCCCAATAA | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G28090.2 | GGGCCCAATAA | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G28090.3 | GGGCCCAATAA | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G28490 | AT1G28490.1 | CTTATTGGGCTC | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT1G28490.1 | CTTATTGGGCTTTAT | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT1G28490.2 | CTTATTGGGCTC | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT1G28490.2 | CTTATTGGGCTTTAT | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT1G29070 | AT1G29070.1 | TATTGGGCTTTTA | ribosomal protein L34 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271); Has 389 Blast hits to 389 proteins in 164 species: Archae - 0; Bacteria - 342; Metazoa - 0; Fungi - 9; Plants - 23; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT1G29150 | AT1G29150.1 | ATATTGGGCCTTTA | specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. |
| AT1G29220 | AT1G29220.1 | TTATTGGGCCTTTA | transcriptional regulator family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HCNGP-like (InterPro:IPR012479); Has 10343 Blast hits to 2896 proteins in 211 species: Archae - 2; Bacteria - 122; Metazoa - 7536; Fungi - 402; Plants - 244; Viruses - 187; Other Eukaryotes - 1850 (source: NCBI BLink). |
| AT1G29250 | AT1G29250.1 | CCCAATTGGGCCTATTGGGCT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT1G29260 | AT1G29260.1 | AGCCCAATAGGCCCAATTGGG | Encodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function. |
| AT1G29990 | AT1G29990.1 | ATATTGGGCCGTTAAA | Encodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins. |
| AT1G30110 | AT1G30110.1 | CCCGGCCCAATA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 25 (ATNUDX25); FUNCTIONS IN: bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: diadenosine tetraphosphate catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 4194 Blast hits to 4194 proteins in 805 species: Archae - 14; Bacteria - 2251; Metazoa - 23; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1859 (source: NCBI BLink). |
| AT1G31360 | AT1G31360.1 | TTAAGGCCCAATAT | Encodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro. |
| AT1G31360.2 | TTAAGGCCCAATAT | Encodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro. |
| AT1G31817 | AT1G31817.1 | AGCCCAATA | NUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink). |
| AT1G31817.1 | GAGCCCAATAAG | NUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink). |
| AT1G32730 | AT1G32730.1 | ATATTGGGCTTTAA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G33120 | AT1G33120.1 | AGCCCAATAT | 60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). |
| AT1G33410 | AT1G33410.1 | CTAGGCCCAATAA | suppressor of auxin resistance1 (SAR1); INVOLVED IN: response to auxin stimulus, mRNA export from nucleus, developmental process; LOCATED IN: nuclear membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 129 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 24; Plants - 26; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G33980 | AT1G33980.1 | TAAGCCCAATAACAAGCCCATTT | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) |
| AT1G33980.2 | TAAGCCCAATAACAAGCCCATTT | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) |
| AT1G34430 | AT1G34430.1 | AAAAAGCCCAATA | embryo defective 3003 (EMB3003); FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosolic ribosome, plasma membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: LTA2; dihydrolipoyllysine-residue acetyltransferase (TAIR:AT3G25860.1); Has 15590 Blast hits to 14171 proteins in 1332 species: Archae - 64; Bacteria - 7001; Metazoa - 632; Fungi - 308; Plants - 200; Viruses - 0; Other Eukaryotes - 7385 (source: NCBI BLink). |
| AT1G34430.1 | CTATTGGGCCTT | embryo defective 3003 (EMB3003); FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosolic ribosome, plasma membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: LTA2; dihydrolipoyllysine-residue acetyltransferase (TAIR:AT3G25860.1); Has 15590 Blast hits to 14171 proteins in 1332 species: Archae - 64; Bacteria - 7001; Metazoa - 632; Fungi - 308; Plants - 200; Viruses - 0; Other Eukaryotes - 7385 (source: NCBI BLink). |
| AT1G35340 | AT1G35340.1 | CTATTGGGCTTT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G35340.2 | CTATTGGGCTTT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G35340.3 | CTATTGGGCTTT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G35510 | AT1G35510.1 | AATAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01480.1); Has 438 Blast hits to 423 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 438; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G41880 | AT1G41880.1 | ATAAGCCCAATAG | 60S ribosomal protein L35a (RPL35aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aD) (TAIR:AT3G55750.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT1G45976 | AT1G45976.1 | AGGGCCCAATAG | s-ribonuclease binding protein 1 (SBP1); FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), S-ribonuclease binding protein, SBP1, pollen (InterPro:IPR017066); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G10650.2); Has 850 Blast hits to 850 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 475; Fungi - 4; Plants - 238; Viruses - 48; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT1G47640 | AT1G47640.1 | TACGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 147 Blast hits to 147 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G48430 | AT1G48430.1 | CCGGCCCAATAT | dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink). |
| AT1G48440 | AT1G48440.1 | ATATTGGGCCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G48650 | AT1G48650.1 | TTAGCCCAATAA | helicase domain-containing protein; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA binding (InterPro:IPR001159), Region of unknown function DUF1605 (InterPro:IPR011709), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding (TAIR:AT2G01130.1). |
| AT1G48650.2 | TTAGCCCAATAA | helicase domain-containing protein; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA binding (InterPro:IPR001159), Region of unknown function DUF1605 (InterPro:IPR011709), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding (TAIR:AT2G01130.1). |
| AT1G49760 | AT1G49760.1 | GCCCAATAA | polyadenylate-binding protein, putative / PABP, putative, similar to poly(A)-binding protein GB:AAF66825 GI:7673359 from (Nicotiana tabacum). Highly and ubiquitously expressed. Member of the class II PABP family. |
| AT1G49850 | AT1G49850.1 | ATAGGCCCAATAATTGGGCTTTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6256 Blast hits to 6238 proteins in 202 species: Archae - 0; Bacteria - 4; Metazoa - 2216; Fungi - 437; Plants - 2560; Viruses - 6; Other Eukaryotes - 1033 (source: NCBI BLink). |
| AT1G52340 | AT1G52340.1 | TTATTGGGCTTA | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT1G53140 | AT1G53140.1 | TGAGGCCCAATACGGCCCATTAA | Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis. |
| AT1G53670 | AT1G53670.1 | AAAAAGCCCAATAA | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G53670.2 | AAAAAGCCCAATAA | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G54050 | AT1G54050.1 | ATAAGGCCCAATAA | 17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink). |
| AT1G54050.1 | CAAGGCCCAATAA | 17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink). |
| AT1G54260 | AT1G54260.1 | TTTAGGCCCAATAA | histone H1/H5 family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Histone H1/H5 (InterPro:IPR005818); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / histone H1/H5 family protein (TAIR:AT1G72740.2); Has 265 Blast hits to 265 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 265; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G54310 | AT1G54310.1 | AAATGGGCCCAATAA | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PUA (InterPro:IPR002478); Has 3651 Blast hits to 3638 proteins in 946 species: Archae - 69; Bacteria - 3053; Metazoa - 33; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 462 (source: NCBI BLink). |
| AT1G54360 | AT1G54360.1 | ATAAGCCCAATAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT1G54360.2 | ATAAGCCCAATAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT1G54360.3 | ATAAGCCCAATAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT1G54360.4 | ATAAGCCCAATAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT1G54490 | AT1G54490.1 | CCGGCCCAATAAAGCCCATTTA | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. |
| AT1G55250 | AT1G55250.1 | TTATTGGGCTTTTT | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
| AT1G55250.1 | TTTAGGCCCAATA | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
| AT1G55265 | AT1G55265.1 | AATAGGCCCAATAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19860.1); Has 266 Blast hits to 266 proteins in 15 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 259; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT1G55490 | AT1G55490.1 | TAAAGGCCCAAATAGGCCCAATAT | encodes the beta subunit of the chloroplast chaperonin 60, a homologue of bacterial GroEL. Mutants in this gene develops lesions on its leaves, expresses systemic acquired resistance (SAR) and develops accelerated cell death to heat shock stress. The protein has molecular chaperone activity for suppressing protein aggregation in vitro. |
| AT1G55490.2 | TAAAGGCCCAAATAGGCCCAATAT | encodes the beta subunit of the chloroplast chaperonin 60, a homologue of bacterial GroEL. Mutants in this gene develops lesions on its leaves, expresses systemic acquired resistance (SAR) and develops accelerated cell death to heat shock stress. The protein has molecular chaperone activity for suppressing protein aggregation in vitro. |
| AT1G57540 | AT1G57540.1 | CTTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57540.2 | CTTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57540.3 | CTTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57860 | AT1G57860.1 | AAGGCCCAATAAG | 60S ribosomal protein L21; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21E) (TAIR:AT1G57660.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT1G58380 | AT1G58380.1 | AAAAGGCCCAATAT | XW6; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast, membrane; EXPRESSED IN: guard cell, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 7963 Blast hits to 7153 proteins in 1715 species: Archae - 183; Bacteria - 3057; Metazoa - 1443; Fungi - 466; Plants - 299; Viruses - 25; Other Eukaryotes - 2490 (source: NCBI BLink). |
| AT1G58440 | AT1G58440.1 | AGAGGCCCAATAA | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
| AT1G61570 | AT1G61570.1 | CAAGGCCCAATAT | Encodes a putative small zinc finger-like protein (TIM13); nucleus-encoded gene whose product is found in the mitochondrial inner membrane space. |
| AT1G63460 | AT1G63460.1 | GTGGCCCAATAGAAGCCCATTAAG | glutathione peroxidase, putative; FUNCTIONS IN: glutathione peroxidase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Glutathione peroxidase (InterPro:IPR000889); BEST Arabidopsis thaliana protein match is: ATGPX6 (GLUTATHIONE PEROXIDASE 6); glutathione peroxidase (TAIR:AT4G11600.1); Has 5286 Blast hits to 5285 proteins in 1007 species: Archae - 0; Bacteria - 1863; Metazoa - 687; Fungi - 136; Plants - 239; Viruses - 8; Other Eukaryotes - 2353 (source: NCBI BLink). |
| AT1G63970 | AT1G63970.1 | AAAGGCCCAATAA | Encodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF |
| AT1G63970.2 | AAAGGCCCAATAA | Encodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF |
| AT1G63980 | AT1G63980.1 | TTATTGGGCCTTT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink). |
| AT1G63980.2 | TTATTGGGCCTTT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink). |
| AT1G64350 | AT1G64350.1 | ACAGGCCCAATAT | seh1-like protein |
| AT1G64510 | AT1G64510.1 | AACGGGCCTTTAACAGGCCCAATAA | ribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: thylakoid, chloroplast thylakoid membrane, ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 978 Blast hits to 978 proteins in 282 species: Archae - 0; Bacteria - 578; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). |
| AT1G64520 | AT1G64520.1 | TTATTGGGCCTGTTAAAGGCCCGTT | Regulatory Particle non-ATPase 12a (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: RPN12b (Regulatory Particle Non-ATPase 12b); peptidase (TAIR:AT5G42040.1); Has 353 Blast hits to 353 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 84; Plants - 39; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT1G65820 | AT1G65820.1 | GTAGGCCCAATAT | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129). |
| AT1G65820.2 | GTAGGCCCAATAT | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129). |
| AT1G65820.3 | GTAGGCCCAATAT | microsomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129). |
| AT1G66820 | AT1G66820.1 | ATAAGCCCAATAA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 4695 Blast hits to 1095 proteins in 171 species: Archae - 18; Bacteria - 305; Metazoa - 2068; Fungi - 95; Plants - 1647; Viruses - 112; Other Eukaryotes - 450 (source: NCBI BLink). |
| AT1G66820.1 | TAAATGGGTTAAAGCCCAATAT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 4695 Blast hits to 1095 proteins in 171 species: Archae - 18; Bacteria - 305; Metazoa - 2068; Fungi - 95; Plants - 1647; Viruses - 112; Other Eukaryotes - 450 (source: NCBI BLink). |
| AT1G67760 | AT1G67760.1 | ATATTGGGCCATA | ATP binding / protein binding / unfolded protein binding; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), T-complex protein 1, epsilon subunit (InterPro:IPR012718); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 767 Blast hits to 665 proteins in 236 species: Archae - 251; Bacteria - 0; Metazoa - 166; Fungi - 119; Plants - 66; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink). |
| AT1G68790 | AT1G68790.1 | GAAGCCCAATAGGCCCAATAA | LITTLE NUCLEI3 (LINC3); INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LINC2 (LITTLE NUCLEI2) (TAIR:AT1G13220.2); Has 250284 Blast hits to 107694 proteins in 2507 species: Archae - 2115; Bacteria - 37052; Metazoa - 113182; Fungi - 17848; Plants - 9025; Viruses - 1093; Other Eukaryotes - 69969 (source: NCBI BLink). |
| AT1G70190 | AT1G70190.1 | TTATTGGGCTTTTA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G37660.1); Has 5742 Blast hits to 5742 proteins in 1557 species: Archae - 0; Bacteria - 3189; Metazoa - 133; Fungi - 84; Plants - 174; Viruses - 0; Other Eukaryotes - 2162 (source: NCBI BLink). |
| AT1G70570 | AT1G70570.1 | CTTATTGGGCCAA | anthranilate phosphoribosyltransferase, putative; FUNCTIONS IN: anthranilate phosphoribosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: tryptophan biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 3, N-terminal (InterPro:IPR017459), Glycosyl transferase, family 3 (InterPro:IPR000312); Has 991 Blast hits to 991 proteins in 393 species: Archae - 46; Bacteria - 770; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G70680 | AT1G70680.1 | TCAGGCCCAATAT | caleosin-related family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Caleosin related (InterPro:IPR007736); BEST Arabidopsis thaliana protein match is: caleosin-related family protein (TAIR:AT1G70670.1); Has 228 Blast hits to 223 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 44; Plants - 181; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G72170 | AT1G72170.1 | ATATTGGGCCTAAGTTAAGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22520.2); Has 60 Blast hits to 60 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G72710 | AT1G72710.1 | GCCCAATAT | Encodes a member of the casein kinase 1 protein family that is localized to the cytoplasm and nucleus. |
| AT1G73350 | AT1G73350.1 | TATTGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G73350.2 | TATTGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G73350.3 | TATTGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G73710 | AT1G73710.1 | TAAAGCCCAATAG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23020.1); Has 27768 Blast hits to 6414 proteins in 199 species: Archae - 2; Bacteria - 35; Metazoa - 962; Fungi - 509; Plants - 25092; Viruses - 0; Other Eukaryotes - 1168 (source: NCBI BLink). |
| AT1G73930 | AT1G73930.1 | TAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 216 Blast hits to 196 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 22; Plants - 20; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G73930.2 | TAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1630 (InterPro:IPR012860); Has 216 Blast hits to 196 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 22; Plants - 20; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G74260 | AT1G74260.1 | TTATTGGGCTTA | Encodes formylglycinamidine ribonucleotide synthase an enzyme involved in de novo purine biosynthesis. PUR4 is localizes to the chloroplast and mitochondria. Loss of PUR4 function affects male but not female gametophyte development. |
| AT1G74530 | AT1G74530.1 | CTAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G74530.2 | CTAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G74530.3 | CTAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G75120 | AT1G75120.1 | ATATTGGGC | REDUCED RESIDUAL ARABINOSE 1 (RRA1); LOCATED IN: endomembrane system, endoplasmic reticulum; EXPRESSED IN: meristem; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RRA2 (REDUCED RESIDUAL ARABINOSE 2) (TAIR:AT1G75110.1); Has 153 Blast hits to 151 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G75180 | AT1G75180.1 | TAAAAGCCCAATAAAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75180.2 | TAAAAGCCCAATAAAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75180.3 | TAAAAGCCCAATAAAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75330 | AT1G75330.1 | AAAAAGCCCAATAAG | ORNITHINE CARBAMOYLTRANSFERASE (OTC); FUNCTIONS IN: amino acid binding, ornithine carbamoyltransferase activity, carboxyl- or carbamoyltransferase activity; INVOLVED IN: amino acid metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (InterPro:IPR006132), Aspartate/ornithine carbamoyltransferase (InterPro:IPR006130), Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding region (InterPro:IPR006131), Ornithine carbamoyltransferase (InterPro:IPR002292); BEST Arabidopsis thaliana protein match is: aspartate carabmoyltransferase, chloroplast / aspartate transcarbamylase / ATCase (PYRB) (TAIR:AT3G20330.1); Has 11337 Blast hits to 11337 proteins in 1659 species: Archae - 346; Bacteria - 6031; Metazoa - 180; Fungi - 195; Plants - 66; Viruses - 6; Other Eukaryotes - 4513 (source: NCBI BLink). |
| AT1G75560 | AT1G75560.1 | TAAATGGGCTATTGGGCTTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G75560.2 | TAAATGGGCTATTGGGCTTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G75630 | AT1G75630.1 | CTAAGCCCAATAA | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, |
| AT1G75870 | AT1G75870.1 | TTATTGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76300 | AT1G76300.1 | CTAATGGGCCCAATAA | snRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT1G76320 | AT1G76320.1 | GTTAGGCCCAATAT | FAR1-related sequence 4 (FRS4); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FAR1 (FAR-RED IMPAIRED RESPONSE 1); transcription activator/ transcription factor (TAIR:AT4G15090.1); Has 879 Blast hits to 796 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 78; Plants - 800; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76320.1 | TACGGCCCAATAT | FAR1-related sequence 4 (FRS4); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FAR1 (FAR-RED IMPAIRED RESPONSE 1); transcription activator/ transcription factor (TAIR:AT4G15090.1); Has 879 Blast hits to 796 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 78; Plants - 800; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76320.2 | GTTAGGCCCAATAT | FAR1-related sequence 4 (FRS4); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FAR1 (FAR-RED IMPAIRED RESPONSE 1); transcription activator/ transcription factor (TAIR:AT4G15090.1); Has 879 Blast hits to 796 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 78; Plants - 800; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76320.2 | TACGGCCCAATAT | FAR1-related sequence 4 (FRS4); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FAR1 (FAR-RED IMPAIRED RESPONSE 1); transcription activator/ transcription factor (TAIR:AT4G15090.1); Has 879 Blast hits to 796 proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 78; Plants - 800; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G76730 | AT1G76730.1 | CTTATTGGGC | 5-formyltetrahydrofolate cyclo-ligase family protein; FUNCTIONS IN: catalytic activity, ATP binding, 5-formyltetrahydrofolate cyclo-ligase activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 5-formyltetrahydrofolate cyclo-ligase (InterPro:IPR002698); Has 270 Blast hits to 270 proteins in 109 species: Archae - 50; Bacteria - 73; Metazoa - 104; Fungi - 6; Plants - 17; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT1G76740 | AT1G76740.1 | GCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76840.1); Has 3136 Blast hits to 2432 proteins in 274 species: Archae - 9; Bacteria - 251; Metazoa - 1340; Fungi - 208; Plants - 114; Viruses - 8; Other Eukaryotes - 1206 (source: NCBI BLink). |
| AT1G77420 | AT1G77420.1 | TAAAAGCCCAATAA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink). |
| AT1G77420.1 | TAAAAGCCCAATAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink). |
| AT1G77440 | AT1G77440.1 | AAAGCCCAATAA | Encodes beta subunit of 20s proteosome complex which is involved in protein degradation. |
| AT1G77480 | AT1G77480.1 | ATATTGGGCCCT | nucellin protein, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: nucellin protein, putative (TAIR:AT1G44130.1); Has 1042 Blast hits to 1037 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 17; Plants - 945; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT1G77480.2 | ATATTGGGCCCT | nucellin protein, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: nucellin protein, putative (TAIR:AT1G44130.1); Has 1042 Blast hits to 1037 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 17; Plants - 945; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT1G77490 | AT1G77490.1 | AGGGCCCAATAT | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT1G77750 | AT1G77750.1 | AAAAAGCCCAATAA | 30S ribosomal protein S13, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: mitochondrion, small ribosomal subunit, chloroplast, mitochondrial small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast (CS13) (TAIR:AT5G14320.1); Has 5725 Blast hits to 5725 proteins in 1762 species: Archae - 116; Bacteria - 2963; Metazoa - 147; Fungi - 105; Plants - 348; Viruses - 0; Other Eukaryotes - 2046 (source: NCBI BLink). |
| AT1G78670 | AT1G78670.1 | CAAAGCCCAATAT | gamma-glutamyl hydrolase 3 (ATGGH3); FUNCTIONS IN: hydrolase activity, omega peptidase activity, catalytic activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C26, gamma-glutamyl hydrolase (InterPro:IPR015527), Peptidase C26 (InterPro:IPR011697); BEST Arabidopsis thaliana protein match is: gamma-glutamyl hydrolase, putative / gamma-Glu-X carboxypeptidase, putative / conjugase, putative (TAIR:AT1G78660.2); Has 274 Blast hits to 271 proteins in 59 species: Archae - 0; Bacteria - 0; Metazoa - 163; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT1G78900 | AT1G78900.1 | ATAAAGCCCAATAA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. |
| AT1G78900.1 | GGACCCACTTATTGGGCCGTA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. |
| AT1G78900.2 | ATAAAGCCCAATAA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. |
| AT1G78900.2 | GGACCCACTTATTGGGCCGTA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. |
| AT1G79260 | AT1G79260.1 | TTATTGGGCCTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1794 (InterPro:IPR014878); Has 445 Blast hits to 445 proteins in 114 species: Archae - 0; Bacteria - 250; Metazoa - 95; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink). |
| AT1G79830 | AT1G79830.1 | GGGCCCAATAT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT1G79830.2 | GGGCCCAATAT | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT1G80070 | AT1G80070.1 | CAAAGGCCCAATAA | a genetic locus involved in embryogenesis. Mutations in this locus result in an abnormal suspensor and embryo lethality. |
| AT1G80500 | AT1G80500.1 | CCCAATAGCCCAATAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20930.1); Has 437 Blast hits to 435 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 248; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT1G80750 | AT1G80750.1 | GTAAGGCCTTACATAAGCCCATAAATATTGGGCTTTTTTAGCCCAATAG | 60S ribosomal protein L7 (RPL7A); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7D) (TAIR:AT3G13580.3); Has 856 Blast hits to 856 proteins in 248 species: Archae - 76; Bacteria - 0; Metazoa - 354; Fungi - 146; Plants - 114; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink). |
| AT1G80770 | AT1G80770.1 | ATAGGCCCAATAT | pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink). |
| AT2G01110 | AT2G01110.1 | AAAAGGCCCAATAA | mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein. |
| AT2G01120 | AT2G01120.1 | TTATTGGGCCTTTT | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT2G01350 | AT2G01350.1 | GAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.1 | TAAAAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.2 | GAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.2 | TAAAAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.3 | GAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.3 | TAAAAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.4 | GAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.4 | TAAAAGCCCAATAG | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01720 | AT2G01720.1 | GAAGCCCAATAA | ribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 87; Plants - 31; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G03430 | AT2G03430.1 | AAAAGGCCCATAAACGGGCCCAATAT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink). |
| AT2G04030 | AT2G04030.1 | GTAGGCCCAATAAG | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G04030.2 | GTAGGCCCAATAAG | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G06520 | AT2G06520.1 | GCCCAATAG | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT2G06990 | AT2G06990.1 | TGAGCCCAATAG | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
| AT2G17350 | AT2G17350.1 | ACAGGCCCAATATAGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 93 Blast hits to 67 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 16; Fungi - 13; Plants - 21; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G17360 | AT2G17360.1 | CTTATTGGGCCTATATTGGGCCTGT | 40S ribosomal protein S4 (RPS4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT2G17670 | AT2G17670.1 | AAAAGCCCAATAGGCCCAATG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). |
| AT2G17670.1 | CAAGCCCAATAGGCCCAATG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). |
| AT2G17670.2 | AAAAGCCCAATAGGCCCAATG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). |
| AT2G17670.2 | CAAGCCCAATAGGCCCAATG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). |
| AT2G18710 | AT2G18710.1 | TATTGGGCCTAAAAGGCCTGGCCCATTAG | SecY Homolog 1 (SCY1); FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: EMB2289 (EMBRYO DEFECTIVE 2289); P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT2G31530.1); Has 6517 Blast hits to 6501 proteins in 1505 species: Archae - 48; Bacteria - 2805; Metazoa - 25; Fungi - 2; Plants - 53; Viruses - 0; Other Eukaryotes - 3584 (source: NCBI BLink). |
| AT2G19310 | AT2G19310.1 | AAAAGGCCTTTTCTATTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress, response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: HSP18.2 (heat shock protein 18.2) (TAIR:AT5G59720.1); Has 527 Blast hits to 527 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 34; Plants - 479; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT2G20300 | AT2G20300.1 | CCCGGCCCAATAAG | Encodes ABNORMAL LEAF SHAPE 2 (ALE2), a receptor-like protein kinase (RLK) with a cluster of basic amino acid residues followed by a cysteine-containing sequence in the putative extracellular domain. Function together with ACR4 (Arabidopsis homolog of the Crinkly4) and ALE1 in positively regulating protoderm-specific gene expression and for the formation of leafy organs. ale2 mutants have various epidermal defects, including disorganization of epidermis-related tissues, defects in the leaf cuticle and the fusion of organs. |
| AT2G20580 | AT2G20580.1 | TGAGCCCAATA | encoding the RPN subunits of the 26S proteasome |
| AT2G21150 | AT2G21150.1 | AAAAGCCCAATTATTGGGCCGAT | XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. Nuclear localized. |
| AT2G21250 | AT2G21250.1 | TTATTGGGCCTAAA | mannose 6-phosphate reductase (NADPH-dependent), putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: mannose 6-phosphate reductase (NADPH-dependent), putative (TAIR:AT2G21260.1); Has 13388 Blast hits to 13358 proteins in 1330 species: Archae - 187; Bacteria - 7678; Metazoa - 1798; Fungi - 1191; Plants - 907; Viruses - 0; Other Eukaryotes - 1627 (source: NCBI BLink). |
| AT2G21250.2 | TTATTGGGCCTAAA | mannose 6-phosphate reductase (NADPH-dependent), putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: mannose 6-phosphate reductase (NADPH-dependent), putative (TAIR:AT2G21260.1); Has 13388 Blast hits to 13358 proteins in 1330 species: Archae - 187; Bacteria - 7678; Metazoa - 1798; Fungi - 1191; Plants - 907; Viruses - 0; Other Eukaryotes - 1627 (source: NCBI BLink). |
| AT2G21280 | AT2G21280.1 | CAAAGCCCAATAAGGGCCTTTAA | A nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system. |
| AT2G21290 | AT2G21290.1 | TTAAAGGCCCTTATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G21410 | AT2G21410.1 | TTATTGGGCCATA | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. |
| AT2G22610 | AT2G22610.1 | GGGCCCAATAT | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT1G72250.1); Has 61125 Blast hits to 37324 proteins in 1305 species: Archae - 470; Bacteria - 4361; Metazoa - 29529; Fungi - 3969; Plants - 2072; Viruses - 206; Other Eukaryotes - 20518 (source: NCBI BLink). |
| AT2G23130 | AT2G23130.1 | ATATTGGGCCCAATG | AGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers. |
| AT2G23130.2 | ATATTGGGCCCAATG | AGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers. |
| AT2G23440 | AT2G23440.1 | ATATTGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G23780 | AT2G23780.1 | ATCGGCCCAATAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G19310.1); Has 2997 Blast hits to 2989 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 1936; Fungi - 317; Plants - 374; Viruses - 17; Other Eukaryotes - 353 (source: NCBI BLink). |
| AT2G23780.1 | TCAGGCCCAATAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G19310.1); Has 2997 Blast hits to 2989 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 1936; Fungi - 317; Plants - 374; Viruses - 17; Other Eukaryotes - 353 (source: NCBI BLink). |
| AT2G23930 | AT2G23930.1 | TTATTGGGCCTGA | PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G (SNRNP-G); FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative (TAIR:AT3G11500.1); Has 892 Blast hits to 892 proteins in 193 species: Archae - 86; Bacteria - 0; Metazoa - 373; Fungi - 185; Plants - 110; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT2G23930.1 | TTATTGGGCTTA | PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G (SNRNP-G); FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative (TAIR:AT3G11500.1); Has 892 Blast hits to 892 proteins in 193 species: Archae - 86; Bacteria - 0; Metazoa - 373; Fungi - 185; Plants - 110; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT2G23930.2 | TTATTGGGCCTGA | PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G (SNRNP-G); FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative (TAIR:AT3G11500.1); Has 892 Blast hits to 892 proteins in 193 species: Archae - 86; Bacteria - 0; Metazoa - 373; Fungi - 185; Plants - 110; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT2G23930.2 | TTATTGGGCTTA | PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G (SNRNP-G); FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative (TAIR:AT3G11500.1); Has 892 Blast hits to 892 proteins in 193 species: Archae - 86; Bacteria - 0; Metazoa - 373; Fungi - 185; Plants - 110; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). |
| AT2G25350 | AT2G25350.1 | TATTGGGCTATT | phox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT4G32160.1); Has 19818 Blast hits to 12588 proteins in 761 species: Archae - 181; Bacteria - 1370; Metazoa - 11138; Fungi - 1442; Plants - 628; Viruses - 164; Other Eukaryotes - 4895 (source: NCBI BLink). |
| AT2G25610 | AT2G25610.1 | CAAGGCCCAATAG | H+-transporting two-sector ATPase, C subunit family protein; FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: vacuolar ATP synthase, putative / V-ATPase, putative (TAIR:AT4G32530.1); Has 1596 Blast hits to 1304 proteins in 284 species: Archae - 70; Bacteria - 89; Metazoa - 650; Fungi - 323; Plants - 223; Viruses - 0; Other Eukaryotes - 241 (source: NCBI BLink). |
| AT2G25720 | AT2G25720.1 | TTTAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G25890 | AT2G25890.1 | AATAGCCCAATAAG | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: leaf whorl, petal, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO1 (OLEOSIN 1) (TAIR:AT4G25140.1); Has 402 Blast hits to 402 proteins in 48 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 398; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G26430 | AT2G26430.1 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26430.2 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26430.3 | CTAAGCCCAATAAGGGCCTAG | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26780 | AT2G26780.1 | AGAGGCCCAATAT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 325 Blast hits to 275 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 149; Fungi - 125; Plants - 34; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT2G27030 | AT2G27030.1 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G27030.2 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G27030.3 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G28000 | AT2G28000.1 | TTATTGGGCCATA | Encodes chaperonin-60 alpha, a molecular chaperone involved in Rubisco folding. Mutants display aberrant chloroplast and embryo development. |
| AT2G29180 | AT2G29180.1 | ATATTGGGCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 21 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G29400 | AT2G29400.1 | TAGCCCATTTACAGGCCCAATAA | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
| AT2G29510 | AT2G29510.1 | CTATTGGGCCCATCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59020.1); Has 3816 Blast hits to 613 proteins in 107 species: Archae - 0; Bacteria - 39; Metazoa - 471; Fungi - 67; Plants - 91; Viruses - 10; Other Eukaryotes - 3138 (source: NCBI BLink). |
| AT2G29560 | AT2G29560.1 | CTTATTGGGCCTAAAATGGGCTTTTA | enolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: glycolysis; LOCATED IN: phosphopyruvate hydratase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9375 Blast hits to 9353 proteins in 2216 species: Archae - 179; Bacteria - 3114; Metazoa - 1311; Fungi - 220; Plants - 152; Viruses - 0; Other Eukaryotes - 4399 (source: NCBI BLink). |
| AT2G31190 | AT2G31190.1 | ATATTGGGCCTTAA | LOCATED IN: mitochondrion, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: emb1879 (embryo defective 1879) (TAIR:AT5G49820.1); Has 274 Blast hits to 274 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 96; Fungi - 41; Plants - 94; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT2G31200 | AT2G31200.1 | TTAAGGCCCAATAT | Encodes actin depolymerizing factor 6 (ADF6). |
| AT2G32600 | AT2G32600.1 | TGATGGGCTGATATTGGGCCTTAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, intracellular, spliceosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 17385 Blast hits to 7765 proteins in 482 species: Archae - 26; Bacteria - 1475; Metazoa - 7274; Fungi - 1847; Plants - 3510; Viruses - 897; Other Eukaryotes - 2356 (source: NCBI BLink). |
| AT2G32890 | AT2G32890.1 | CTATTGGGCCTAT | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. This gene is contained within a highly AT-rich repetitive sequence region. |
| AT2G32900 | AT2G32900.1 | ATAGGCCCAATAG | homologous to Drosophila ZW10, a centromere/kinetochore protein involved in chromosome segregation |
| AT2G34630 | AT2G34630.2 | TTATTGGGCTTA | Encodes a geranyl diphosphate synthase. RNAi lines are dwarf. T-DNA knock-out lines are embryo lethal. |
| AT2G35720 | AT2G35720.1 | GCCCAATAAG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT3G47940.1); Has 15787 Blast hits to 15749 proteins in 1885 species: Archae - 105; Bacteria - 5397; Metazoa - 3297; Fungi - 1386; Plants - 1147; Viruses - 13; Other Eukaryotes - 4442 (source: NCBI BLink). |
| AT2G36990 | AT2G36990.1 | ATTTGGGCTTTTAAGCCCAATATAAGGCCCAACA | Encodes a general sigma factor in chloroplasts and is probably responsible for the recognition of sigma 70 type standard bacteria-type multi-subunit RNA polymerase (PEP) promoters in young cotyledons. |
| AT2G37120 | AT2G37120.1 | CTTATTGGGCTTC | DNA-binding S1FA family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA binding protein S1FA (InterPro:IPR006779); Has 54 Blast hits to 54 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G37270 | AT2G37270.1 | AAAAGCCCAACATAAGCCCAATAA | One of two genes encoding the ribosomal protein S5. Expressed at a lower level compared to ATRPS5A. |
| AT2G37270.2 | AAAAGCCCAACATAAGCCCAATAA | One of two genes encoding the ribosomal protein S5. Expressed at a lower level compared to ATRPS5A. |
| AT2G37600 | AT2G37600.1 | ATATTGGGCCAT | 60S ribosomal protein L36 (RPL36A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 94; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT2G37600.2 | ATATTGGGCCAT | 60S ribosomal protein L36 (RPL36A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 94; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT2G38560 | AT2G38560.1 | TTGGCCCAATAAGGGCCTGG | Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. |
| AT2G40020 | AT2G40020.1 | CTATTGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink). |
| AT2G40020.2 | CTATTGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink). |
| AT2G40020.3 | CTATTGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink). |
| AT2G40090 | AT2G40090.1 | CAAGCCCAATAAGTAAGGCCCACA | member of ATH subfamily |
| AT2G40380 | AT2G40380.1 | ATATTGGGCCTATT | PRENYLATED RAB ACCEPTOR 1.B2 (PRA1.B2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 382 Blast hits to 382 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 64; Plants - 187; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT2G40380.1 | ATATTGGGCCTCT | PRENYLATED RAB ACCEPTOR 1.B2 (PRA1.B2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 382 Blast hits to 382 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 64; Plants - 187; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink). |
| AT2G40590 | AT2G40590.1 | TTAAGGCCCAATAAG | 40S ribosomal protein S26 (RPS26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26A) (TAIR:AT2G40510.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT2G41060 | AT2G41060.1 | CAAGGCCCAATAG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UBP1 interacting protein 2a (UBA2a) (TAIR:AT3G56860.3); Has 17419 Blast hits to 11431 proteins in 532 species: Archae - 0; Bacteria - 698; Metazoa - 10129; Fungi - 1624; Plants - 2756; Viruses - 123; Other Eukaryotes - 2089 (source: NCBI BLink). |
| AT2G41060.2 | CAAGGCCCAATAG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UBP1 interacting protein 2a (UBA2a) (TAIR:AT3G56860.3); Has 17419 Blast hits to 11431 proteins in 532 species: Archae - 0; Bacteria - 698; Metazoa - 10129; Fungi - 1624; Plants - 2756; Viruses - 123; Other Eukaryotes - 2089 (source: NCBI BLink). |
| AT2G41680 | AT2G41680.1 | ATGGCCCAATAT | Encodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage. |
| AT2G42300 | AT2G42300.1 | ATAAAGCCCAATAGGCCCAATT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G42300.2 | ATAAAGCCCAATAGGCCCAATT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G42390 | AT2G42390.1 | CAAAGCCCAATAT | protein kinase C substrate, heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT5G56360.1); Has 464 Blast hits to 443 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 290; Fungi - 79; Plants - 29; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). |
| AT2G42560 | AT2G42560.1 | ATATTGGGCCTAAT | late embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein (InterPro:IPR004238); BEST Arabidopsis thaliana protein match is: ATECP63 (EMBRYONIC CELL PROTEIN 63) (TAIR:AT2G36640.1); Has 12374 Blast hits to 7501 proteins in 1066 species: Archae - 63; Bacteria - 4676; Metazoa - 2087; Fungi - 744; Plants - 1442; Viruses - 129; Other Eukaryotes - 3233 (source: NCBI BLink). |
| AT2G44065 | AT2G44065.1 | TATTGGGCTTG | ribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink). |
| AT2G44065.2 | TATTGGGCTTG | ribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink). |
| AT2G44180 | AT2G44180.1 | ATATTGGGCCCAATAAG | Encodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci. |
| AT2G44310 | AT2G44310.1 | CAAAGGCCCAATAA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G54530.1); Has 158 Blast hits to 153 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT2G44310.1 | TCTGACGGGCCCAATAT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G54530.1); Has 158 Blast hits to 153 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT2G44520 | AT2G44520.1 | ATATTGGGCCTTAA | cytochrome c oxidase 10 (COX10); FUNCTIONS IN: protoheme IX farnesyltransferase activity, prenyltransferase activity; INVOLVED IN: heme biosynthetic process; LOCATED IN: integral to membrane, mitochondrial membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protohaem IX farnesyltransferase, mitochondria (InterPro:IPR016315), Protohaem IX farnesyltransferase (InterPro:IPR006369), UbiA prenyltransferase (InterPro:IPR000537); Has 6172 Blast hits to 6172 proteins in 1140 species: Archae - 109; Bacteria - 2789; Metazoa - 160; Fungi - 121; Plants - 40; Viruses - 0; Other Eukaryotes - 2953 (source: NCBI BLink). |
| AT2G45000 | AT2G45000.1 | TTATTGGGCTGGGCCGA | EMBRYO DEFECTIVE 2766 (EMB2766); FUNCTIONS IN: structural constituent of nuclear pore; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, nuclear pore; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nsp1-like, C-terminal (InterPro:IPR007758); Has 196388 Blast hits to 74057 proteins in 2349 species: Archae - 657; Bacteria - 41194; Metazoa - 62656; Fungi - 37422; Plants - 6443; Viruses - 2462; Other Eukaryotes - 45554 (source: NCBI BLink). |
| AT2G45200 | AT2G45200.1 | ATAAGCCCAATAT | Encodes a member of the GOS1 (Golgi SNARE) gene family. |
| AT2G45200.1 | TGAGCCCAATAA | Encodes a member of the GOS1 (Golgi SNARE) gene family. |
| AT2G45200.1 | TGAGCCCAATAA | Encodes a member of the GOS1 (Golgi SNARE) gene family. |
| AT2G45200.1 | TGAGCCCAATAT | Encodes a member of the GOS1 (Golgi SNARE) gene family. |
| AT2G45530 | AT2G45530.1 | CTTAGGCCCAATAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G37950.1); Has 621 Blast hits to 621 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 262; Fungi - 5; Plants - 312; Viruses - 3; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT2G45710 | AT2G45710.1 | TTAGCCCAATAG | 40S ribosomal protein S27 (RPS27A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, nucleolus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein S27e (InterPro:IPR000592); BEST Arabidopsis thaliana protein match is: ARS27A (ARABIDOPSIS RIBOSOMAL PROTEIN S27); structural constituent of ribosome (TAIR:AT3G61110.1); Has 690 Blast hits to 690 proteins in 269 species: Archae - 76; Bacteria - 0; Metazoa - 297; Fungi - 98; Plants - 99; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). |
| AT2G45730 | AT2G45730.1 | TTAAAGCCCAATAA | eukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT2G46230 | AT2G46230.1 | TTATTGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT2G46230.2 | TTATTGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT2G46490 | AT2G46490.1 | CTTATTGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35110.1); Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46735 | AT2G46735.1 | AAAAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G47380 | AT2G47380.1 | TTAGCCCAATAG | cytochrome c oxidase subunit Vc family protein / COX5C family protein; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase subunit Vc (InterPro:IPR008432); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit Vc, putative / COX5C, putative (TAIR:AT5G61310.4); Has 60 Blast hits to 60 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G47580 | AT2G47580.1 | ATATTGGGCTAA | encodes spliceosomal protein U1A |
| AT3G01130 | AT3G01130.1 | TAAAGGCCCATATAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G01130.2 | TAAAGGCCCATATAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G01320 | AT3G01320.1 | AAAAAGCCCAATAG | Encodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT3G01340 | AT3G01340.1 | AAGGCCCAATA | protein transport protein SEC13 family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: intracellular protein transport, membrane budding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G30050.1); Has 16199 Blast hits to 10279 proteins in 408 species: Archae - 22; Bacteria - 3034; Metazoa - 6785; Fungi - 3044; Plants - 1251; Viruses - 0; Other Eukaryotes - 2063 (source: NCBI BLink). |
| AT3G01340.2 | AAGGCCCAATA | protein transport protein SEC13 family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: intracellular protein transport, membrane budding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G30050.1); Has 16199 Blast hits to 10279 proteins in 408 species: Archae - 22; Bacteria - 3034; Metazoa - 6785; Fungi - 3044; Plants - 1251; Viruses - 0; Other Eukaryotes - 2063 (source: NCBI BLink). |
| AT3G01345 | AT3G01345.1 | TATTGGGCCTT | Expressed protein; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G28919.1); Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G01370 | AT3G01370.1 | AGCCCAATAA | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
| AT3G01410 | AT3G01410.1 | CTATTGGGCTTTTT | RNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink). |
| AT3G01410.2 | CTATTGGGCTTTTT | RNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink). |
| AT3G01740 | AT3G01740.1 | ATATTGGGCTC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37, mitochondrial (InterPro:IPR013870); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14290.1); Has 117 Blast hits to 117 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 22; Plants - 27; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G02450 | AT3G02450.1 | AGCCCAATAG | cell division protein ftsH, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase M41, FtsH extracellular (InterPro:IPR011546); BEST Arabidopsis thaliana protein match is: FTSH6 (FTSH PROTEASE 6); ATP-dependent peptidase/ ATPase/ metallopeptidase/ peptidase/ zinc ion binding (TAIR:AT5G15250.1); Has 29914 Blast hits to 28201 proteins in 1898 species: Archae - 923; Bacteria - 10733; Metazoa - 4167; Fungi - 2480; Plants - 1767; Viruses - 20; Other Eukaryotes - 9824 (source: NCBI BLink). |
| AT3G03840 | AT3G03840.1 | AGCCCAATAT | auxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT3G03820.1); Has 578 Blast hits to 575 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 577; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G03920 | AT3G03920.1 | ATATTGGGCTAA | Gar1 RNA-binding region family protein; FUNCTIONS IN: RNA binding, rRNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast thylakoid membrane, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gar1 protein RNA-binding region (InterPro:IPR007504); BEST Arabidopsis thaliana protein match is: Gar1 RNA-binding region family protein (TAIR:AT5G18180.1); Has 26246 Blast hits to 8264 proteins in 726 species: Archae - 15; Bacteria - 4613; Metazoa - 10704; Fungi - 2027; Plants - 5901; Viruses - 362; Other Eukaryotes - 2624 (source: NCBI BLink). |
| AT3G04040 | AT3G04040.1 | ATATTGGGCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1); Has 32 Blast hits to 32 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G04400 | AT3G04400.1 | ATATTGGGCCTAAG | embryo defective 2171 (emb2171); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14b/L23e (InterPro:IPR000218); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L23 (RPL23B) (TAIR:AT2G33370.1); Has 6297 Blast hits to 6297 proteins in 1833 species: Archae - 236; Bacteria - 2977; Metazoa - 280; Fungi - 176; Plants - 586; Viruses - 0; Other Eukaryotes - 2042 (source: NCBI BLink). |
| AT3G04400.1 | TTATTGGGCTTAT | embryo defective 2171 (emb2171); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14b/L23e (InterPro:IPR000218); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L23 (RPL23B) (TAIR:AT2G33370.1); Has 6297 Blast hits to 6297 proteins in 1833 species: Archae - 236; Bacteria - 2977; Metazoa - 280; Fungi - 176; Plants - 586; Viruses - 0; Other Eukaryotes - 2042 (source: NCBI BLink). |
| AT3G04500 | AT3G04500.1 | CTATTGGGCCTCAGCCCAATAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition motif-related (InterPro:IPR015464); BEST Arabidopsis thaliana protein match is: UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding (TAIR:AT1G17370.2); Has 10169 Blast hits to 8298 proteins in 506 species: Archae - 0; Bacteria - 623; Metazoa - 5880; Fungi - 1176; Plants - 1670; Viruses - 0; Other Eukaryotes - 820 (source: NCBI BLink). |
| AT3G05280 | AT3G05280.1 | ATATTGGGCTCA | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 381 Blast hits to 380 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 69; Plants - 47; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT3G06030 | AT3G06030.1 | AAAAAGCCCAATAAGAAGGCCCATTAAG | NPK1-related protein kinase 3 |
| AT3G06040 | AT3G06040.1 | CTTATTGGGCTTGGCCCATA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). |
| AT3G06040.2 | CTTATTGGGCTTGGCCCATA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). |
| AT3G06040.3 | CTTATTGGGCTTGGCCCATA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G36420.1); Has 5695 Blast hits to 5695 proteins in 1555 species: Archae - 0; Bacteria - 3184; Metazoa - 132; Fungi - 84; Plants - 176; Viruses - 0; Other Eukaryotes - 2119 (source: NCBI BLink). |
| AT3G06310 | AT3G06310.1 | TGAGCCCAATATCAGCCCA | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06310.2 | TGAGCCCAATATCAGCCCA | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06320 | AT3G06320.1 | TGGGCTGATATTGGGCTCA | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT3G06610 | AT3G06610.1 | CAAGGCCCAATAT | DNA-binding enhancer protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 98; Fungi - 15; Plants - 20; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G07110 | AT3G07110.1 | ACGGCCCAATAA | 60S ribosomal protein L13A (RPL13aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1890 Blast hits to 1890 proteins in 584 species: Archae - 212; Bacteria - 573; Metazoa - 292; Fungi - 125; Plants - 164; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink). |
| AT3G07110.2 | ACGGCCCAATAA | 60S ribosomal protein L13A (RPL13aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1890 Blast hits to 1890 proteins in 584 species: Archae - 212; Bacteria - 573; Metazoa - 292; Fungi - 125; Plants - 164; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink). |
| AT3G07400 | AT3G07400.1 | ATTTGGGCCTAAAGCCCAATAG | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); Has 274 Blast hits to 273 proteins in 48 species: Archae - 0; Bacteria - 6; Metazoa - 26; Fungi - 34; Plants - 176; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G07440 | AT3G07440.1 | TTATTGGGCCGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48530.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G07590 | AT3G07590.1 | TTTTGGGCCCAATAT | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). |
| AT3G07630 | AT3G07630.1 | TAGGGCTTTTATTGGGCCCAGT | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G07630.2 | TAGGGCTTTTATTGGGCCCAGT | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G08510 | AT3G08510.1 | AAAAGCCCAATAA | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08510.2 | AAAAGCCCAATAA | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08510.3 | AAAAGCCCAATAA | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08520 | AT3G08520.1 | TTATTGGGCTTTT | 60S ribosomal protein L41 (RPL41D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G08610 | AT3G08610.1 | TATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G08960 | AT3G08960.1 | TATAGGCCCAATAA | binding / protein transporter; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT1G26170.1); Has 1034 Blast hits to 933 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 468; Fungi - 402; Plants - 81; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT3G09350 | AT3G09350.1 | TAAGCCCAATAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G09350.2 | TAAGCCCAATAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G09350.3 | TAAGCCCAATAA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G09630 | AT3G09630.1 | ATATTGGGCCCT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.1 | TTATTGGGCTTTAT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.2 | ATATTGGGCCCT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G09630.2 | TTATTGGGCTTTAT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). |
| AT3G10530 | AT3G10530.1 | TCAGGCCCAATAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BING4, C-terminal (InterPro:IPR012952), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.3); Has 6810 Blast hits to 4312 proteins in 298 species: Archae - 16; Bacteria - 2174; Metazoa - 1948; Fungi - 1292; Plants - 310; Viruses - 0; Other Eukaryotes - 1070 (source: NCBI BLink). |
| AT3G10540 | AT3G10540.1 | TATGGCCCAATAG | 3-phosphoinositide-dependent protein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein Kinase-1, 3-phosphoinositide dependent (InterPro:IPR015746), Protein kinase, core (InterPro:IPR000719), Pleckstrin homology-type (InterPro:IPR011993); BEST Arabidopsis thaliana protein match is: PDK1 (3'-PHOSPHOINOSITIDE-DEPENDENT PROTEIN KINASE 1); 3-phosphoinositide-dependent protein kinase/ kinase/ phosphoinositide binding / protein binding / protein kinase (TAIR:AT5G04510.1); Has 93608 Blast hits to 92119 proteins in 3282 species: Archae - 79; Bacteria - 8637; Metazoa - 40327; Fungi - 8699; Plants - 17250; Viruses - 597; Other Eukaryotes - 18019 (source: NCBI BLink). |
| AT3G10572 | AT3G10572.1 | GAAGCCCATTATATTGGCCCAATAG | 3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G10730 | AT3G10730.1 | TTATTGGGCTTTTAAAAGCCCATCA | sad1/unc-84-like 2 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope, endoplasmic reticulum, spindle, phragmoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919); BEST Arabidopsis thaliana protein match is: sad1/unc-84 protein-related (TAIR:AT5G04990.1); Has 419 Blast hits to 416 proteins in 105 species: Archae - 4; Bacteria - 31; Metazoa - 294; Fungi - 27; Plants - 31; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G10940 | AT3G10940.1 | AAAAAGCCCAATAA | protein phosphatase-related; FUNCTIONS IN: phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: SEX4 (STARCH-EXCESS 4); polysaccharide binding / protein tyrosine/serine/threonine phosphatase (TAIR:AT3G52180.2); Has 743 Blast hits to 742 proteins in 92 species: Archae - 5; Bacteria - 8; Metazoa - 545; Fungi - 12; Plants - 77; Viruses - 11; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT3G11120 | AT3G11120.1 | ATCGGCCCAATAT | 60S ribosomal protein L41 (RPL41E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G11120.1 | TATGGGCTTTATTGGGC | 60S ribosomal protein L41 (RPL41E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G11745 | AT3G11745.1 | TATGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G12600 | AT3G12600.1 | GAATGGGCCCAATAAG | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT3G12600.2 | GAATGGGCCCAATAAG | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT3G12950 | AT3G12950.1 | ATATTGGGCCTAAA | catalytic; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase, trypsin-like serine and cysteine (InterPro:IPR009003); BEST Arabidopsis thaliana protein match is: catalytic (TAIR:AT5G45030.2); Has 63 Blast hits to 63 proteins in 19 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 2; Plants - 41; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G13275 | AT3G13275.1 | TTAATGGGCCTTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 13 Blast hits to 13 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13300 | AT3G13300.1 | TAGGGCCCAATAA | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT3G13300.2 | TAGGGCCCAATAA | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT3G13700 | AT3G13700.1 | CTTATTGGGCCAT | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G13700.1 | TTAAGGCCCAATAG | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G13700.2 | CTTATTGGGCCAT | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G13700.2 | TTAAGGCCCAATAG | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G13930 | AT3G13930.1 | TAGGGCCCAATAT | dihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae - 43; Bacteria - 6315; Metazoa - 646; Fungi - 315; Plants - 198; Viruses - 0; Other Eukaryotes - 7611 (source: NCBI BLink). |
| AT3G14430 | AT3G14430.1 | CTTATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15040 | AT3G15040.1 | CTATTGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 2804 Blast hits to 412 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 419; Fungi - 51; Plants - 212; Viruses - 0; Other Eukaryotes - 2100 (source: NCBI BLink). |
| AT3G15220 | AT3G15220.1 | CTTATTGGGCTTTTA | protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: spindle, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATMAP4K ALPHA1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G53165.2); Has 97460 Blast hits to 95819 proteins in 3033 species: Archae - 88; Bacteria - 8614; Metazoa - 42541; Fungi - 8570; Plants - 18723; Viruses - 614; Other Eukaryotes - 18310 (source: NCBI BLink). |
| AT3G15280 | AT3G15280.1 | AACGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15290 | AT3G15290.1 | TTATTGGGCCGTT | 3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink). |
| AT3G16740 | AT3G16740.1 | CTATTGGGCCTAAT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G18780.1); Has 799 Blast hits to 770 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 797; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G17300 | AT3G17300.1 | CTTATTGGGCCGTT | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G17300.2 | CTTATTGGGCCGTT | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G17626 | AT3G17626.1 | TTATGGGCTTTATTATTGGGCTTTTAGCCCAACT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: ribosomal protein L18 family protein (TAIR:AT1G48350.1); Has 336 Blast hits to 336 proteins in 121 species: Archae - 0; Bacteria - 241; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G18165 | AT3G18165.1 | TAGGGCCCTAGAAGCCCAAGGCCCAATAAAACCGGGTCGG | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT3G18940 | AT3G18940.1 | TTATTGGGCTTTAATATGGCCCATAT | clast3-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP010044 (InterPro:IPR016562); Has 170 Blast hits to 170 proteins in 73 species: Archae - 1; Bacteria - 0; Metazoa - 98; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G20050 | AT3G20050.1 | TTCGGCCCAATAT | Encodes a putative cytoplasmic chaperonin that is similar to mouse Tcp-1 (t complex polypeptide 1). |
| AT3G20910 | AT3G20910.1 | CTATTGGGCCTTTA | NUCLEAR FACTOR Y, SUBUNIT A9 (NF-YA9); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); BEST Arabidopsis thaliana protein match is: NF-YA1 (NUCLEAR FACTOR Y, SUBUNIT A1); transcription factor (TAIR:AT5G12840.4); Has 452 Blast hits to 452 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 97; Plants - 214; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT3G24440 | AT3G24440.1 | AATAGGCCCAATAT | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
| AT3G24490 | AT3G24490.1 | TGGCCCAATAT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 2488 Blast hits to 1665 proteins in 165 species: Archae - 0; Bacteria - 71; Metazoa - 1163; Fungi - 123; Plants - 222; Viruses - 36; Other Eukaryotes - 873 (source: NCBI BLink). |
| AT3G24515 | AT3G24515.1 | ATATTGGGCCAA | ubiquitin-conjugating enzyme 37 (UBC37); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC11 (UBIQUITIN-CONJUGATING ENZYME 11); ubiquitin-protein ligase (TAIR:AT3G08690.1); Has 7488 Blast hits to 7480 proteins in 304 species: Archae - 0; Bacteria - 0; Metazoa - 3738; Fungi - 1409; Plants - 1069; Viruses - 22; Other Eukaryotes - 1250 (source: NCBI BLink). |
| AT3G24820 | AT3G24820.1 | TTATTGGGCCTTTT | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 97 Blast hits to 97 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G24830 | AT3G24830.1 | AAAAGGCCCAATAA | 60S ribosomal protein L13A (RPL13aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aA) (TAIR:AT3G07110.1); Has 1473 Blast hits to 1473 proteins in 438 species: Archae - 212; Bacteria - 283; Metazoa - 292; Fungi - 127; Plants - 164; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink). |
| AT3G25920 | AT3G25920.1 | AAAGGCCCAATAA | encodes a plastid ribosomal protein CL15, a constituent of the large subunit of the ribosomal complex |
| AT3G26410 | AT3G26410.1 | TAAATGGGCTTTATTGGGCCCATG | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G26420 | AT3G26420.1 | CATGGGCCCAATAAAGCCCATTTA | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. |
| AT3G27020 | AT3G27020.1 | AGCCCAATA | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
| AT3G27330 | AT3G27330.1 | TTATTGGGCCTAAC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40720.1); Has 6969 Blast hits to 6918 proteins in 1619 species: Archae - 0; Bacteria - 145; Metazoa - 5625; Fungi - 356; Plants - 343; Viruses - 13; Other Eukaryotes - 487 (source: NCBI BLink). |
| AT3G27340 | AT3G27340.1 | GTTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). |
| AT3G27340.2 | GTTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). |
| AT3G27340.3 | GTTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). |
| AT3G27430 | AT3G27430.1 | CTTATTGGGCCTAAG | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
| AT3G27430.2 | CTTATTGGGCCTAAG | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
| AT3G27520 | AT3G27520.1 | CTATTGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G32180 | AT3G32180.1 | TTATTGGGCTTGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G32160.1); Has 34 Blast hits to 22 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G44600 | AT3G44600.1 | ATAAGGCCCAATAG | Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3. |
| AT3G45030 | AT3G45030.1 | TTATTGGGCTTTAT | 40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). |
| AT3G46560 | AT3G46560.1 | ATAAAGCCCACCAGGCCCAATAA | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT3G47390 | AT3G47390.1 | CTTATTGGGCCTATATGGGCTTC | cytidine/deoxycytidylate deaminase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: riboflavin biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02464 (InterPro:IPR012816), CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193), Riboflavin-specific deaminase, C-terminal (InterPro:IPR011549), Bacterial bifunctional deaminase-reductase, C-terminal (InterPro:IPR002734), Riboflavin biosynthesis protein RibD (InterPro:IPR004794); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT4G20960.1); Has 5155 Blast hits to 5155 proteins in 1224 species: Archae - 129; Bacteria - 2674; Metazoa - 23; Fungi - 93; Plants - 54; Viruses - 14; Other Eukaryotes - 2168 (source: NCBI BLink). |
| AT3G47610 | AT3G47610.1 | ATATTGGGCCGA | transcription regulator/ zinc ion binding; FUNCTIONS IN: transcription regulator activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2HC5-type (InterPro:IPR009349); Has 247 Blast hits to 233 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 80; Plants - 16; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT3G48380 | AT3G48380.1 | ATATTGGGCTAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G48380.2 | ATATTGGGCTAGGCCCATATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT3G48425 | AT3G48425.1 | ATATTGGGCTTG | endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Exodeoxyribonuclease III xth (InterPro:IPR004808); BEST Arabidopsis thaliana protein match is: ARP; DNA-(apurinic or apyrimidinic site) lyase (TAIR:AT2G41460.1); Has 3937 Blast hits to 3936 proteins in 1101 species: Archae - 54; Bacteria - 2118; Metazoa - 201; Fungi - 59; Plants - 62; Viruses - 0; Other Eukaryotes - 1443 (source: NCBI BLink). |
| AT3G48680 | AT3G48680.1 | TTAGCCCATAAGGCCCAATAA | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT3G48930 | AT3G48930.1 | CTAAGGCCCGTAATTAAAGGCCCAATAA | embryo defective 1080 (EMB1080); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: RPS11-BETA (RIBOSOMAL PROTEIN S11-BETA); structural constituent of ribosome (TAIR:AT5G23740.1); Has 956 Blast hits to 954 proteins in 334 species: Archae - 160; Bacteria - 168; Metazoa - 241; Fungi - 98; Plants - 94; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT3G49010 | AT3G49010.1 | TTCGGCCCACCGGCCCAATAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49010.2 | TTCGGCCCACCGGCCCAATAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49010.3 | TTCGGCCCACCGGCCCAATAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49010.4 | TTCGGCCCACCGGCCCAATAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49010.5 | TTCGGCCCACCGGCCCAATAA | Encodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). |
| AT3G49470 | AT3G49470.1 | GAAGCCCAATAAAAGGCCCAAT | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 2 (NACA2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT4G10480.1); Has 1168 Blast hits to 1151 proteins in 231 species: Archae - 23; Bacteria - 6; Metazoa - 522; Fungi - 246; Plants - 124; Viruses - 7; Other Eukaryotes - 240 (source: NCBI BLink). |
| AT3G49601 | AT3G49601.1 | ATATTGGGCCTAAGCCCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf21 (InterPro:IPR013170); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37820.1); Has 58354 Blast hits to 32469 proteins in 1203 species: Archae - 56; Bacteria - 5471; Metazoa - 26539; Fungi - 6511; Plants - 2874; Viruses - 282; Other Eukaryotes - 16621 (source: NCBI BLink). |
| AT3G49601.1 | ATATTGGGCCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf21 (InterPro:IPR013170); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37820.1); Has 58354 Blast hits to 32469 proteins in 1203 species: Archae - 56; Bacteria - 5471; Metazoa - 26539; Fungi - 6511; Plants - 2874; Viruses - 282; Other Eukaryotes - 16621 (source: NCBI BLink). |
| AT3G50080 | AT3G50080.1 | TTATTGGGCCTTTATGGCCCATTAG | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT3G50808 | AT3G50808.1 | ATAAGCCCAATAA | unknown protein. |
| AT3G51440 | AT3G51440.1 | ATATTGGGCCTAC | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 1156 Blast hits to 1151 proteins in 269 species: Archae - 13; Bacteria - 456; Metazoa - 195; Fungi - 19; Plants - 279; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink). |
| AT3G51520 | AT3G51520.1 | TTGGCCCAATAT | diacylglycerol acyltransferase family; FUNCTIONS IN: diacylglycerol O-acyltransferase activity, transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Diacylglycerol acyltransferase (InterPro:IPR007130); Has 889 Blast hits to 882 proteins in 180 species: Archae - 0; Bacteria - 135; Metazoa - 472; Fungi - 110; Plants - 62; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT3G52040 | AT3G52040.1 | AATTGGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52050 | AT3G52050.1 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.2 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.3 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.4 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.5 | TTATTGGGCCCAATT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52590 | AT3G52590.1 | AGCCCAATAT | Ubiquitin extension protein |
| AT3G52860 | AT3G52860.1 | AAAAGGCCCAATAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 68 Blast hits to 68 proteins in 28 species: Archae - 0; Bacteria - 2; Metazoa - 36; Fungi - 13; Plants - 13; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT3G52960 | AT3G52960.1 | GTAGGCCCAATAA | peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink). |
| AT3G52960.1 | GTAGGCCCATTAAGGCCCAATAACGGCGT | peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink). |
| AT3G53500 | AT3G53500.2 | ATAAGGCCCAATAA | RSZ32; FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, RNA splicing; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: RSZ33; nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT2G37340.1); Has 19457 Blast hits to 16188 proteins in 516 species: Archae - 6; Bacteria - 235; Metazoa - 7507; Fungi - 1066; Plants - 1444; Viruses - 8093; Other Eukaryotes - 1106 (source: NCBI BLink). |
| AT3G53740 | AT3G53740.1 | ATAAGGCCCAATAAAAGCCCAAAC | 60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G53740.2 | ATAAGGCCCAATAAAAGCCCAAAC | 60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G53740.3 | ATAAGGCCCAATAAAAGCCCAAAC | 60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G53740.4 | ATAAGGCCCAATAAAAGCCCAAAC | 60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). |
| AT3G53750 | AT3G53750.1 | GTTTGGGCTTTTATTGGGCCTTAT | Member of the Actin gene family. Expressed in mature pollen. |
| AT3G54190 | AT3G54190.1 | TTATTGGGCTGGGCCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G54440 | AT3G54440.1 | AAAGCCCAATAA | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink). |
| AT3G54440.2 | AAAGCCCAATAA | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink). |
| AT3G54540 | AT3G54540.1 | ATAAGCCCATAATGAGGCCCAATAAG | member of GCN subfamily |
| AT3G54920 | AT3G54920.1 | AGAGGCCCAATAT | Powdery mildew resistant mutant encodes a pectate lyase-like protein |
| AT3G55750 | AT3G55750.1 | ATAAGCCCAATAG | 60S ribosomal protein L35a (RPL35aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aB) (TAIR:AT1G41880.1); Has 539 Blast hits to 539 proteins in 185 species: Archae - 19; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT3G55850 | AT3G55850.1 | TTATTGGGCCTTAA | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
| AT3G56020 | AT3G56020.1 | AGATGGGCCTTAAAGGCCCAATAT | 60S ribosomal protein L41 (RPL41G); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G56020.1 | TTATTGGGCT | 60S ribosomal protein L41 (RPL41G); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G56030 | AT3G56030.1 | AGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G40240.1); Has 6707 Blast hits to 2251 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 13; Plants - 6562; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT3G56030.1 | ATATTGGGCCTTTAAGGCCCATCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G40240.1); Has 6707 Blast hits to 2251 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 13; Plants - 6562; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT3G56270 | AT3G56270.1 | AAAAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40480.1); Has 136 Blast hits to 136 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT3G56270.1 | AACGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40480.1); Has 136 Blast hits to 136 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT3G56860 | AT3G56860.1 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G56860.2 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G56860.3 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G57270 | AT3G57270.1 | TATTGGGC | encodes a member of glycosyl hydrolase family 17 |
| AT3G57280 | AT3G57280.1 | TGAGCCCAATAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 95 Blast hits to 95 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 21; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G57900 | AT3G57900.1 | TTAATGGGCTTTAATTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: epidermis; Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G57910 | AT3G57910.1 | TTATTGGGCCTAATTAAAGCCCATTAA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT5G26610.2); Has 5088 Blast hits to 3153 proteins in 241 species: Archae - 10; Bacteria - 109; Metazoa - 2809; Fungi - 372; Plants - 190; Viruses - 44; Other Eukaryotes - 1554 (source: NCBI BLink). |
| AT3G58130 | AT3G58130.1 | TATTGGGCTCA | N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl phosphatidylinositol deacetylase (InterPro:IPR003737); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27340.4); Has 346 Blast hits to 344 proteins in 163 species: Archae - 0; Bacteria - 54; Metazoa - 92; Fungi - 109; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT3G58130.2 | TATTGGGCTCA | N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl phosphatidylinositol deacetylase (InterPro:IPR003737); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27340.4); Has 346 Blast hits to 344 proteins in 163 species: Archae - 0; Bacteria - 54; Metazoa - 92; Fungi - 109; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT3G58700 | AT3G58700.1 | TTATTGGGCCAAT | 60S ribosomal protein L11 (RPL11B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L11 (RPL11D) (TAIR:AT5G45775.2); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink). |
| AT3G59340 | AT3G59340.1 | GAGCCCAATAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF914, eukaryotic (InterPro:IPR009262); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59310.1); Has 715 Blast hits to 712 proteins in 169 species: Archae - 7; Bacteria - 146; Metazoa - 153; Fungi - 87; Plants - 74; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink). |
| AT3G60300 | AT3G60300.1 | TATTGGGCCGTT | RWD domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Zinc finger, RING-type (InterPro:IPR001841), RWD (InterPro:IPR006575); Has 252 Blast hits to 252 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 198; Fungi - 9; Plants - 28; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT3G60810 | AT3G60810.1 | TTATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 355 Blast hits to 355 proteins in 103 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT3G60810.2 | TTATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 355 Blast hits to 355 proteins in 103 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT3G61580 | AT3G61580.1 | GCCCAATAA | delta-8 sphingolipid desaturase (SLD1); FUNCTIONS IN: oxidoreductase activity, sphingolipid delta-4 desaturase activity; INVOLVED IN: lipid metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1 (InterPro:IPR005804), Cytochrome b5 (InterPro:IPR001199), Fatty acid/sphingolipid desaturase (InterPro:IPR012171); BEST Arabidopsis thaliana protein match is: delta-8 sphingolipid desaturase, putative (TAIR:AT2G46210.1); Has 3797 Blast hits to 3723 proteins in 598 species: Archae - 1; Bacteria - 564; Metazoa - 826; Fungi - 1045; Plants - 622; Viruses - 2; Other Eukaryotes - 737 (source: NCBI BLink). |
| AT3G62120 | AT3G62120.1 | CTTATTGGGCTTGGCCCATG | tRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink). |
| AT3G62120.2 | CTTATTGGGCTTGGCCCATG | tRNA synthetase class II (G, H, P and S) family protein; FUNCTIONS IN: proline-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: prolyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Prolyl-tRNA synthetase, class IIa, prokaryotic-type (InterPro:IPR004499), Prolyl-tRNA synthetase, class II, C-terminal (InterPro:IPR016061), Anticodon-binding (InterPro:IPR004154), Prolyl-tRNA synthetase, class II (InterPro:IPR017449), Prolyl-tRNA synthetase, class IIa, conserved region (InterPro:IPR002316), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA6 (OVULE ABORTION 6); ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / proline-tRNA ligase (TAIR:AT5G52520.1); Has 5872 Blast hits to 5731 proteins in 1483 species: Archae - 181; Bacteria - 3502; Metazoa - 187; Fungi - 122; Plants - 56; Viruses - 0; Other Eukaryotes - 1824 (source: NCBI BLink). |
| AT3G62240 | AT3G62240.1 | CTATTGGGCCATTAAG | zinc finger (C2H2 type) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: nucleic acid binding / protein binding / zinc ion binding (TAIR:AT2G47090.1); Has 3224 Blast hits to 1336 proteins in 208 species: Archae - 0; Bacteria - 156; Metazoa - 809; Fungi - 335; Plants - 89; Viruses - 4; Other Eukaryotes - 1831 (source: NCBI BLink). |
| AT3G62250 | AT3G62250.1 | CTTAATGGCCCAATAG | ubiquitin 5 (UBQ5); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein ubiquitination during ubiquitin-dependent protein catabolic process, protein modification process, translation; LOCATED IN: cytosolic small ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein S27a (InterPro:IPR002906), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ6; protein binding (TAIR:AT2G47110.1); Has 9355 Blast hits to 5604 proteins in 655 species: Archae - 78; Bacteria - 7; Metazoa - 4233; Fungi - 952; Plants - 1981; Viruses - 176; Other Eukaryotes - 1928 (source: NCBI BLink). |
| AT3G62310 | AT3G62310.1 | ATATTGGGCCGG | RNA helicase, putative; FUNCTIONS IN: RNA helicase activity, helicase activity, ATP binding, nucleic acid binding; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT2G47250.1); Has 7383 Blast hits to 6668 proteins in 1008 species: Archae - 2; Bacteria - 1942; Metazoa - 2132; Fungi - 846; Plants - 392; Viruses - 554; Other Eukaryotes - 1515 (source: NCBI BLink). |
| AT3G62400 | AT3G62400.1 | TTAAGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G62400.2 | TTAAGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G62840 | AT3G62840.1 | TTAAGGCCCAATAA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G62840.2 | TTAAGGCCCAATAA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G63410 | AT3G63410.1 | CAAAACGCCCAATA | Encodes a MPBQ/MSBQ methyltransferase located in the chloroplast inner envelope membrane. Mutant plants lack plastoquinone (PQ), suggesting that the APG1 protein is involved in the methylation step of PQ biosynthesis. The gene product is also involved in tocopherol (vitamin E) biosynthesis. |
| AT3G63460 | AT3G63460.1 | TTATTGGGCCCAATTG | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT3G63460.2 | TTATTGGGCCCAATTG | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). |
| AT3G63500 | AT3G63500.1 | AGAGGCCCAATAG | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1423, plant (InterPro:IPR004082); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14740.1); Has 2817 Blast hits to 2297 proteins in 310 species: Archae - 8; Bacteria - 278; Metazoa - 1232; Fungi - 288; Plants - 201; Viruses - 10; Other Eukaryotes - 800 (source: NCBI BLink). |
| AT4G00490 | AT4G00490.1 | ACAGGCCCAATAA | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. Mutant of BAM2 has no visible phenotype. |
| AT4G00660 | AT4G00660.1 | CAAGCCCAAGCCCAATA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH12) (TAIR:AT3G61240.2); Has 29911 Blast hits to 28926 proteins in 1767 species: Archae - 415; Bacteria - 11594; Metazoa - 5504; Fungi - 3568; Plants - 1459; Viruses - 51; Other Eukaryotes - 7320 (source: NCBI BLink). |
| AT4G00660.2 | CAAGCCCAAGCCCAATA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH12) (TAIR:AT3G61240.2); Has 29911 Blast hits to 28926 proteins in 1767 species: Archae - 415; Bacteria - 11594; Metazoa - 5504; Fungi - 3568; Plants - 1459; Viruses - 51; Other Eukaryotes - 7320 (source: NCBI BLink). |
| AT4G00810 | AT4G00810.1 | AGCCCAATAT | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT4G00810.2 | AGCCCAATAT | 60S acidic ribosomal protein P1 (RPP1B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1673 Blast hits to 1672 proteins in 297 species: Archae - 60; Bacteria - 0; Metazoa - 672; Fungi - 360; Plants - 316; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink). |
| AT4G00830 | AT4G00830.1 | CTAGGCCCAATAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink). |
| AT4G00830.2 | CTAGGCCCAATAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink). |
| AT4G00840 | AT4G00840.1 | TTATTGGGCCTGTTAATGGGCCTTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G60800.1); Has 3992 Blast hits to 3990 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1955; Fungi - 533; Plants - 396; Viruses - 0; Other Eukaryotes - 1108 (source: NCBI BLink). |
| AT4G00850 | AT4G00850.1 | ATAAGGCCCATTAACAGGCCCAATAA | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA |
| AT4G00860 | AT4G00860.1 | AAATGGGCCCATAATGGCCCAATAT | putative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains. |
| AT4G01220 | AT4G01220.1 | CAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RGXT1 (rhamnogalacturonan xylosyltransferase 1); UDP-xylosyltransferase (TAIR:AT4G01770.1); Has 188 Blast hits to 185 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT4G01220.2 | CAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RGXT1 (rhamnogalacturonan xylosyltransferase 1); UDP-xylosyltransferase (TAIR:AT4G01770.1); Has 188 Blast hits to 185 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT4G01690 | AT4G01690.1 | CTATTGGGCCTATA | Encodes protoporphyrinogen oxidase (PPOX). |
| AT4G01690.2 | CTATTGGGCCTATA | Encodes protoporphyrinogen oxidase (PPOX). |
| AT4G01860 | AT4G01860.1 | TATTGGGCCCT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT4G01860.2 | TATTGGGCCCT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT4G02195 | AT4G02195.1 | ATAAGCCCAATAT | member of SYP4 Gene Family |
| AT4G02210 | AT4G02210.1 | CTAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02220 | AT4G02220.1 | TTATTGGGCTTAG | zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320), Zinc finger, MYND-type (InterPro:IPR002893); BEST Arabidopsis thaliana protein match is: programmed cell death 2 C-terminal domain-containing protein (TAIR:AT5G64830.1); Has 702 Blast hits to 666 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 111; Plants - 110; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). |
| AT4G02720 | AT4G02720.1 | AGGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF926 (InterPro:IPR009269); Has 94634 Blast hits to 43088 proteins in 1394 species: Archae - 72; Bacteria - 10621; Metazoa - 45152; Fungi - 10187; Plants - 3989; Viruses - 718; Other Eukaryotes - 23895 (source: NCBI BLink). |
| AT4G02720.1 | ATATTGGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF926 (InterPro:IPR009269); Has 94634 Blast hits to 43088 proteins in 1394 species: Archae - 72; Bacteria - 10621; Metazoa - 45152; Fungi - 10187; Plants - 3989; Viruses - 718; Other Eukaryotes - 23895 (source: NCBI BLink). |
| AT4G02880 | AT4G02880.1 | CTATTGGGCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03290.1); Has 3704 Blast hits to 3126 proteins in 384 species: Archae - 40; Bacteria - 363; Metazoa - 1661; Fungi - 338; Plants - 170; Viruses - 7; Other Eukaryotes - 1125 (source: NCBI BLink). |
| AT4G02930 | AT4G02930.1 | CTAAGGCCCAATAA | elongation factor Tu, putative / EF-Tu, putative; FUNCTIONS IN: translation elongation factor activity, ATP binding; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, cell wall; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, bacterial and organelle (InterPro:IPR004541), Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: ATRABE1B (ARABIDOPSIS RAB GTPASE HOMOLOG E1B); GTP binding / GTPase/ translation elongation factor (TAIR:AT4G20360.1); Has 60152 Blast hits to 60103 proteins in 12753 species: Archae - 783; Bacteria - 22701; Metazoa - 13343; Fungi - 6902; Plants - 1303; Viruses - 3; Other Eukaryotes - 15117 (source: NCBI BLink). |
| AT4G03030 | AT4G03030.1 | AAAGCCCAATA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 1405 Blast hits to 1314 proteins in 98 species: Archae - 0; Bacteria - 31; Metazoa - 962; Fungi - 4; Plants - 358; Viruses - 9; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT4G03030.1 | TAAGCCCAATA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 1405 Blast hits to 1314 proteins in 98 species: Archae - 0; Bacteria - 31; Metazoa - 962; Fungi - 4; Plants - 358; Viruses - 9; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT4G03180 | AT4G03180.1 | GTGGGCTTATTGGGCAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 869 Blast hits to 650 proteins in 112 species: Archae - 2; Bacteria - 20; Metazoa - 199; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 516 (source: NCBI BLink). |
| AT4G03280 | AT4G03280.1 | TCAGCCCAATAAGGCCCAC | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03280.2 | TCAGCCCAATAAGGCCCAC | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G04620 | AT4G04620.1 | TAAAGGCCCAATAA | autophagy 8b (ATG8B); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase (TAIR:AT4G21980.2); Has 1162 Blast hits to 1160 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 581; Fungi - 125; Plants - 172; Viruses - 3; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT4G04620.2 | TAAAGGCCCAATAA | autophagy 8b (ATG8B); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8A (AUTOPHAGY 8A); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase (TAIR:AT4G21980.2); Has 1162 Blast hits to 1160 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 581; Fungi - 125; Plants - 172; Viruses - 3; Other Eukaryotes - 281 (source: NCBI BLink). |
| AT4G05460 | AT4G05460.1 | TATAGGCCAAGGCCCAATAT | F-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G08580 | AT4G08580.1 | TATTGGGCCTTAATGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17900.1); Has 39042 Blast hits to 22601 proteins in 1140 species: Archae - 179; Bacteria - 2955; Metazoa - 18595; Fungi - 3264; Plants - 1100; Viruses - 245; Other Eukaryotes - 12704 (source: NCBI BLink). |
| AT4G08940 | AT4G08940.1 | TAAAGCCCAATAA | ubiquitin thiolesterase; FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase (TAIR:AT4G01037.1); Has 214 Blast hits to 214 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G09000 | AT4G09000.1 | TTATTGGGCCTATT | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09000.2 | TTATTGGGCCTATT | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09150 | AT4G09150.1 | TGGCCCAATAGTAAGCCCATATA | T-complex protein 11; FUNCTIONS IN: phosphopantetheine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862), Phosphopantetheine attachment site (InterPro:IPR006162); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT1G22930.1); Has 12960 Blast hits to 8305 proteins in 753 species: Archae - 49; Bacteria - 1704; Metazoa - 5727; Fungi - 995; Plants - 381; Viruses - 20; Other Eukaryotes - 4084 (source: NCBI BLink). |
| AT4G10180 | AT4G10180.1 | CTATTGGGCCAT | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling. |
| AT4G10330 | AT4G10330.1 | CTATTGGGCTGAAGTTGGGCCTTG | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 4017 Blast hits to 987 proteins in 153 species: Archae - 18; Bacteria - 164; Metazoa - 2052; Fungi - 67; Plants - 1382; Viruses - 57; Other Eukaryotes - 277 (source: NCBI BLink). |
| AT4G10710 | AT4G10710.1 | TAAGCCCAATA | encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SPT16. |
| AT4G10925 | AT4G10925.1 | CTATTGGGCCTAAC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G10925.2 | CTATTGGGCCTAAC | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G23960.1); Has 131 Blast hits to 131 proteins in 34 species: Archae - 0; Bacteria - 51; Metazoa - 1; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G12340 | AT4G12340.1 | AGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); Has 33 Blast hits to 31 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G12340.1 | CTAGGCCCAATAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); Has 33 Blast hits to 31 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G12620 | AT4G12620.1 | ATAAGCCCAATATTCGGCCCAAA | Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime. |
| AT4G12640 | AT4G12640.1 | TTTGGGCCGAATATTGGGCTTAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 6679 Blast hits to 5578 proteins in 311 species: Archae - 8; Bacteria - 143; Metazoa - 3956; Fungi - 1074; Plants - 834; Viruses - 0; Other Eukaryotes - 664 (source: NCBI BLink). |
| AT4G13170 | AT4G13170.1 | GGGCCAATATTGGGCTTTAA | 60S ribosomal protein L13A (RPL13aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1401 Blast hits to 1401 proteins in 423 species: Archae - 212; Bacteria - 236; Metazoa - 292; Fungi - 130; Plants - 165; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink). |
| AT4G14200 | AT4G14200.1 | ATATTGGGCCC | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; Has 1311 Blast hits to 831 proteins in 209 species: Archae - 4; Bacteria - 342; Metazoa - 470; Fungi - 179; Plants - 56; Viruses - 0; Other Eukaryotes - 260 (source: NCBI BLink). |
| AT4G14300 | AT4G14300.1 | CTATTGGGCT | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT2G33410.1); Has 82956 Blast hits to 37358 proteins in 1472 species: Archae - 56; Bacteria - 18252; Metazoa - 33610; Fungi - 7047; Plants - 9752; Viruses - 546; Other Eukaryotes - 13693 (source: NCBI BLink). |
| AT4G15000 | AT4G15000.1 | TAAAGGCCCAATAA | 60S ribosomal protein L27 (RPL27C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27B) (TAIR:AT3G22230.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT4G15000.2 | TAAAGGCCCAATAA | 60S ribosomal protein L27 (RPL27C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27B) (TAIR:AT3G22230.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT4G16144 | AT4G16144.1 | GCCCAATAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: mov34 family protein (TAIR:AT1G48790.1); Has 622 Blast hits to 459 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 326; Fungi - 156; Plants - 82; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT4G16720 | AT4G16720.1 | CAAAGCCCAATAG | 60S ribosomal protein L15 (RPL15A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15B) (TAIR:AT4G17390.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT4G17040 | AT4G17040.1 | CTATTGGGCCTATT | ATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plastid stroma, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: ATP-dependent Clp protease proteolytic subunit, putative (TAIR:AT1G09130.2); Has 8307 Blast hits to 8303 proteins in 1647 species: Archae - 0; Bacteria - 4113; Metazoa - 115; Fungi - 50; Plants - 683; Viruses - 6; Other Eukaryotes - 3340 (source: NCBI BLink). |
| AT4G17050 | AT4G17050.1 | AATAGGCCCAATAG | UREIDOGLYCINE AMINOHYDROLASE (UGLYAH); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cupin 2, conserved barrel (InterPro:IPR013096), Cupin, RmlC-type (InterPro:IPR011051), RmlC-like jelly roll fold (InterPro:IPR014710); Has 513 Blast hits to 513 proteins in 229 species: Archae - 4; Bacteria - 414; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). |
| AT4G17240 | AT4G17240.1 | TTAAAGCCCATAGTTAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 43 Blast hits to 43 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT4G17390 | AT4G17390.1 | AAAAGGCCCAATAAGGGC | 60S ribosomal protein L15 (RPL15B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15A) (TAIR:AT4G16720.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT4G17390.1 | AAGGCCCAATA | 60S ribosomal protein L15 (RPL15B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15A) (TAIR:AT4G16720.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT4G17410 | AT4G17410.1 | GCCCTTATTGGGCCTTTT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G47430.1); Has 8731 Blast hits to 6294 proteins in 276 species: Archae - 2; Bacteria - 71; Metazoa - 5540; Fungi - 1215; Plants - 632; Viruses - 56; Other Eukaryotes - 1215 (source: NCBI BLink). |
| AT4G17410.1 | TATTGGGCCTT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G47430.1); Has 8731 Blast hits to 6294 proteins in 276 species: Archae - 2; Bacteria - 71; Metazoa - 5540; Fungi - 1215; Plants - 632; Viruses - 56; Other Eukaryotes - 1215 (source: NCBI BLink). |
| AT4G17520 | AT4G17520.1 | TAACGGGCCCGGCCCAATAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 13357 Blast hits to 8375 proteins in 750 species: Archae - 13; Bacteria - 2605; Metazoa - 5274; Fungi - 1340; Plants - 1789; Viruses - 136; Other Eukaryotes - 2200 (source: NCBI BLink). |
| AT4G18100 | AT4G18100.1 | CTTATTGGGCCAC | 60S ribosomal protein L32 (RPL32A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: callus, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32e (InterPro:IPR001515), Ribosomal protein L32e, conserved site (InterPro:IPR018263); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L32 (RPL32B) (TAIR:AT5G46430.2); Has 1112 Blast hits to 1112 proteins in 342 species: Archae - 217; Bacteria - 0; Metazoa - 540; Fungi - 96; Plants - 104; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT4G19006 | AT4G19006.1 | GCCCAATA | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT5G45620.1); Has 799 Blast hits to 796 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 466; Fungi - 144; Plants - 91; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT4G19210 | AT4G19210.1 | CAAGCCCAATAA | member of RLI subfamily |
| AT4G20330 | AT4G20330.1 | TTATTGGGCCGAA | transcription initiation factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor TFIIE, beta subunit (InterPro:IPR016656), Transcription factor TFIIE beta subunit-like, DNA-binding (InterPro:IPR017935); BEST Arabidopsis thaliana protein match is: transcription initiation factor-related (TAIR:AT4G21010.1); Has 212 Blast hits to 212 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 68; Plants - 35; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G21320 | AT4G21320.1 | TGGCCCAATAA | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. |
| AT4G21800 | AT4G21800.1 | CTTATTGGGCCTTG | Encodes QQT2. Required for early embryo development. qqt1 mutant lines are embryo-defective. Participates in the organization of microtubules during cell division. Interacts with QQT1 (encoded by AT5G22370). |
| AT4G21800.2 | CTTATTGGGCCTTG | Encodes QQT2. Required for early embryo development. qqt1 mutant lines are embryo-defective. Participates in the organization of microtubules during cell division. Interacts with QQT1 (encoded by AT5G22370). |
| AT4G21860 | AT4G21860.1 | ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAAT | methionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink). |
| AT4G21860.2 | ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAAT | methionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink). |
| AT4G22260 | AT4G22260.1 | CTAAGCCCAATAAG | Similar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues. |
| AT4G22350 | AT4G22350.1 | GTGGCCCAATAA | ubiquitin carboxyl-terminal hydrolase family protein; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase/ zinc ion binding (TAIR:AT4G22285.1); Has 2784 Blast hits to 2384 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1738; Fungi - 374; Plants - 244; Viruses - 0; Other Eukaryotes - 428 (source: NCBI BLink). |
| AT4G22350.1 | TTATTGGGCT | ubiquitin carboxyl-terminal hydrolase family protein; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase/ zinc ion binding (TAIR:AT4G22285.1); Has 2784 Blast hits to 2384 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1738; Fungi - 374; Plants - 244; Viruses - 0; Other Eukaryotes - 428 (source: NCBI BLink). |
| AT4G22670 | AT4G22670.1 | TTATTGGGCCTTATTAACGGGCTTAT | Arabidopsis thaliana Hsp70-interacting protein 1 (AtHip1); FUNCTIONS IN: binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ATTDX (TETRATICOPEPTIDE DOMAIN-CONTAINING THIOREDOXIN); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / protein binding (TAIR:AT3G17880.2); Has 104992 Blast hits to 32574 proteins in 1569 species: Archae - 323; Bacteria - 31113; Metazoa - 46021; Fungi - 5704; Plants - 7149; Viruses - 884; Other Eukaryotes - 13798 (source: NCBI BLink). |
| AT4G22720 | AT4G22720.1 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). |
| AT4G22720.2 | TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTA | glycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). |
| AT4G22756 | AT4G22756.1 | ATGGCCCAATAA | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase. |
| AT4G23140 | AT4G23140.1 | TTATTGGGCTCA | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23140.2 | TTATTGGGCTCA | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23390 | AT4G23390.1 | ATATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF239, plant (InterPro:IPR004314); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20170.2); Has 423 Blast hits to 388 proteins in 17 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 10; Plants - 409; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G23820 | AT4G23820.1 | CTTATTGGGCCACTAAAGCCCAAAC | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G41870.1); Has 2405 Blast hits to 2400 proteins in 312 species: Archae - 2; Bacteria - 563; Metazoa - 8; Fungi - 896; Plants - 841; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). |
| AT4G23840 | AT4G23840.1 | GTTTGGGCTTTAGTGGCCCAATAAG | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G15740.1); Has 7635 Blast hits to 5145 proteins in 376 species: Archae - 2; Bacteria - 2863; Metazoa - 1987; Fungi - 78; Plants - 1868; Viruses - 40; Other Eukaryotes - 797 (source: NCBI BLink). |
| AT4G23850 | AT4G23850.1 | TACGGCCCAATAAG | long-chain-fatty-acid--CoA ligase / long-chain acyl-CoA synthetase; FUNCTIONS IN: catalytic activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: long-chain-fatty-acid--CoA ligase, putative / long-chain acyl-CoA synthetase, putative (TAIR:AT4G11030.1); Has 34929 Blast hits to 33173 proteins in 1967 species: Archae - 465; Bacteria - 18245; Metazoa - 1999; Fungi - 1232; Plants - 1153; Viruses - 1; Other Eukaryotes - 11834 (source: NCBI BLink). |
| AT4G23850.1 | TTATTGGGCCTAAT | long-chain-fatty-acid--CoA ligase / long-chain acyl-CoA synthetase; FUNCTIONS IN: catalytic activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: long-chain-fatty-acid--CoA ligase, putative / long-chain acyl-CoA synthetase, putative (TAIR:AT4G11030.1); Has 34929 Blast hits to 33173 proteins in 1967 species: Archae - 465; Bacteria - 18245; Metazoa - 1999; Fungi - 1232; Plants - 1153; Viruses - 1; Other Eukaryotes - 11834 (source: NCBI BLink). |
| AT4G24370 | AT4G24370.1 | CTTATTGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT4G24380 | AT4G24380.1 | TTGGCCCAATAAG | unknown protein; INVOLVED IN: 10-formyltetrahydrofolate biosynthetic process, folic acid and derivative biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65400.1); Has 484 Blast hits to 484 proteins in 112 species: Archae - 0; Bacteria - 2; Metazoa - 89; Fungi - 296; Plants - 68; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G24380.2 | TTGGCCCAATAAG | unknown protein; INVOLVED IN: 10-formyltetrahydrofolate biosynthetic process, folic acid and derivative biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65400.1); Has 484 Blast hits to 484 proteins in 112 species: Archae - 0; Bacteria - 2; Metazoa - 89; Fungi - 296; Plants - 68; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT4G24780 | AT4G24780.1 | ATATTGGGCTAA | pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT5G63180.1); Has 863 Blast hits to 860 proteins in 162 species: Archae - 0; Bacteria - 350; Metazoa - 0; Fungi - 105; Plants - 397; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT4G25500 | AT4G25500.1 | TATAGGCCCAATA | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. |
| AT4G25740 | AT4G25740.1 | TCAGCCCAATAAAAGCCCAAAT | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). |
| AT4G25740.2 | TCAGCCCAATAAAAGCCCAAAT | 40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). |
| AT4G26210 | AT4G26210.1 | ATATTGGGCTATT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G26210.2 | ATATTGGGCTATT | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G26840 | AT4G26840.1 | GTGGCCCAATAA | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
| AT4G27000 | AT4G27000.1 | ATATTGGGCCATA | ATRBP45C; FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45A (RNA-binding protein 45A); RNA binding (TAIR:AT5G54900.1); Has 24066 Blast hits to 14859 proteins in 588 species: Archae - 10; Bacteria - 1237; Metazoa - 14401; Fungi - 2729; Plants - 3582; Viruses - 5; Other Eukaryotes - 2102 (source: NCBI BLink). |
| AT4G27090 | AT4G27090.1 | ATATTGGGC | 60S ribosomal protein L14 (RPL14B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14A) (TAIR:AT2G20450.1); Has 520 Blast hits to 520 proteins in 229 species: Archae - 47; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT4G27230 | AT4G27230.1 | CAAGCCCAATATAGCCCATATA | Encodes HTA2, a histone H2A protein. |
| AT4G27370 | AT4G27370.1 | CTTATTGGGCCCATA | member of Myosin-like proteins |
| AT4G27380 | AT4G27380.1 | TATGGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G27585 | AT4G27585.1 | TAAAGCCCAATAA | band 7 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid, membrane; EXPRESSED IN: callus, leaf; CONTAINS InterPro DOMAIN/s: Stomatin (InterPro:IPR001972), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: band 7 family protein (TAIR:AT5G54100.1); Has 7621 Blast hits to 7607 proteins in 1311 species: Archae - 148; Bacteria - 4066; Metazoa - 810; Fungi - 128; Plants - 171; Viruses - 3; Other Eukaryotes - 2295 (source: NCBI BLink). |
| AT4G28030 | AT4G28030.1 | TATGGGCTCATATTGGGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT4G28030.2 | TATGGGCTCATATTGGGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT4G28200 | AT4G28200.1 | GTAGGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: RNA processing; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), U3 small nucleolar RNA-associated protein 6 (InterPro:IPR013949); Has 352 Blast hits to 342 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 130; Plants - 24; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink). |
| AT4G28510 | AT4G28510.1 | CTAAGCCCAATAA | prohibitin 1 (Atphb1) |
| AT4G28610 | AT4G28610.1 | CAAGCCCAATA | Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling. |
| AT4G29070 | AT4G29070.1 | TCGGCCCATTTTGAGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G29070.2 | TCGGCCCATTTTGAGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31080 | AT4G31080.1 | TTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24330.1); Has 251 Blast hits to 245 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G31300 | AT4G31300.1 | ATATTGGGCTTT | Encodes 20S proteasome subunit PBA1 (PBA1). |
| AT4G31300.1 | TATTGGGCTTG | Encodes 20S proteasome subunit PBA1 (PBA1). |
| AT4G31300.1 | TATTGGGCTTTTA | Encodes 20S proteasome subunit PBA1 (PBA1). |
| AT4G31300.2 | ATATTGGGCTTT | Encodes 20S proteasome subunit PBA1 (PBA1). |
| AT4G31300.2 | TATTGGGCTTG | Encodes 20S proteasome subunit PBA1 (PBA1). |
| AT4G31300.2 | TATTGGGCTTTTA | Encodes 20S proteasome subunit PBA1 (PBA1). |
| AT4G31360 | AT4G31360.1 | CTATTGGGC | selenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT4G31530 | AT4G31530.1 | AGAGGCCCAATA | binding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 2281 Blast hits to 2232 proteins in 521 species: Archae - 12; Bacteria - 1390; Metazoa - 76; Fungi - 31; Plants - 258; Viruses - 0; Other Eukaryotes - 514 (source: NCBI BLink). |
| AT4G31580 | AT4G31580.1 | TAAGCCCAATAAATAGGCCCAAAT | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K. |
| AT4G31580.2 | TAAGCCCAATAAATAGGCCCAAAT | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K. |
| AT4G31840 | AT4G31840.1 | CAAGGCCCAATAA | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT2G25060.1); Has 804 Blast hits to 795 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 804; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31985 | AT4G31985.1 | AAAAAGCCCAATAA | 60S ribosomal protein L39 (RPL39C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39B) (TAIR:AT3G02190.1); Has 591 Blast hits to 591 proteins in 225 species: Archae - 151; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT4G32710 | AT4G32710.1 | CTATTGGGCCTGT | ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATPERK1 (PROLINE EXTENSIN-LIKE RECEPTOR KINASE 1); ATP binding / protein kinase (TAIR:AT3G24550.1); Has 87667 Blast hits to 86649 proteins in 3166 species: Archae - 53; Bacteria - 7959; Metazoa - 38002; Fungi - 7110; Plants - 19079; Viruses - 374; Other Eukaryotes - 15090 (source: NCBI BLink). |
| AT4G34450 | AT4G34450.1 | TATGGGCTATTGGGCCG | coatomer gamma-2 subunit, putative / gamma-2 coat protein, putative / gamma-2 COP, putative; FUNCTIONS IN: protein binding, clathrin binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Coatomer, gamma subunit, appendage, Ig-like subdomain (InterPro:IPR013040), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Coatomer, gamma subunit (InterPro:IPR017106), Coatomer, gamma subunit , appendage (InterPro:IPR014863), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin alpha-adaptin/coatomer adaptor, appendage, C-terminal subdomain (InterPro:IPR015873), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT2G16200.1); Has 1246 Blast hits to 1241 proteins in 162 species: Archae - 0; Bacteria - 2; Metazoa - 606; Fungi - 289; Plants - 90; Viruses - 0; Other Eukaryotes - 259 (source: NCBI BLink). |
| AT4G34570 | AT4G34570.1 | TGAGGCCCAATAT | Encodes a bifunctional dihydrofolate reductase - thymidylate synthase gene. This is unique in Arabidopsis and protozoa. Other organisms have independent genes for this function. |
| AT4G34660 | AT4G34660.1 | GAGCCCAATAT | SH3 domain-containing protein 2 (SH3P2); FUNCTIONS IN: clathrin binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: clathrin binding (TAIR:AT4G18060.1); Has 1201 Blast hits to 1169 proteins in 144 species: Archae - 0; Bacteria - 12; Metazoa - 956; Fungi - 47; Plants - 87; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). |
| AT4G34670 | AT4G34670.1 | ATATTGGGCTC | 40S ribosomal protein S3A (RPS3aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S3Ae, conserved site (InterPro:IPR018281), Ribosomal protein S3Ae (InterPro:IPR001593); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3A (RPS3aA) (TAIR:AT3G04840.1); Has 941 Blast hits to 936 proteins in 297 species: Archae - 150; Bacteria - 1; Metazoa - 370; Fungi - 111; Plants - 126; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G34830 | AT4G34830.1 | CCAGGCCCAATAA | LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 19818 Blast hits to 5849 proteins in 171 species: Archae - 3; Bacteria - 16; Metazoa - 570; Fungi - 397; Plants - 17732; Viruses - 0; Other Eukaryotes - 1100 (source: NCBI BLink). |
| AT4G34840 | AT4G34840.1 | TTATTGGGCCTGG | ATMTN2; FUNCTIONS IN: methylthioadenosine nucleosidase activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: ATMTN1; catalytic/ methylthioadenosine nucleosidase (TAIR:AT4G38800.1); Has 1301 Blast hits to 1301 proteins in 595 species: Archae - 0; Bacteria - 1215; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT4G34870 | AT4G34870.1 | ATATTGGGCTTTA | belongs to cyclophilin family |
| AT4G34900 | AT4G34900.1 | ATATTGGGCTTATTTTGGGCT | XXANTHINE DEHYDROGENASE 2 (XDH2); FUNCTIONS IN: in 8 functions; INVOLVED IN: allantoin biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Aldehyde oxidase/xanthine dehydrogenase (InterPro:IPR016208), Ferredoxin (InterPro:IPR001041), Molybdopterin dehydrogenase, FAD-binding (InterPro:IPR002346), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), [2Fe-2S]-binding (InterPro:IPR002888), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167), FAD-binding, type 2 (InterPro:IPR016166), CO dehydrogenase flavoprotein, C-terminal (InterPro:IPR005107), 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (InterPro:IPR016169), Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead (InterPro:IPR000674), Aldehyde oxidase and xanthine dehydrogenase, molybdopterin binding (InterPro:IPR008274); BEST Arabidopsis thaliana protein match is: XDH1 (XANTHINE DEHYDROGENASE 1); xanthine dehydrogenase (TAIR:AT4G34890.1); Has 15600 Blast hits to 15136 proteins in 810 species: Archae - 184; Bacteria - 7544; Metazoa - 1009; Fungi - 62; Plants - 139; Viruses - 0; Other Eukaryotes - 6662 (source: NCBI BLink). |
| AT4G34910 | AT4G34910.1 | AGCCCAAAATAAGCCCAATAT | DEAD/DEAH box helicase, putative (RH16); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 23736 Blast hits to 23298 proteins in 1666 species: Archae - 321; Bacteria - 8811; Metazoa - 4714; Fungi - 2993; Plants - 1279; Viruses - 4; Other Eukaryotes - 5614 (source: NCBI BLink). |
| AT4G35760 | AT4G35760.1 | TTTAGGCCCAATAT | LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vitamin K epoxide reductase (InterPro:IPR012932), Thioredoxin-like fold (InterPro:IPR012336); Has 447 Blast hits to 447 proteins in 86 species: Archae - 0; Bacteria - 179; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). |
| AT4G35850 | AT4G35850.1 | TAAGCCCAATAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink). |
| AT4G36420 | AT4G36420.1 | TTATTGGGCCTAACCGAACC | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5784 Blast hits to 5784 proteins in 1564 species: Archae - 0; Bacteria - 3201; Metazoa - 134; Fungi - 85; Plants - 177; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). |
| AT4G37000 | AT4G37000.1 | TTGGCCCAATA | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT4G37040 | AT4G37040.1 | TTGGCCCATTAATAGCCCAATAT | encodes a methionine aminopeptidase |
| AT4G38020 | AT4G38020.1 | CTTATTGGGCCTATTATTGGGCCTAT | tRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 7116 Blast hits to 7116 proteins in 1450 species: Archae - 3; Bacteria - 4784; Metazoa - 124; Fungi - 58; Plants - 45; Viruses - 0; Other Eukaryotes - 2102 (source: NCBI BLink). |
| AT4G39080 | AT4G39080.1 | GAAGCCCATTAAAAGCCCAATA | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. |
| AT4G39235 | AT4G39235.1 | TTATTGGGCCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G05570.1); Has 39 Blast hits to 39 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G39740 | AT4G39740.1 | GAAGCCCAATAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT3G08950.1); Has 2451 Blast hits to 2451 proteins in 612 species: Archae - 9; Bacteria - 1265; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 905 (source: NCBI BLink). |
| AT4G39740.1 | TTAAAGCCCAATAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT3G08950.1); Has 2451 Blast hits to 2451 proteins in 612 species: Archae - 9; Bacteria - 1265; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 905 (source: NCBI BLink). |
| AT5G01230 | AT5G01230.1 | CAAGCCCAATAA | FtsJ-like methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal RNA methyltransferase J (InterPro:IPR015507), Ribosomal RNA methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana protein match is: FtsJ-like methyltransferase family protein (TAIR:AT4G25730.1); Has 4341 Blast hits to 4312 proteins in 938 species: Archae - 101; Bacteria - 1436; Metazoa - 438; Fungi - 272; Plants - 53; Viruses - 63; Other Eukaryotes - 1978 (source: NCBI BLink). |
| AT5G01230.2 | CAAGCCCAATAA | FtsJ-like methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal RNA methyltransferase J (InterPro:IPR015507), Ribosomal RNA methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana protein match is: FtsJ-like methyltransferase family protein (TAIR:AT4G25730.1); Has 4341 Blast hits to 4312 proteins in 938 species: Archae - 101; Bacteria - 1436; Metazoa - 438; Fungi - 272; Plants - 53; Viruses - 63; Other Eukaryotes - 1978 (source: NCBI BLink). |
| AT5G01290 | AT5G01290.1 | CAAGGCCCAATA | mRNA guanylyltransferase/ phosphatase/ polynucleotide 5'-phosphatase/ protein tyrosine phosphatase/ protein tyrosine/serine/threonine phosphatase; FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, protein tyrosine/serine/threonine phosphatase activity, mRNA guanylyltransferase activity, polynucleotide 5'-phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, mRNA processing, mRNA capping, dephosphorylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Protein-tyrosine phosphatase (InterPro:IPR000387), mRNA capping enzyme (InterPro:IPR001339), mRNA capping enzyme, bifunctional (InterPro:IPR017074), Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340), mRNA capping enzyme, C-terminal (InterPro:IPR013846); BEST Arabidopsis thaliana protein match is: mRNA capping enzyme family protein (TAIR:AT3G09100.2); Has 687 Blast hits to 666 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 240; Fungi - 154; Plants - 41; Viruses - 65; Other Eukaryotes - 187 (source: NCBI BLink). |
| AT5G01300 | AT5G01300.1 | TTTAGGCCCAATAAAGCCCAATAT | phosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT5G01300.2 | TTTAGGCCCAATAAAGCCCAATAT | phosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT5G01610 | AT5G01610.1 | AAGGCCCAATAG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08890.2); Has 251 Blast hits to 251 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 250; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G01910 | AT5G01910.1 | GTGGCCCAATATAGCCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G01910.1 | GTGGCCCAATATAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G01910.2 | GTGGCCCAATATAGCCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G01910.2 | GTGGCCCAATATAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G01920 | AT5G01920.1 | ATTGGGCTATATTGGGCCAC | Chloroplast thylakoid protein kinase STN8 is specific in phosphorylation of N-terminal threonine residues in D1, D2 and CP43 proteins, and Thr-4 in PsbH protein of photosystem II. Phosphorylation of Thr-4 in the wild type required both light and prior phosphorylation at Thr-2. |
| AT5G01920.1 | TTATTGGGCTATATTGGGCCAC | Chloroplast thylakoid protein kinase STN8 is specific in phosphorylation of N-terminal threonine residues in D1, D2 and CP43 proteins, and Thr-4 in PsbH protein of photosystem II. Phosphorylation of Thr-4 in the wild type required both light and prior phosphorylation at Thr-2. |
| AT5G01940 | AT5G01940.1 | AAGGCCCAATACAGGCCCAAT | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor IF2/IF5, N-terminal (InterPro:IPR016189), Translation initiation factor IF2/IF5 (InterPro:IPR002735); BEST Arabidopsis thaliana protein match is: EIF2 BETA; translation initiation factor (TAIR:AT5G20920.3); Has 598 Blast hits to 598 proteins in 237 species: Archae - 153; Bacteria - 0; Metazoa - 140; Fungi - 121; Plants - 53; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). |
| AT5G02100 | AT5G02100.1 | ATATTGGGCCTCACGTGGT | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. |
| AT5G02450 | AT5G02450.1 | TTATTGGGCCTC | 60S ribosomal protein L36 (RPL36C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). |
| AT5G02610 | AT5G02610.1 | CTATTGGGCTATT | 60S ribosomal protein L35 (RPL35D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 840 Blast hits to 840 proteins in 308 species: Archae - 109; Bacteria - 145; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink). |
| AT5G02650 | AT5G02650.1 | CTATTGGGCCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28260.2); Has 13 Blast hits to 13 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G03290 | AT5G03290.1 | TTATTGGGCCTGG | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). |
| AT5G03770 | AT5G03770.1 | TTATTGGGCTCA | 3-deoxy-D-manno-octulosonic acid transferase-related; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Three-deoxy-D-manno-octulosonic-acid transferase, N-terminal (InterPro:IPR007507); Has 3832 Blast hits to 3832 proteins in 736 species: Archae - 0; Bacteria - 1449; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 2371 (source: NCBI BLink). |
| AT5G04130 | AT5G04130.1 | CTATTGGGCT | DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink). |
| AT5G04130.2 | CTATTGGGCT | DNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink). |
| AT5G04270 | AT5G04270.1 | ATAAGCCCAATAA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G09320.1); Has 3947 Blast hits to 3944 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1934; Fungi - 520; Plants - 397; Viruses - 0; Other Eukaryotes - 1096 (source: NCBI BLink). |
| AT5G04440 | AT5G04440.1 | TTGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31115.2); Has 213 Blast hits to 213 proteins in 56 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT5G04710 | AT5G04710.1 | ATAAGGCCCAATA | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink). |
| AT5G04720 | AT5G04720.1 | TATTGGGCCTTAT | ADR1-like 2 (ADR1-L2); FUNCTIONS IN: protein binding, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: defense response, apoptosis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Disease resistance, plant (InterPro:IPR014011), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: ADR1-L1 (ADR1-like 1); ATP binding / protein binding (TAIR:AT4G33300.2); Has 16716 Blast hits to 11049 proteins in 439 species: Archae - 24; Bacteria - 1102; Metazoa - 2478; Fungi - 82; Plants - 12542; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). |
| AT5G04750 | AT5G04750.1 | CTATTGGGCTATT | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G04750.2 | CTATTGGGCTATT | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G05000 | AT5G05000.1 | CTTATTGGGCTTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast. |
| AT5G05000.2 | CTTATTGGGCTTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast. |
| AT5G05000.3 | CTTATTGGGCTTT | Outer membrane protein that may function in import of nuclear encoded proteins into the chloroplast. |
| AT5G05010 | AT5G05010.1 | AAAGCCCAATAAG | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT5G05010.2 | AAAGCCCAATAAG | clathrin adaptor complexes medium subunit-related; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); Has 502 Blast hits to 497 proteins in 159 species: Archae - 0; Bacteria - 2; Metazoa - 197; Fungi - 145; Plants - 54; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). |
| AT5G05310 | AT5G05310.1 | GATGGGCCATTATTGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink). |
| AT5G05310.2 | GATGGGCCATTATTGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink). |
| AT5G05310.3 | GATGGGCCATTATTGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink). |
| AT5G05780 | AT5G05780.1 | GCCCAATAAATGACGTG | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. |
| AT5G05780.1 | TCAGGCCCATCATATTGGGCTTA | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. |
| AT5G05800 | AT5G05800.1 | TTATTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11290.1); Has 434 Blast hits to 262 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 26; Plants - 408; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G05800.2 | TTATTGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11290.1); Has 434 Blast hits to 262 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 26; Plants - 408; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G06310 | AT5G06310.1 | TTATTGGGCCTTTAA | Encodes AtPOT1b. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b. |
| AT5G06340 | AT5G06340.1 | AAATGGGCCCAATA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink). |
| AT5G07090 | AT5G07090.1 | ATAAGCCCAATAA | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT5G07090.2 | ATAAGCCCAATAA | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT5G07120 | AT5G07120.1 | ATATTGGGCTGGGCTGGGC | SORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT5G08060 | AT5G08060.1 | TATTGGGCCTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G08280 | AT5G08280.1 | CCGGCCCAATAA | Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. |
| AT5G08290 | AT5G08290.1 | TTATTGGGCCGG | Encodes Dim1 homolog. |
| AT5G08415 | AT5G08415.1 | TATTGGGCT | lipoic acid synthase family protein; FUNCTIONS IN: lipoic acid synthase activity, iron-sulfur cluster binding, lipoate synthase activity, catalytic activity; INVOLVED IN: lipoic acid biosynthetic process, lipoate biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Lipoate synthase (InterPro:IPR003698), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: LIP1 (LIPOIC ACID SYNTHASE 1); lipoic acid synthase (TAIR:AT2G20860.1); Has 5746 Blast hits to 5746 proteins in 1192 species: Archae - 36; Bacteria - 2422; Metazoa - 113; Fungi - 91; Plants - 53; Viruses - 0; Other Eukaryotes - 3031 (source: NCBI BLink). |
| AT5G08415.1 | TTGGCCCAATAT | lipoic acid synthase family protein; FUNCTIONS IN: lipoic acid synthase activity, iron-sulfur cluster binding, lipoate synthase activity, catalytic activity; INVOLVED IN: lipoic acid biosynthetic process, lipoate biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Lipoate synthase (InterPro:IPR003698), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: LIP1 (LIPOIC ACID SYNTHASE 1); lipoic acid synthase (TAIR:AT2G20860.1); Has 5746 Blast hits to 5746 proteins in 1192 species: Archae - 36; Bacteria - 2422; Metazoa - 113; Fungi - 91; Plants - 53; Viruses - 0; Other Eukaryotes - 3031 (source: NCBI BLink). |
| AT5G08420 | AT5G08420.1 | AGCCCAATA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); Has 2056 Blast hits to 1575 proteins in 229 species: Archae - 85; Bacteria - 30; Metazoa - 600; Fungi - 242; Plants - 75; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). |
| AT5G08420.1 | ATATTGGGCCAA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); Has 2056 Blast hits to 1575 proteins in 229 species: Archae - 85; Bacteria - 30; Metazoa - 600; Fungi - 242; Plants - 75; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). |
| AT5G09880 | AT5G09880.1 | CTATTGGGCCCATCA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G16940.1); Has 75114 Blast hits to 36610 proteins in 1254 species: Archae - 65; Bacteria - 4369; Metazoa - 40620; Fungi - 8054; Plants - 5837; Viruses - 419; Other Eukaryotes - 15750 (source: NCBI BLink). |
| AT5G10110 | AT5G10110.1 | CTATTGGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10350 | AT5G10350.1 | GAGGCCCAATA | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10350.2 | GAGGCCCAATA | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10690 | AT5G10690.1 | ATATTGGGCTTTAA | pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12775.1); Has 9217 Blast hits to 4059 proteins in 145 species: Archae - 2; Bacteria - 6; Metazoa - 124; Fungi - 115; Plants - 8658; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink). |
| AT5G10695 | AT5G10695.1 | TTAAAGCCCAATAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10910 | AT5G10910.1 | ATATTGGGCCGGCCCATAT | mraW methylase family protein; FUNCTIONS IN: methyltransferase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial methyltransferase (InterPro:IPR002903); Has 5437 Blast hits to 5435 proteins in 1466 species: Archae - 0; Bacteria - 2709; Metazoa - 101; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2607 (source: NCBI BLink). |
| AT5G11330 | AT5G11330.1 | ATATTGGGCCTGG | monooxygenase family protein; FUNCTIONS IN: oxidoreductase activity, monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: CTF2B; monooxygenase/ oxidoreductase (TAIR:AT2G29720.1); Has 2280 Blast hits to 2280 proteins in 460 species: Archae - 2; Bacteria - 1124; Metazoa - 4; Fungi - 594; Plants - 114; Viruses - 0; Other Eukaryotes - 442 (source: NCBI BLink). |
| AT5G11330.1 | CTATTGGGCCTATA | monooxygenase family protein; FUNCTIONS IN: oxidoreductase activity, monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: CTF2B; monooxygenase/ oxidoreductase (TAIR:AT2G29720.1); Has 2280 Blast hits to 2280 proteins in 460 species: Archae - 2; Bacteria - 1124; Metazoa - 4; Fungi - 594; Plants - 114; Viruses - 0; Other Eukaryotes - 442 (source: NCBI BLink). |
| AT5G11340 | AT5G11340.1 | CCAGGCCCAATAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT5G16800.2); Has 2784 Blast hits to 2784 proteins in 681 species: Archae - 121; Bacteria - 1284; Metazoa - 435; Fungi - 175; Plants - 77; Viruses - 0; Other Eukaryotes - 692 (source: NCBI BLink). |
| AT5G11340.1 | TATAGGCCCAATAG | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT5G16800.2); Has 2784 Blast hits to 2784 proteins in 681 species: Archae - 121; Bacteria - 1284; Metazoa - 435; Fungi - 175; Plants - 77; Viruses - 0; Other Eukaryotes - 692 (source: NCBI BLink). |
| AT5G12290 | AT5G12290.1 | TACTGGGCCCATTAAAAGCCCAATAAG | Encodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background. |
| AT5G12410 | AT5G12410.1 | CAAGCCCAATAGGCCCATTC | THUMP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: THUMP (InterPro:IPR004114); Has 2926 Blast hits to 1988 proteins in 205 species: Archae - 10; Bacteria - 67; Metazoa - 1296; Fungi - 226; Plants - 118; Viruses - 74; Other Eukaryotes - 1135 (source: NCBI BLink). |
| AT5G13070 | AT5G13070.1 | TTAAAGCCCAATAA | MSF1-like family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PRELI/MSF1 (InterPro:IPR006797); Has 651 Blast hits to 651 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 458; Fungi - 150; Plants - 18; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT5G13190 | AT5G13190.1 | ATTAGGCCTTTTGAGCCCAATAT | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LPS-induced tumor necrosis factor alpha factor (InterPro:IPR006629); Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13310 | AT5G13310.1 | ATATTGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13970.1); Has 356 Blast hits to 305 proteins in 95 species: Archae - 0; Bacteria - 44; Metazoa - 138; Fungi - 38; Plants - 34; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT5G13370 | AT5G13370.1 | AAAAGCCCAATAA | auxin-responsive GH3 family protein; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: auxin-responsive GH3 family protein (TAIR:AT5G13360.2); Has 819 Blast hits to 760 proteins in 112 species: Archae - 0; Bacteria - 241; Metazoa - 51; Fungi - 2; Plants - 219; Viruses - 0; Other Eukaryotes - 306 (source: NCBI BLink). |
| AT5G13370.1 | CAAGGCCCAATAT | auxin-responsive GH3 family protein; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: auxin-responsive GH3 family protein (TAIR:AT5G13360.2); Has 819 Blast hits to 760 proteins in 112 species: Archae - 0; Bacteria - 241; Metazoa - 51; Fungi - 2; Plants - 219; Viruses - 0; Other Eukaryotes - 306 (source: NCBI BLink). |
| AT5G13450 | AT5G13450.1 | ATAAGCCCAATAA | ATP synthase delta chain, mitochondrial, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: mitochondrion, chloroplast, plasma membrane, membrane, mitochondrial proton-transporting ATP synthase complex, catalytic core F(1); EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); BEST Arabidopsis thaliana protein match is: ATPD (ATP SYNTHASE DELTA-SUBUNIT GENE); hydrogen ion transporting ATP synthase, rotational mechanism / proton-transporting ATPase, rotational mechanism (TAIR:AT4G09650.1); Has 3881 Blast hits to 3881 proteins in 1167 species: Archae - 0; Bacteria - 1909; Metazoa - 184; Fungi - 93; Plants - 120; Viruses - 0; Other Eukaryotes - 1575 (source: NCBI BLink). |
| AT5G13450.2 | ATAAGCCCAATAA | ATP synthase delta chain, mitochondrial, putative / H(+)-transporting two-sector ATPase, delta (OSCP) subunit, putative; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: mitochondrion, chloroplast, plasma membrane, membrane, mitochondrial proton-transporting ATP synthase complex, catalytic core F(1); EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); BEST Arabidopsis thaliana protein match is: ATPD (ATP SYNTHASE DELTA-SUBUNIT GENE); hydrogen ion transporting ATP synthase, rotational mechanism / proton-transporting ATPase, rotational mechanism (TAIR:AT4G09650.1); Has 3881 Blast hits to 3881 proteins in 1167 species: Archae - 0; Bacteria - 1909; Metazoa - 184; Fungi - 93; Plants - 120; Viruses - 0; Other Eukaryotes - 1575 (source: NCBI BLink). |
| AT5G13610 | AT5G13610.1 | TTATTGGGCCTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF155 (InterPro:IPR003734); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69380.1); Has 361 Blast hits to 361 proteins in 152 species: Archae - 0; Bacteria - 121; Metazoa - 21; Fungi - 154; Plants - 33; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G13700 | AT5G13700.1 | TTATTGGGCTTTA | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT5G13730 | AT5G13730.1 | TTATTGGGCCTTTT | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
| AT5G13970 | AT5G13970.1 | ATAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13310.1); Has 608 Blast hits to 543 proteins in 119 species: Archae - 2; Bacteria - 47; Metazoa - 119; Fungi - 63; Plants - 38; Viruses - 17; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT5G14050 | AT5G14050.1 | GGGCTTTATTGGGC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink). |
| AT5G14200 | AT5G14200.1 | CGGCCCAATAT | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G14200.2 | CGGCCCAATAT | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G14200.3 | CGGCCCAATAT | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT5G14430 | AT5G14430.1 | ATAAAGCCCAATAAG | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT5G14430.1 | ATAAAGCCCAATAT | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT5G14430.2 | ATAAAGCCCAATAAG | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT5G14430.2 | ATAAAGCCCAATAT | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT5G14440 | AT5G14440.1 | TTATTGGGCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). |
| AT5G14440.2 | TTATTGGGCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). |
| AT5G14610 | AT5G14610.1 | TAAGCCCAATAAG | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / protein binding; FUNCTIONS IN: protein binding, helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), WW/Rsp5/WWP (InterPro:IPR001202), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DRH1 (DEAD BOX RNA HELICASE 1); ATP-dependent RNA helicase/ ATPase (TAIR:AT3G01540.4); Has 52477 Blast hits to 39251 proteins in 1971 species: Archae - 612; Bacteria - 22224; Metazoa - 10881; Fungi - 4675; Plants - 4189; Viruses - 260; Other Eukaryotes - 9636 (source: NCBI BLink). |
| AT5G15200 | AT5G15200.1 | TAAAGGCCCAATAA | 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT5G15200.1 | TAAAGGCCCAATATAAAGCC | 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT5G15200.1 | TCAAAACGGGCCCAATATAAAGCC | 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT5G15200.2 | TAAAGGCCCAATAA | 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT5G15200.2 | TAAAGGCCCAATATAAAGCC | 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT5G15200.2 | TCAAAACGGGCCCAATATAAAGCC | 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT5G15320 | AT5G15320.1 | AGAGGCCCATTTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G15320.2 | AGAGGCCCATTTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16550 | AT5G16550.1 | CAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G16940 | AT5G16940.1 | ATATTGGGCCCAATAA | carbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink). |
| AT5G16940.2 | ATATTGGGCCCAATAA | carbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink). |
| AT5G16950 | AT5G16950.1 | TTATTGGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17870 | AT5G17870.1 | CAAAGGCCCAATAAAAAAGCCCA | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
| AT5G17870.1 | CAAAGGCCCAATAG | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
| AT5G17900 | AT5G17900.1 | ATAGGCCCATGAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink). |
| AT5G18140 | AT5G18140.1 | CAAGCCCAATAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G22360.1); Has 15420 Blast hits to 15415 proteins in 1898 species: Archae - 116; Bacteria - 5110; Metazoa - 3216; Fungi - 1289; Plants - 1204; Viruses - 8; Other Eukaryotes - 4477 (source: NCBI BLink). |
| AT5G18790 | AT5G18790.1 | ATATTGGGCCTATT | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT3G06320.1); Has 1786 Blast hits to 1786 proteins in 750 species: Archae - 0; Bacteria - 1570; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT5G18800 | AT5G18800.1 | AATAGGCCCAATAT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 73; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G18800.2 | AATAGGCCCAATAT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 73; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G19300 | AT5G19300.1 | AATAGGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Protein of unknown function DUF171 (InterPro:IPR003750); Has 4766 Blast hits to 2044 proteins in 217 species: Archae - 72; Bacteria - 102; Metazoa - 2264; Fungi - 372; Plants - 195; Viruses - 4; Other Eukaryotes - 1757 (source: NCBI BLink). |
| AT5G20850 | AT5G20850.1 | GCCTTTAAAGCCCAATAT | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation. |
| AT5G22140 | AT5G22140.1 | CAAAGGCCCAATAG | pyridine nucleotide-disulphide oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327); BEST Arabidopsis thaliana protein match is: pyridine nucleotide-disulphide oxidoreductase family protein (TAIR:AT3G44190.1); Has 8697 Blast hits to 8694 proteins in 1406 species: Archae - 266; Bacteria - 6387; Metazoa - 242; Fungi - 449; Plants - 207; Viruses - 0; Other Eukaryotes - 1146 (source: NCBI BLink). |
| AT5G22140.2 | CAAAGGCCCAATAG | pyridine nucleotide-disulphide oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327); BEST Arabidopsis thaliana protein match is: pyridine nucleotide-disulphide oxidoreductase family protein (TAIR:AT3G44190.1); Has 8697 Blast hits to 8694 proteins in 1406 species: Archae - 266; Bacteria - 6387; Metazoa - 242; Fungi - 449; Plants - 207; Viruses - 0; Other Eukaryotes - 1146 (source: NCBI BLink). |
| AT5G22350 | AT5G22350.1 | ATATTGGGCCTAC | ELONGATED MITOCHONDRIA 1 (ELM1); INVOLVED IN: mitochondrial fission, protein localization in organelle; LOCATED IN: mitochondrial outer membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1022 (InterPro:IPR009367); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06180.2); Has 1314 Blast hits to 1314 proteins in 78 species: Archae - 0; Bacteria - 145; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 1141 (source: NCBI BLink). |
| AT5G22620 | AT5G22620.1 | CTATTGGGCCTG | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase (InterPro:IPR001345); Has 7256 Blast hits to 7163 proteins in 1237 species: Archae - 46; Bacteria - 4441; Metazoa - 577; Fungi - 226; Plants - 90; Viruses - 0; Other Eukaryotes - 1876 (source: NCBI BLink). |
| AT5G22620.2 | CTATTGGGCCTG | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase (InterPro:IPR001345); Has 7256 Blast hits to 7163 proteins in 1237 species: Archae - 46; Bacteria - 4441; Metazoa - 577; Fungi - 226; Plants - 90; Viruses - 0; Other Eukaryotes - 1876 (source: NCBI BLink). |
| AT5G22875 | AT5G22875.1 | AGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G22875.1 | TTAGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G22875.2 | AGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G22875.2 | TTAGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G22950 | AT5G22950.1 | AAAAGGCCCAATAT | VPS24.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS24.2 (TAIR:AT3G45000.1); Has 1310 Blast hits to 1309 proteins in 191 species: Archae - 14; Bacteria - 29; Metazoa - 586; Fungi - 224; Plants - 254; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink). |
| AT5G23230 | AT5G23230.1 | ATTGGCCCAATAAG | NICOTINAMIDASE 2 (NIC2); FUNCTIONS IN: nicotinamidase activity, catalytic activity; INVOLVED IN: NAD metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); BEST Arabidopsis thaliana protein match is: NIC3 (NICOTINAMIDASE 3); catalytic/ nicotinamidase (TAIR:AT5G23220.1); Has 4281 Blast hits to 4279 proteins in 809 species: Archae - 137; Bacteria - 3598; Metazoa - 0; Fungi - 94; Plants - 51; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink). |
| AT5G23395 | AT5G23395.1 | CAAGCCCAATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); Has 224 Blast hits to 224 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 94; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G23900 | AT5G23900.1 | ATAAGCCCAATAA | 60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 98; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT5G24640 | AT5G24640.1 | TAAAAGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41730.1); Has 13 Blast hits to 13 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G24650 | AT5G24650.1 | TAAAAGCCCAATAT | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G24650.1 | TGAGGCCCAATAA | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G24710 | AT5G24710.1 | TTATTGGGCCTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 46946 Blast hits to 23834 proteins in 1336 species: Archae - 160; Bacteria - 9572; Metazoa - 15324; Fungi - 6794; Plants - 1938; Viruses - 1106; Other Eukaryotes - 12052 (source: NCBI BLink). |
| AT5G24760 | AT5G24760.1 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink). |
| AT5G24760.2 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink). |
| AT5G24760.3 | AAAAAGCCCAATAA | alcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink). |
| AT5G24810 | AT5G24810.1 | TTGGGCTTATTGGGCCCATAA | ABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink). |
| AT5G26742 | AT5G26742.1 | AGCCCAATAACGGCCCACTA | embryo defective 1138 (emb1138); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), GUCT (InterPro:IPR012562), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, CCHC-type (InterPro:IPR001878), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: PMH2 (putative mitochondrial RNA helicase 2); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT3G22330.1); Has 41664 Blast hits to 39827 proteins in 1977 species: Archae - 837; Bacteria - 17695; Metazoa - 6892; Fungi - 3987; Plants - 1854; Viruses - 126; Other Eukaryotes - 10273 (source: NCBI BLink). |
| AT5G26742.2 | AGCCCAATAACGGCCCACTA | embryo defective 1138 (emb1138); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), GUCT (InterPro:IPR012562), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, CCHC-type (InterPro:IPR001878), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: PMH2 (putative mitochondrial RNA helicase 2); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT3G22330.1); Has 41664 Blast hits to 39827 proteins in 1977 species: Archae - 837; Bacteria - 17695; Metazoa - 6892; Fungi - 3987; Plants - 1854; Viruses - 126; Other Eukaryotes - 10273 (source: NCBI BLink). |
| AT5G35400 | AT5G35400.1 | AAAAGGCCCAATAA | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 4676 Blast hits to 4649 proteins in 1359 species: Archae - 66; Bacteria - 2736; Metazoa - 98; Fungi - 50; Plants - 81; Viruses - 0; Other Eukaryotes - 1645 (source: NCBI BLink). |
| AT5G35400.1 | ATATTGGGCTC | tRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 4676 Blast hits to 4649 proteins in 1359 species: Archae - 66; Bacteria - 2736; Metazoa - 98; Fungi - 50; Plants - 81; Viruses - 0; Other Eukaryotes - 1645 (source: NCBI BLink). |
| AT5G38160 | AT5G38160.1 | AGCCCATATTAGGCCCAATAA | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G38170.1); Has 193 Blast hits to 190 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 193; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G38380 | AT5G38380.1 | AAGGCCCAATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 90 Blast hits to 90 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G38380.2 | AAGGCCCAATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 90 Blast hits to 90 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 66; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G38580 | AT5G38580.1 | GCCCAATAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G38570.1); Has 225 Blast hits to 219 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 225; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G40010 | AT5G40010.1 | TATTGGGC | AAA-ATPase 1 (AATP1); FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: stem, inflorescence meristem, flower, root, stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT3G28580.1); Has 31876 Blast hits to 20429 proteins in 1746 species: Archae - 754; Bacteria - 4743; Metazoa - 10542; Fungi - 3311; Plants - 1681; Viruses - 199; Other Eukaryotes - 10646 (source: NCBI BLink). |
| AT5G40200 | AT5G40200.1 | GAAGCCCAATAT | Encodes a putative DegP protease. |
| AT5G40200.1 | TTATTGGGCCTAAC | Encodes a putative DegP protease. |
| AT5G40370 | AT5G40370.1 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink). |
| AT5G40370.2 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink). |
| AT5G40770 | AT5G40770.1 | ATATTGGGCTAA | prohibitin 3 |
| AT5G42270 | AT5G42270.1 | CAGGCCCAATAAG | VAR1 contains a conserved motif for ATPase and a metalloprotease characteristic to FtsH proteins, and is targeted into chloroplasts. A VAR1-fusion protein synthesized in vitro exhibited ATPase activity and partial metalloprotease activity. This protein is located to the thylakoid membrane and forms a complex with VAR2. FtsH1 (VAR1) and FtsH5 are interchangeable in thylakoid membranes. |
| AT5G42740 | AT5G42740.1 | TATTGGGC | glucose-6-phosphate isomerase, cytosolic (PGIC); FUNCTIONS IN: glucose-6-phosphate isomerase activity; INVOLVED IN: response to cadmium ion, gluconeogenesis, glycolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglucose isomerase, conserved site (InterPro:IPR018189), Phosphoglucose isomerase (PGI) (InterPro:IPR001672); BEST Arabidopsis thaliana protein match is: PGI1 (PHOSPHOGLUCOSE ISOMERASE 1); glucose-6-phosphate isomerase (TAIR:AT4G24620.2); Has 7416 Blast hits to 7411 proteins in 2035 species: Archae - 34; Bacteria - 3763; Metazoa - 548; Fungi - 156; Plants - 870; Viruses - 0; Other Eukaryotes - 2045 (source: NCBI BLink). |
| AT5G42790 | AT5G42790.1 | TTAGCCCAATAAG | encodes a protein with extensive homology to the largest subunit of the multicatalytic proteinase complex (proteasome) |
| AT5G43260 | AT5G43260.1 | AGCCCAATAA | chaperone protein dnaJ-related; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 66 Blast hits to 65 proteins in 21 species: Archae - 0; Bacteria - 15; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G44440 | AT5G44440.1 | TATTGGGC | FAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, petal, sepal, flower, pedicel; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT5G44410.1); Has 3215 Blast hits to 3107 proteins in 522 species: Archae - 13; Bacteria - 1477; Metazoa - 1; Fungi - 1131; Plants - 356; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink). |
| AT5G44785 | AT5G44785.1 | AACGGCCCAATAA | ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3 (OSB3); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: PTAC9 (PLASTID TRANSCRIPTIONALLY ACTIVE 9); single-stranded DNA binding (TAIR:AT4G20010.2); Has 170 Blast hits to 86 proteins in 15 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT5G44785.2 | AACGGCCCAATAA | ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3 (OSB3); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: PTAC9 (PLASTID TRANSCRIPTIONALLY ACTIVE 9); single-stranded DNA binding (TAIR:AT4G20010.2); Has 170 Blast hits to 86 proteins in 15 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT5G45390 | AT5G45390.1 | AATAGGCCAGGGCCCAATAAACCGT | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT5G45680 | AT5G45680.1 | ATATTGGGCCTGT | FK506-binding protein 1 (FKBP13); FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT4G39710.1); Has 6942 Blast hits to 6551 proteins in 1120 species: Archae - 86; Bacteria - 3279; Metazoa - 1434; Fungi - 355; Plants - 420; Viruses - 0; Other Eukaryotes - 1368 (source: NCBI BLink). |
| AT5G46750 | AT5G46750.1 | TTATTGGGCCATACAAGCCCAT | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT5G47010 | AT5G47010.1 | TAATTGGGCCCAATAT | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. |
| AT5G47320 | AT5G47320.1 | CTTATTGGGCT | Nuclear encoded mitochondrial ribosome subunit. |
| AT5G47435 | AT5G47435.1 | CTTATTGGGCCCATTT | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. |
| AT5G47435.2 | CTTATTGGGCCCATTT | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. |
| AT5G47630 | AT5G47630.1 | TTAAAGCCCAATAA | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. |
| AT5G47630.2 | TTAAAGCCCAATAA | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. |
| AT5G47700 | AT5G47700.1 | CAAAGCCCAATAA | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink). |
| AT5G47700.1 | GCCCAATA | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink). |
| AT5G47700.2 | CAAAGCCCAATAA | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink). |
| AT5G47700.2 | GCCCAATA | 60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink). |
| AT5G48580 | AT5G48580.1 | CTAGGCCCAATAAG | immunophilin (FKBP15-2) |
| AT5G48730 | AT5G48730.1 | ATTTGGGCCTGGCCCAATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13431 Blast hits to 4993 proteins in 158 species: Archae - 3; Bacteria - 10; Metazoa - 241; Fungi - 171; Plants - 12464; Viruses - 0; Other Eukaryotes - 542 (source: NCBI BLink). |
| AT5G49200 | AT5G49200.1 | TAAGCCCAATAG | WD-40 repeat family protein / zfwd4 protein (ZFWD4); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / zfwd3 protein (ZFWD3) (TAIR:AT5G40880.1); Has 25041 Blast hits to 14412 proteins in 471 species: Archae - 20; Bacteria - 3252; Metazoa - 10699; Fungi - 5302; Plants - 2300; Viruses - 0; Other Eukaryotes - 3468 (source: NCBI BLink). |
| AT5G49220 | AT5G49220.1 | AAAAAGCCCAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16100.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G49510 | AT5G49510.1 | ATAGGCCCAATAG | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G49510.2 | ATAGGCCCAATAG | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G49930 | AT5G49930.1 | ATATTGGGCTTATAGGCCC | embryo defective 1441 (emb1441); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Fibronectin-binding A, N-terminal (InterPro:IPR008616), Zinc finger, CCHC-type (InterPro:IPR001878), Protein of unknown function DUF814 (InterPro:IPR008532); Has 2906 Blast hits to 2454 proteins in 381 species: Archae - 144; Bacteria - 336; Metazoa - 995; Fungi - 294; Plants - 92; Viruses - 7; Other Eukaryotes - 1038 (source: NCBI BLink). |
| AT5G49950 | AT5G49950.1 | CTTATTGGGCCTCA | embryogenesis-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT1G34340.1); Has 1634 Blast hits to 1634 proteins in 564 species: Archae - 0; Bacteria - 851; Metazoa - 297; Fungi - 122; Plants - 62; Viruses - 0; Other Eukaryotes - 302 (source: NCBI BLink). |
| AT5G50240 | AT5G50240.3 | TTATTGGGCCTATAAAAGCCCATTTA | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
| AT5G50250 | AT5G50250.1 | GTAAGGCCCAATAA | Encodes a RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT5G50810 | AT5G50810.1 | TTGGCCCAATAAG | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
| AT5G52070 | AT5G52070.1 | AGCCCAATAG | agenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT5G42670.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G52440 | AT5G52440.1 | TCAGGCCCAATAA | HCF106; nuclear gene for chloroplast. Thylakoid membrane delta pH translocation pathway component protein; related to Escherichia coli TatA and TatB |
| AT5G52440.1 | TTTAACGGCCCAATAT | HCF106; nuclear gene for chloroplast. Thylakoid membrane delta pH translocation pathway component protein; related to Escherichia coli TatA and TatB |
| AT5G52990 | AT5G52990.1 | CTATTGGGCT | vesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G53400 | AT5G53400.1 | GTTGGGCCTTATTGGGCTC | nuclear movement family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: nuclear movement family protein (TAIR:AT4G27890.1); Has 1930 Blast hits to 1478 proteins in 221 species: Archae - 7; Bacteria - 113; Metazoa - 767; Fungi - 136; Plants - 100; Viruses - 4; Other Eukaryotes - 803 (source: NCBI BLink). |
| AT5G53450 | AT5G53450.1 | GTGGCCCAATAAGGCCCAATG | OBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT5G53450.2 | GTGGCCCAATAAGGCCCAATG | OBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink). |
| AT5G53620 | AT5G53620.1 | TCAGCCCAATAGGCCCAACA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.1 | TCAGCCCAATAGGCCCGT | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.2 | TCAGCCCAATAGGCCCAACA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.2 | TCAGCCCAATAGGCCCGT | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.3 | TCAGCCCAATAGGCCCAACA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G53620.3 | TCAGCCCAATAGGCCCGT | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). |
| AT5G54080 | AT5G54080.1 | CAAGCCCAATAG | homogentisate 1,2-dioxygenase |
| AT5G54080.2 | CAAGCCCAATAG | homogentisate 1,2-dioxygenase |
| AT5G54920 | AT5G54920.1 | CAAAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26990.1); Has 233 Blast hits to 205 proteins in 59 species: Archae - 0; Bacteria - 3; Metazoa - 116; Fungi - 29; Plants - 67; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G54920.1 | CTAGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26990.1); Has 233 Blast hits to 205 proteins in 59 species: Archae - 0; Bacteria - 3; Metazoa - 116; Fungi - 29; Plants - 67; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G54920.2 | CAAAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26990.1); Has 233 Blast hits to 205 proteins in 59 species: Archae - 0; Bacteria - 3; Metazoa - 116; Fungi - 29; Plants - 67; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G54920.2 | CTAGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26990.1); Has 233 Blast hits to 205 proteins in 59 species: Archae - 0; Bacteria - 3; Metazoa - 116; Fungi - 29; Plants - 67; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT5G55000 | AT5G55000.1 | TATTGGGCTTTAA | FH protein interacting protein FIP2 |
| AT5G55000.2 | TATTGGGCTTTAA | FH protein interacting protein FIP2 |
| AT5G55610 | AT5G55610.1 | TTATTGGGCCTTATATGGG | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55610.2 | TTATTGGGCCTTATATGGG | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G56670 | AT5G56670.1 | ATAAAGCCCAATAG | 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT5G56670.1 | TATGGGCCCATAAAGCCCAATAT | 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT5G57460 | AT5G57460.1 | ATTAGGCCCAATAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G57460.1 | CTATTGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G57460.1 | TTATTGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to 121 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G57815 | AT5G57815.1 | TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G57860 | AT5G57860.1 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G57860.2 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G57860.3 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G57860.4 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G57950 | AT5G57950.1 | CTATTGGGCCTTTT | 26S proteasome regulatory subunit, putative; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular signaling cascade; LOCATED IN: proteasome regulatory particle; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PDZ/DHR/GLGF (InterPro:IPR001478); Has 352 Blast hits to 352 proteins in 164 species: Archae - 0; Bacteria - 46; Metazoa - 112; Fungi - 85; Plants - 23; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT5G58240 | AT5G58240.1 | ATGGCCCAATAAG | Encodes a Fhit protein. Has nucleoside phosphoramidase and adenylylsulfatase activities. |
| AT5G58240.2 | ATGGCCCAATAAG | Encodes a Fhit protein. Has nucleoside phosphoramidase and adenylylsulfatase activities. |
| AT5G58250 | AT5G58250.1 | CTTATTGGGCCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 230 Blast hits to 230 proteins in 64 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink). |
| AT5G58330 | AT5G58330.1 | TTATTGGGCCTTAACTGGGCCTAAAAGTCAA | malate dehydrogenase (NADP), chloroplast, putative; FUNCTIONS IN: oxidoreductase activity, binding, malate dehydrogenase activity, catalytic activity, malate dehydrogenase (NADP+) activity; INVOLVED IN: malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), Malate dehydrogenase, NADP-dependent, plants (InterPro:IPR011273), NAD(P)-binding (InterPro:IPR016040), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G56720.1); Has 6543 Blast hits to 6543 proteins in 1476 species: Archae - 77; Bacteria - 3514; Metazoa - 459; Fungi - 108; Plants - 380; Viruses - 0; Other Eukaryotes - 2005 (source: NCBI BLink). |
| AT5G58330.2 | TTATTGGGCCTTAACTGGGCCTAAAAGTCAA | malate dehydrogenase (NADP), chloroplast, putative; FUNCTIONS IN: oxidoreductase activity, binding, malate dehydrogenase activity, catalytic activity, malate dehydrogenase (NADP+) activity; INVOLVED IN: malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), Malate dehydrogenase, NADP-dependent, plants (InterPro:IPR011273), NAD(P)-binding (InterPro:IPR016040), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G56720.1); Has 6543 Blast hits to 6543 proteins in 1476 species: Archae - 77; Bacteria - 3514; Metazoa - 459; Fungi - 108; Plants - 380; Viruses - 0; Other Eukaryotes - 2005 (source: NCBI BLink). |
| AT5G58330.3 | TTATTGGGCCTTAACTGGGCCTAAAAGTCAA | malate dehydrogenase (NADP), chloroplast, putative; FUNCTIONS IN: oxidoreductase activity, binding, malate dehydrogenase activity, catalytic activity, malate dehydrogenase (NADP+) activity; INVOLVED IN: malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), Malate dehydrogenase, NADP-dependent, plants (InterPro:IPR011273), NAD(P)-binding (InterPro:IPR016040), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G56720.1); Has 6543 Blast hits to 6543 proteins in 1476 species: Archae - 77; Bacteria - 3514; Metazoa - 459; Fungi - 108; Plants - 380; Viruses - 0; Other Eukaryotes - 2005 (source: NCBI BLink). |
| AT5G58440 | AT5G58440.1 | ATATTGGGCTTT | SORTING NEXIN 2a (SNX2a); FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2b (SORTING NEXIN 2b); phosphoinositide binding / protein binding (TAIR:AT5G07120.1); Has 1775 Blast hits to 1763 proteins in 175 species: Archae - 7; Bacteria - 6; Metazoa - 1144; Fungi - 391; Plants - 81; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT5G58800 | AT5G58800.1 | TTATTGGGCTTG | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). |
| AT5G58800.2 | TTATTGGGCTTG | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). |
| AT5G58920 | AT5G58920.1 | TATAGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59560 | AT5G59560.1 | AGCCCAATA | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling. |
| AT5G59560.1 | TTATTGGGCCGTA | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling. |
| AT5G59560.2 | AGCCCAATA | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling. |
| AT5G59560.2 | TTATTGGGCCGTA | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling. |
| AT5G59613 | AT5G59613.1 | CTTATTGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial respiratory chain complex III; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46430.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G60790 | AT5G60790.1 | CTTATTGGGCCTTTAA | member of GCN subfamily |
| AT5G61450 | AT5G61450.1 | ATATTGGGCT | 2-phosphoglycerate kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; Has 393 Blast hits to 372 proteins in 106 species: Archae - 58; Bacteria - 24; Metazoa - 63; Fungi - 40; Plants - 52; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). |
| AT5G61790 | AT5G61790.1 | ATGGCCCAGGCCCAATAA | calnexin 1 (CNX1); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin, putative (TAIR:AT5G07340.1); Has 1344 Blast hits to 1252 proteins in 297 species: Archae - 2; Bacteria - 61; Metazoa - 623; Fungi - 137; Plants - 191; Viruses - 36; Other Eukaryotes - 294 (source: NCBI BLink). |
| AT5G62300 | AT5G62300.1 | TTATTGGGCTGA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). |
| AT5G62300.2 | TTATTGGGCTGA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). |
| AT5G62810 | AT5G62810.1 | GTAGGCCCAATAA | mutant has a defect in the intracellular transport of thiolase from the cytosol to glyoxysomes (formerly known as ped2) |
| AT5G63280 | AT5G63280.1 | ATTGGGCCTAGCCCAGCCCAATAA | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT5G40710.1); Has 77 Blast hits to 75 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 44; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT5G63510 | AT5G63510.1 | CCGTTAAAAAGCCCAATAT | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT5G63510.1 | TTATTGGGCCTGT | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT5G63670 | AT5G63670.1 | TAAAAGCCCAAATACGGCCCAATAA | SPT4 HOMOLOG 2 (SPT42); FUNCTIONS IN: positive transcription elongation factor activity, zinc ion binding; INVOLVED IN: positive regulation of transcription, N-terminal protein myristoylation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation Spt4 (InterPro:IPR009287), Transcription initiation Spt4-like (InterPro:IPR016046); BEST Arabidopsis thaliana protein match is: positive transcription elongation factor/ zinc ion binding (TAIR:AT5G08565.1); Has 324 Blast hits to 324 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 119; Plants - 27; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT5G64270 | AT5G64270.1 | TATTGGGCTTC | splicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink). |
| AT5G64370 | AT5G64370.1 | TAAAGCCCAATAA | PYD3 encodes a beta-ureidopropionase which, when expressed in E. coli, has been shown to convert beta-ureidopropionate into beta-alanine. |
| AT5G64650 | AT5G64650.1 | TTATTGGGCT | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5414 Blast hits to 5398 proteins in 1517 species: Archae - 0; Bacteria - 3033; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT5G65650 | AT5G65650.1 | TTATTGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G36660.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G65720 | AT5G65720.1 | TATTGGGC | cysteine desulfurase whose activity is dependent on AtSufE activation. |
| AT5G65720.2 | TATTGGGC | cysteine desulfurase whose activity is dependent on AtSufE activation. |
| AT5G65750 | AT5G65750.1 | GTTGGGCCTAAAAGCCCAATAT | 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, oxoglutarate dehydrogenase (succinyl-transferring) activity, thiamin pyrophosphate binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative (TAIR:AT3G55410.1); Has 8716 Blast hits to 8694 proteins in 1114 species: Archae - 2; Bacteria - 2389; Metazoa - 550; Fungi - 187; Plants - 68; Viruses - 0; Other Eukaryotes - 5520 (source: NCBI BLink). |
| AT5G65750.1 | TTTTGGGCCGATAAGCCCAATAT | 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, oxoglutarate dehydrogenase (succinyl-transferring) activity, thiamin pyrophosphate binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative (TAIR:AT3G55410.1); Has 8716 Blast hits to 8694 proteins in 1114 species: Archae - 2; Bacteria - 2389; Metazoa - 550; Fungi - 187; Plants - 68; Viruses - 0; Other Eukaryotes - 5520 (source: NCBI BLink). |
| AT5G65940 | AT5G65940.1 | ATAAGGCCCAATAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65940.2 | ATAAGGCCCAATAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65940.3 | ATAAGGCCCAATAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65960 | AT5G65960.1 | TATTGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 294 Blast hits to 294 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 21; Plants - 119; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT5G66080 | AT5G66080.1 | CAAAGCCCAATAAG | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3605 Blast hits to 3604 proteins in 217 species: Archae - 0; Bacteria - 11; Metazoa - 1260; Fungi - 366; Plants - 1225; Viruses - 5; Other Eukaryotes - 738 (source: NCBI BLink). |
| AT5G66090 | AT5G66090.1 | CTTATTGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G66280 | AT5G66280.1 | ATAAGCCCAATAA | GDP-D-mannose 4,6-dehydratase |
| AT5G66280.1 | TTAAAGCCCATCTTGGCCCAATAG | GDP-D-mannose 4,6-dehydratase |
| AT5G66290 | AT5G66290.1 | TGGGCCCAATAAAATGGGCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G66900 | AT5G66900.1 | ATATTGGGCCGTA | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; CONTAINS InterPro DOMAIN/s: Disease resistance, plant (InterPro:IPR014011), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66910.1); Has 22201 Blast hits to 13213 proteins in 513 species: Archae - 34; Bacteria - 1477; Metazoa - 3674; Fungi - 138; Plants - 15962; Viruses - 2; Other Eukaryotes - 914 (source: NCBI BLink). |
| AT5G66930 | AT5G66930.1 | GAAGCCCAATAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445). |
| AT5G66930.2 | GAAGCCCAATAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445). |