| Locus | Gene model | Sequence | Description |
| AT1G01320 | AT1G01320.1 | CTTAGGCCCATTAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G28080.1); Has 10077 Blast hits to 4062 proteins in 343 species: Archae - 100; Bacteria - 2124; Metazoa - 5307; Fungi - 1095; Plants - 343; Viruses - 76; Other Eukaryotes - 1032 (source: NCBI BLink). |
| AT1G01350 | AT1G01350.1 | GGGCCCATTAT | nucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type/C3HC4-type RING finger) family protein (TAIR:AT5G06420.2); Has 684 Blast hits to 680 proteins in 163 species: Archae - 0; Bacteria - 2; Metazoa - 306; Fungi - 148; Plants - 91; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT1G01710 | AT1G01710.1 | TTAATGGGCCTTG | acyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink). |
| AT1G01970 | AT1G01970.1 | ATAATGGGCCATA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: NFD5 (NUCLEAR FUSION DEFECTIVE 5) (TAIR:AT1G19520.1); Has 7256 Blast hits to 3017 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 83; Fungi - 5; Plants - 6997; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink). |
| AT1G01990 | AT1G01990.1 | ATAATGGGCTTTAAAAGGCCTAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G01990.1 | TGAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02080 | AT1G02080.1 | ATAATGGGCTTAT | transcriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink). |
| AT1G02140 | AT1G02140.1 | TAAGCCCATTA | MAGO NASHI (MAGO); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube guidance, sex determination; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mago nashi protein (InterPro:IPR004023); Has 348 Blast hits to 348 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 64; Plants - 47; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT1G02145 | AT1G02145.1 | TAATGGGCTTA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.2 | TAATGGGCTTA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.3 | TAATGGGCTTA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.4 | TAATGGGCTTA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02330 | AT1G02330.1 | ATAATGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink). |
| AT1G02330.1 | ATAATGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink). |
| AT1G03090 | AT1G03090.1 | ATAGGCCCATTAA | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT1G03090.2 | ATAGGCCCATTAA | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT1G03350 | AT1G03350.1 | TGGCCCATTAA | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT4G13110.1); Has 9675 Blast hits to 5119 proteins in 484 species: Archae - 40; Bacteria - 3294; Metazoa - 2852; Fungi - 1070; Plants - 279; Viruses - 71; Other Eukaryotes - 2069 (source: NCBI BLink). |
| AT1G03360 | AT1G03360.1 | TTAATGGGCCA | ARABIDOPSIS THALIANA RIBOSOMAL RNA PROCESSING 4 (ATRRP4); FUNCTIONS IN: RNA binding, exonuclease activity; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), S1, RNA binding (InterPro:IPR003029); Has 443 Blast hits to 443 proteins in 204 species: Archae - 97; Bacteria - 0; Metazoa - 111; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). |
| AT1G03680 | AT1G03680.1 | TTAATGGGCTTTAA | encodes a chloroplast thioredoxin similar to prokaryotic thioredoxins. |
| AT1G03687 | AT1G03687.1 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G03687.2 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G03860 | AT1G03860.1 | ATAATGGGCCTGA | prohibitin 2 |
| AT1G03860.1 | ATAATGGGCTTAG | prohibitin 2 |
| AT1G03860.1 | TAATGGGCCTAAG | prohibitin 2 |
| AT1G03860.2 | ATAATGGGCCTGA | prohibitin 2 |
| AT1G03860.2 | ATAATGGGCTTAG | prohibitin 2 |
| AT1G03860.2 | TAATGGGCCTAAG | prohibitin 2 |
| AT1G03860.3 | ATAATGGGCCTGA | prohibitin 2 |
| AT1G03860.3 | ATAATGGGCTTAG | prohibitin 2 |
| AT1G03860.3 | TAATGGGCCTAAG | prohibitin 2 |
| AT1G04070 | AT1G04070.1 | CTTAATGGGCCTAC | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
| AT1G04080 | AT1G04080.1 | GTAGGCCCATTAAG | PRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink). |
| AT1G04260 | AT1G04260.1 | TTAATGGGCCTTTAA | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors. |
| AT1G04410 | AT1G04410.1 | AGAGGCCCATTAG | malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink). |
| AT1G04420 | AT1G04420.1 | CTAATGGGCCTCT | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink). |
| AT1G04510 | AT1G04510.1 | CTAATGGGCTTC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). |
| AT1G04510.2 | CTAATGGGCTTC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). |
| AT1G04590 | AT1G04590.1 | CTTAATGGGCTA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.1 | TTAATGGGCCAAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.1 | TTAATGGGCCAAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.1 | TTAATGGGCTAA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.2 | CTTAATGGGCTA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.2 | TTAATGGGCCAAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.2 | TTAATGGGCCAAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.2 | TTAATGGGCTAA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04630 | AT1G04630.1 | CTAATGGGCTTAG | maternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G04635 | AT1G04635.1 | CTAAGCCCATTAG | EMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G04790 | AT1G04790.1 | AAAAGGCCCATTAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink). |
| AT1G05190 | AT1G05190.1 | ATAATGGGCCTAG | embryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink). |
| AT1G05190.1 | CTAATGGGCCGT | embryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink). |
| AT1G05190.1 | TAATGGGCCGAA | embryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink). |
| AT1G05350 | AT1G05350.1 | CTAATGGGCTATT | thiF family protein; FUNCTIONS IN: binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor, catalytic activity, cofactor binding; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), UBA/THIF-type NAD/FAD binding fold (InterPro:IPR000594), Molybdenum cofactor biosynthesis, MoeB (InterPro:IPR009036), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: SAE2 (SUMO-ACTIVATING ENZYME 2); SUMO activating enzyme (TAIR:AT2G21470.2); Has 7901 Blast hits to 7756 proteins in 1322 species: Archae - 133; Bacteria - 4223; Metazoa - 801; Fungi - 447; Plants - 189; Viruses - 0; Other Eukaryotes - 2108 (source: NCBI BLink). |
| AT1G07070 | AT1G07070.1 | TATAGGCCCATTAA | 60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT1G07210 | AT1G07210.1 | TCAGCCCATTAT | 30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink). |
| AT1G07210.1 | TGAGCCCATTAT | 30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink). |
| AT1G07400 | AT1G07400.1 | AGCCCATTATAGCCCATAAAACGC | 17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink). |
| AT1G07510 | AT1G07510.1 | GAAGCCCATTAAG | encodes an FtsH protease that is localized to the mitochondrion |
| AT1G07950 | AT1G07950.1 | TAAGCCCATTA | surfeit locus protein 5 family protein / SURF5 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Surfeit locus 5 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: surfeit locus protein 5 family protein / SURF5 family protein (TAIR:AT1G16430.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 139; Fungi - 8; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G07960 | AT1G07960.1 | TAATGGGCTTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G07960.2 | TAATGGGCTTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G07960.3 | TAATGGGCTTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G08280 | AT1G08280.1 | TTAATGGGCTTA | glycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, integral to Golgi membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Sialyltransferase (InterPro:IPR012163), Glycosyl transferase, family 29 (InterPro:IPR001675); Has 1982 Blast hits to 1970 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 1819; Fungi - 0; Plants - 92; Viruses - 14; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT1G08700 | AT1G08700.1 | TTATTGGGCCTAATGGGCT | Encodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation. |
| AT1G08710 | AT1G08710.1 | AGCCCATTAGGCCCAATAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G08710.2 | AGCCCATTAGGCCCAATAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G09140 | AT1G09140.1 | ACAGGCCCATTAA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. |
| AT1G09140.2 | ACAGGCCCATTAA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. |
| AT1G09150 | AT1G09150.1 | TTAATGGGCCTGT | pseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink). |
| AT1G09200 | AT1G09200.1 | TAATGGGCTTG | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10220 Blast hits to 10217 proteins in 5279 species: Archae - 0; Bacteria - 0; Metazoa - 7338; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 576 (source: NCBI BLink). |
| AT1G09660 | AT1G09660.1 | GTAGGCCCATTAT | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G09660.1 | TAAGCCCATTAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G09660.2 | GTAGGCCCATTAT | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G09660.2 | TAAGCCCATTAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G09815 | AT1G09815.1 | GAAGCCCATTA | POLYMERASE DELTA 4 (POLD4); FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 137 Blast hits to 137 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 58; Plants - 33; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G10170 | AT1G10170.1 | TATAGGCCCATTGTTAGCCCATTAG | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
| AT1G10840 | AT1G10840.1 | TAATGGGCCCATG | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
| AT1G10840.2 | TAATGGGCCCATG | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
| AT1G11240 | AT1G11240.1 | TACCCTTATAATGGGCCAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink). |
| AT1G11430 | AT1G11430.1 | CTAATGGGCCTAAT | plastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G11710 | AT1G11710.1 | TAATGGGCTCA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G01110.1); Has 19625 Blast hits to 5674 proteins in 176 species: Archae - 2; Bacteria - 23; Metazoa - 403; Fungi - 262; Plants - 18143; Viruses - 0; Other Eukaryotes - 792 (source: NCBI BLink). |
| AT1G12920 | AT1G12920.1 | ATAAAGCCCATTAG | Encodes a eukaryotic release factor one homolog. |
| AT1G13060 | AT1G13060.1 | ATCGGCCCATTAA | Encodes 20S proteasome beta subunit PBE1 (PBE1). |
| AT1G14010 | AT1G14010.1 | TTAATGGGCCTTAA | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT1G14030 | AT1G14030.1 | ATAATGGGCCTTTAA | ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 838 Blast hits to 833 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 218; Plants - 233; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink). |
| AT1G14270 | AT1G14270.1 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.2 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.3 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.4 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14320 | AT1G14320.1 | TTAAAGCCCATTAG | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. |
| AT1G14320.2 | TTAAAGCCCATTAG | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. |
| AT1G14650 | AT1G14650.1 | GCCCGTTAAAGGCCCATTAA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink). |
| AT1G14650.2 | GCCCGTTAAAGGCCCATTAA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink). |
| AT1G14820 | AT1G14820.1 | GCCCATTAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT1G14820.2 | GCCCATTAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT1G14820.3 | GCCCATTAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT1G14980 | AT1G14980.1 | TGAGGCCCATTAA | Encodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs. |
| AT1G15020 | AT1G15020.1 | TAATGGGCCTATA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT1G15020.2 | TAATGGGCCTATA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT1G15120 | AT1G15120.1 | TTAATGGGCTTTTA | ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT2G01090.1). |
| AT1G15215 | AT1G15215.1 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15215.2 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15215.3 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15250 | AT1G15250.1 | CCAGGCCCATGAAGCCCATTAAGAAGCCCATAT | 60S ribosomal protein L37 (RPL37A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT1G15270 | AT1G15270.1 | GGCCTTTTAATGGGCCATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT1G15280 | AT1G15280.1 | TATGGCCCATTAAAAGGCC | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). |
| AT1G15280.2 | TATGGCCCATTAAAAGGCC | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). |
| AT1G15720 | AT1G15720.1 | ATAATGGGCCG | Arabidopsis thaliana myb family transcription factor (At1g15720) |
| AT1G16870 | AT1G16870.1 | TTAATGGGCCTAAC | mitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT1G16900 | AT1G16900.1 | ATAAGCCCATTAT | curculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein |
| AT1G16900.1 | ATAATGGGCTTA | curculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein |
| AT1G17760 | AT1G17760.1 | TTAATGGGCCAA | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. |
| AT1G18070 | AT1G18070.1 | CTAAGGCCCATTAGTTGGGCTTT | EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink). |
| AT1G18070.2 | CTAAGGCCCATTAGTTGGGCTTT | EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink). |
| AT1G18080 | AT1G18080.1 | ATAAGCCCATTAA | Encodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene. |
| AT1G18480 | AT1G18480.1 | TTAATGGGCCTAC | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G07010.1); Has 433 Blast hits to 431 proteins in 108 species: Archae - 12; Bacteria - 139; Metazoa - 0; Fungi - 17; Plants - 53; Viruses - 3; Other Eukaryotes - 209 (source: NCBI BLink). |
| AT1G18540 | AT1G18540.1 | ATAAGGGCCCATTAG | 60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT1G19710 | AT1G19710.1 | AATAGGCCTTTTAAAGCCCATTAT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink). |
| AT1G20340 | AT1G20340.1 | CAAAGCCCATTAAGGCCCATTT | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. |
| AT1G20350 | AT1G20350.1 | AAATGGGCCTTAATGGGCTTTG | mitochondrial inner membrane translocase |
| AT1G20510 | AT1G20510.1 | TAAAGGCCCATTAT | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink). |
| AT1G20510.2 | TAAAGGCCCATTAT | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink). |
| AT1G20540 | AT1G20540.1 | GTTAGGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G76260.1); Has 6759 Blast hits to 5575 proteins in 300 species: Archae - 0; Bacteria - 624; Metazoa - 3227; Fungi - 1427; Plants - 781; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink). |
| AT1G20770 | AT1G20770.1 | TTAATGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G20780 | AT1G20780.1 | TAAAGGCCCATTAA | Encodes a protein containing a U-box and an ARM domain. |
| AT1G21100 | AT1G21100.1 | AGAGGCCCATTAG | O-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; EXPRESSED IN: stem, cotyledon, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21130.1); Has 2126 Blast hits to 2123 proteins in 426 species: Archae - 0; Bacteria - 600; Metazoa - 84; Fungi - 432; Plants - 916; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink). |
| AT1G21280 | AT1G21280.1 | CAAGGCCCATTAAGCCCAACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G22520 | AT1G22520.1 | ATAAGGCCCATTAATCGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). |
| AT1G22520.2 | ATAAGGCCCATTAATCGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). |
| AT1G22840 | AT1G22840.1 | CCCATTAAGGGCCCATTAAG | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. |
| AT1G22840.2 | CCCATTAAGGGCCCATTAAG | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. |
| AT1G23205 | AT1G23205.1 | TCAGGCCCAGATCGGCCCATTAA | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G70720.1); Has 417 Blast hits to 412 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 417; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G23280 | AT1G23280.1 | TGAGGCCCATTAT | MAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink). |
| AT1G23290 | AT1G23290.1 | ATAATGGGCCTCA | Encodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20. |
| AT1G23740 | AT1G23740.1 | TTTAGGCCCATTAA | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae - 321; Bacteria - 14032; Metazoa - 1331; Fungi - 2499; Plants - 781; Viruses - 3; Other Eukaryotes - 6768 (source: NCBI BLink). |
| AT1G23750 | AT1G23750.1 | TTAATGGGCCTAAA | DNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
| AT1G24170 | AT1G24170.1 | CTTAATGGGCCAA | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G26460 | AT1G26460.1 | TTAATGGGCTGGGCTTTAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 4278 Blast hits to 2050 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 59; Plants - 4056; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). |
| AT1G26640 | AT1G26640.1 | CTTAATGGGCTTC | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT1G26650 | AT1G26650.1 | GAAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G28060 | AT1G28060.1 | TAAAAGCCCATTAG | small nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink). |
| AT1G28090 | AT1G28090.1 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G28090.2 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G28090.3 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G30680 | AT1G30680.1 | TTAATGGGCCTTTT | toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink). |
| AT1G30845 | AT1G30845.1 | TTAATGGGCCATAAGCCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 71 Blast hits to 71 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 19; Plants - 11; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G31220 | AT1G31220.1 | TCAGCCCATTAAG | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide |
| AT1G31420 | AT1G31420.1 | TAATGGGCCTTAAAAATGGGCCCAATG | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
| AT1G31660 | AT1G31660.1 | AGTTGGGCCTAATGGGCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bystin (InterPro:IPR007955); Has 370 Blast hits to 362 proteins in 156 species: Archae - 0; Bacteria - 7; Metazoa - 139; Fungi - 93; Plants - 32; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). |
| AT1G32530 | AT1G32530.1 | TAATGGGCTCAAAGCCCATAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). |
| AT1G32580 | AT1G32580.1 | TTCGGCCCATTAA | plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G32990 | AT1G32990.1 | TTTAGGCCCATTAAGCCCATAA | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11 |
| AT1G33490 | AT1G33490.1 | TAAAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G33500 | AT1G33500.1 | ATAATGGGCTTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT1G33980 | AT1G33980.1 | TTAAGGCCCATTAGAGGCCCATATA | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) |
| AT1G33980.2 | TTAAGGCCCATTAGAGGCCCATATA | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) |
| AT1G34130 | AT1G34130.1 | ATAATGGGCTCAATAAAGCCCAAAC | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. |
| AT1G34130.1 | TTAATGGGCTTTG | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. |
| AT1G34190 | AT1G34190.1 | ATAATGGGCCTGT | Arabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 1564; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G34190.1 | TTAATGGGCCTGA | Arabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 1564; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G44750 | AT1G44750.1 | ATTGGCCCATTAA | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G47250 | AT1G47250.1 | AGCCCATTAAG | Encodes 20S proteasome subunit PAF2 (PAF2). |
| AT1G47720 | AT1G47720.1 | ATAATGGGCCTAG | Encodes an organellar single-strand DNA binding protein, located in mitochondria, controls the stoichiometry of alternative mitochondrial DNA forms generated by homologous recombination. |
| AT1G48320 | AT1G48320.1 | CTAATGGGCCTTTA | thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT5G48950.1); Has 1639 Blast hits to 1639 proteins in 507 species: Archae - 0; Bacteria - 1172; Metazoa - 3; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). |
| AT1G48320.1 | TAGCCCATTAG | thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT5G48950.1); Has 1639 Blast hits to 1639 proteins in 507 species: Archae - 0; Bacteria - 1172; Metazoa - 3; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). |
| AT1G48430 | AT1G48430.1 | CTTAATGGGCT | dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink). |
| AT1G48440 | AT1G48440.1 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G48450 | AT1G48450.1 | CTTAATGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G48450.2 | CTTAATGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G48460 | AT1G48460.1 | CAAAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G48900 | AT1G48900.1 | GTAAGGCCCATTAA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). |
| AT1G48900.2 | GTAAGGCCCATTAA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink). |
| AT1G48920 | AT1G48920.1 | GCCCATTAT | Encodes the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. |
| AT1G49140 | AT1G49140.1 | TGAGGCCCATTAA | NADH-ubiquinone oxidoreductase-related; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT3G18410.2); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G50170 | AT1G50170.1 | ATGGCCCATTAA | encodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis |
| AT1G51360 | AT1G51360.1 | ATAATGGGCTTG | Involved in defense against fungal pathogens and located in cytosol. |
| AT1G51380 | AT1G51380.1 | ATAATGGGCTTC | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 28354 Blast hits to 27866 proteins in 1723 species: Archae - 374; Bacteria - 11782; Metazoa - 5169; Fungi - 3198; Plants - 1370; Viruses - 24; Other Eukaryotes - 6437 (source: NCBI BLink). |
| AT1G51650 | AT1G51650.1 | CTTAATGGGCCGTTAAA | ATP synthase epsilon chain, mitochondrial; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP biosynthetic process, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, epsilon subunit, mitochondrial (InterPro:IPR006721); Has 170 Blast hits to 170 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 3; Plants - 40; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT1G51965 | AT1G51965.1 | GTAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 21191 Blast hits to 6126 proteins in 185 species: Archae - 5; Bacteria - 14; Metazoa - 565; Fungi - 542; Plants - 18830; Viruses - 0; Other Eukaryotes - 1235 (source: NCBI BLink). |
| AT1G52240 | AT1G52240.1 | CTTAATGGGCTTAT | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G52240.2 | CTTAATGGGCTTAT | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G52670 | AT1G52670.1 | ATAATGGGCTTTG | biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin carboxyl carrier protein of acetyl-CoA carboxylase-related (TAIR:AT3G15690.2); Has 1945 Blast hits to 1945 proteins in 695 species: Archae - 0; Bacteria - 1300; Metazoa - 2; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 568 (source: NCBI BLink). |
| AT1G52670.1 | TAATGGGCCCTA | biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin carboxyl carrier protein of acetyl-CoA carboxylase-related (TAIR:AT3G15690.2); Has 1945 Blast hits to 1945 proteins in 695 species: Archae - 0; Bacteria - 1300; Metazoa - 2; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 568 (source: NCBI BLink). |
| AT1G53140 | AT1G53140.1 | TGAGGCCCAATACGGCCCATTAA | Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis. |
| AT1G53670 | AT1G53670.1 | TTAATGGGCTTG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G53670.2 | TTAATGGGCTTG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G53850 | AT1G53850.1 | GTTAGGCCCATGAAAGCCCATTAT | Encodes alpha5 subunit of 20s proteosome involved in protein degradation. |
| AT1G53850.2 | GTTAGGCCCATGAAAGCCCATTAT | Encodes alpha5 subunit of 20s proteosome involved in protein degradation. |
| AT1G54050 | AT1G54050.1 | CTAATGGGCTAAGGCC | 17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink). |
| AT1G54100 | AT1G54100.1 | TTAATGGGCCTGGCCCATA | Aldehyde dehydrogenase |
| AT1G54100.2 | TTAATGGGCCTGGCCCATA | Aldehyde dehydrogenase |
| AT1G54140 | AT1G54140.1 | TTAATGGGCCTAT | putative TATA binding protein associated factor 21kDa |
| AT1G54150 | AT1G54150.1 | ATAGGCCCATTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 1572 Blast hits to 1571 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1041; Fungi - 23; Plants - 178; Viruses - 133; Other Eukaryotes - 197 (source: NCBI BLink). |
| AT1G54310 | AT1G54310.1 | GTGGCCCATTAG | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PUA (InterPro:IPR002478); Has 3651 Blast hits to 3638 proteins in 946 species: Archae - 69; Bacteria - 3053; Metazoa - 33; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 462 (source: NCBI BLink). |
| AT1G54320 | AT1G54320.1 | TAAAGCCCATTATAAAGCCCAC | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); BEST Arabidopsis thaliana protein match is: ALIS1 (ALA-INTERACTING SUBUNIT 1); phospholipid transporter (TAIR:AT3G12740.1); Has 648 Blast hits to 646 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 139; Plants - 105; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| AT1G56070 | AT1G56070.1 | ATTGGCCCATTAAGGCCCATTAAG | encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive. |
| AT1G56460 | AT1G56460.1 | TAATGGGCCGAT | PAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT2G47350.1); Has 6344 Blast hits to 4558 proteins in 417 species: Archae - 6; Bacteria - 427; Metazoa - 2467; Fungi - 794; Plants - 231; Viruses - 26; Other Eukaryotes - 2393 (source: NCBI BLink). |
| AT1G57540 | AT1G57540.1 | CCGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57540.2 | CCGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57540.3 | CCGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G57770 | AT1G57770.1 | TTAATGGGCTTG | amine oxidase family; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD dependent oxidoreductase (InterPro:IPR006076); BEST Arabidopsis thaliana protein match is: CRTISO (CAROTENOID ISOMERASE); carotenoid isomerase (TAIR:AT1G06820.1); Has 4784 Blast hits to 4705 proteins in 573 species: Archae - 90; Bacteria - 1781; Metazoa - 346; Fungi - 53; Plants - 173; Viruses - 0; Other Eukaryotes - 2341 (source: NCBI BLink). |
| AT1G60600 | AT1G60600.1 | TAATGGGCCTTAAAGGCCCAC | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
| AT1G60600.2 | TAATGGGCCTTAAAGGCCCAC | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
| AT1G60900 | AT1G60900.1 | ATAAGCCCATTAAG | U2 snRNP auxiliary factor large subunit, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: ATU2AF65A; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G36690.1); Has 85440 Blast hits to 35122 proteins in 1401 species: Archae - 56; Bacteria - 10121; Metazoa - 44645; Fungi - 7960; Plants - 5595; Viruses - 646; Other Eukaryotes - 16417 (source: NCBI BLink). |
| AT1G61570 | AT1G61570.1 | ACAGGCCCATTAA | Encodes a putative small zinc finger-like protein (TIM13); nucleus-encoded gene whose product is found in the mitochondrial inner membrane space. |
| AT1G63460 | AT1G63460.1 | GTGGCCCAATAGAAGCCCATTAAG | glutathione peroxidase, putative; FUNCTIONS IN: glutathione peroxidase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Glutathione peroxidase (InterPro:IPR000889); BEST Arabidopsis thaliana protein match is: ATGPX6 (GLUTATHIONE PEROXIDASE 6); glutathione peroxidase (TAIR:AT4G11600.1); Has 5286 Blast hits to 5285 proteins in 1007 species: Archae - 0; Bacteria - 1863; Metazoa - 687; Fungi - 136; Plants - 239; Viruses - 8; Other Eukaryotes - 2353 (source: NCBI BLink). |
| AT1G65000 | AT1G65000.1 | CCCAATAAGCCCATTAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, pollen tube, stamen; EXPRESSED DURING: 4 anthesis; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38060.1); Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G65960 | AT1G65960.1 | TAGCCCATTAT | glutamate decarboxylase (GAD2) |
| AT1G66500 | AT1G66500.1 | ACAGGCCCATTAA | zinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 85; Plants - 35; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT1G66530 | AT1G66530.1 | ATAATGGGCCTCT | arginyl-tRNA synthetase, putative / arginine--tRNA ligase, putative; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, arginine-tRNA ligase activity, ATP binding; INVOLVED IN: arginyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), DALR anticodon binding (InterPro:IPR008909), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Arginyl-tRNA synthetase, class Ic, core (InterPro:IPR015945), Arginyl tRNA synthetase, class Ic, N-terminal (InterPro:IPR005148), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Arginyl-tRNA synthetase, class Ic (InterPro:IPR001278); BEST Arabidopsis thaliana protein match is: emb1027 (embryo defective 1027); ATP binding / aminoacyl-tRNA ligase/ arginine-tRNA ligase/ nucleotide binding (TAIR:AT4G26300.1); Has 6538 Blast hits to 6477 proteins in 1602 species: Archae - 156; Bacteria - 2983; Metazoa - 242; Fungi - 116; Plants - 35; Viruses - 3; Other Eukaryotes - 3003 (source: NCBI BLink). |
| AT1G67250 | AT1G67250.1 | TGAGCCCATTAT | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT5G38650.1); Has 170 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 2; Plants - 63; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT1G67250.1 | TTAATGGGCCTTAG | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT5G38650.1); Has 170 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 2; Plants - 63; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT1G67320 | AT1G67320.1 | ATATGGGCCCATTAATAGGCCCAACA | DNA primase, large subunit family; FUNCTIONS IN: DNA primase activity; INVOLVED IN: DNA replication, synthesis of RNA primer; LOCATED IN: alpha DNA polymerase:primase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA primase, large subunit, eukaryotic (InterPro:IPR016558), DNA primase, large subunit, eukaryotic/archaeal (InterPro:IPR007238); Has 329 Blast hits to 325 proteins in 153 species: Archae - 6; Bacteria - 0; Metazoa - 133; Fungi - 93; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT1G67430 | AT1G67430.1 | AAAGCCCATTAA | 60S ribosomal protein L17 (RPL17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17A) (TAIR:AT1G27400.1); Has 1644 Blast hits to 1644 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink). |
| AT1G67680 | AT1G67680.1 | AAAGGCCCATATAAAAAGCCCATTAA | 7S RNA binding; FUNCTIONS IN: 7S RNA binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP72 subunit, RNA-binding (InterPro:IPR013699); BEST Arabidopsis thaliana protein match is: 7S RNA binding (TAIR:AT1G67650.1); Has 525 Blast hits to 512 proteins in 165 species: Archae - 12; Bacteria - 42; Metazoa - 217; Fungi - 108; Plants - 25; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). |
| AT1G68830 | AT1G68830.1 | TTAATGGGCCTAAA | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation |
| AT1G69740 | AT1G69740.1 | ACAGGCCCATTAA | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis. |
| AT1G69740.2 | ACAGGCCCATTAA | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis. |
| AT1G71090 | AT1G71090.1 | TTAATGGGCTTATAATTGGGCTTC | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G01990.1); Has 433 Blast hits to 370 proteins in 101 species: Archae - 9; Bacteria - 33; Metazoa - 0; Fungi - 220; Plants - 97; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G72090 | AT1G72090.1 | TCGACCCGACCCAGGCCCATTA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), Aldolase-type TIM barrel (InterPro:IPR013785), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792), MiaB-like tRNA modifying enzyme, archaeal-type (InterPro:IPR006466); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT4G36390.1); Has 10341 Blast hits to 10323 proteins in 1298 species: Archae - 269; Bacteria - 4639; Metazoa - 269; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5110 (source: NCBI BLink). |
| AT1G72320 | AT1G72320.1 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.2 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.3 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G74260 | AT1G74260.1 | ATCGGCCCTTAGGCCCATTAG | Encodes formylglycinamidine ribonucleotide synthase an enzyme involved in de novo purine biosynthesis. PUR4 is localizes to the chloroplast and mitochondria. Loss of PUR4 function affects male but not female gametophyte development. |
| AT1G74780 | AT1G74780.1 | AGCCCATTAAG | nodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink). |
| AT1G74970 | AT1G74970.1 | TTAATGGGCTCTAATGGGCCGAT | ribosomal protein S9, nuclear encoded component of the chloroplast ribosome |
| AT1G75510 | AT1G75510.1 | AACGGCCCATTAA | transcription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G76020 | AT1G76020.1 | TATGGCCCATTA | INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20225.1); Has 118 Blast hits to 116 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 12; Fungi - 4; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT1G76030 | AT1G76030.1 | TAATGGGCCATA | Encodes the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. |
| AT1G76300 | AT1G76300.1 | CTAATGGGCCCAATAA | snRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT1G76300.1 | CTAATGGGCCGAT | snRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT1G77030 | AT1G77030.1 | TTAATGGGCCTTAATGG | ATP binding / ATP-dependent helicase/ RNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DBP10CT (InterPro:IPR012541), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 46457 Blast hits to 14119 proteins in 1029 species: Archae - 31; Bacteria - 19714; Metazoa - 12532; Fungi - 2798; Plants - 5760; Viruses - 615; Other Eukaryotes - 5007 (source: NCBI BLink). |
| AT1G77540 | AT1G77540.1 | AATAGGCCCATTAATAGGCCC | Encodes a H3/H4 histone acetyltransferase. Belongs to the GNAT family, whose many members are involved in histone acetylation and chromatin remodeling, and are important for the regulation of cell growth and development. |
| AT1G77690 | AT1G77690.1 | CAAGCCCATTAA | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia. |
| AT1G79550 | AT1G79550.1 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK). |
| AT1G79550.2 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK). |
| AT1G79560 | AT1G79560.1 | CTTAATGGGCTA | encodes an FtsH protease that is localized to the chloroplast |
| AT1G79710 | AT1G79710.1 | CTAATGGGCCACAAAAAGCCCATCT | integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae - 4; Bacteria - 113; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink). |
| AT1G80210 | AT1G80210.1 | AAAAGCCCATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: mov34 family protein (TAIR:AT3G06820.2); Has 785 Blast hits to 706 proteins in 167 species: Archae - 0; Bacteria - 3; Metazoa - 423; Fungi - 147; Plants - 120; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). |
| AT1G80210.2 | AAAAGCCCATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: mov34 family protein (TAIR:AT3G06820.2); Has 785 Blast hits to 706 proteins in 167 species: Archae - 0; Bacteria - 3; Metazoa - 423; Fungi - 147; Plants - 120; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). |
| AT1G80770 | AT1G80770.1 | AAAAAGCCCATTAA | pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink). |
| AT1G80770.1 | AGAGGCCCATTAG | pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink). |
| AT2G01110 | AT2G01110.1 | TAATGGGCCTTAT | mutant is Albino and pale green; Chloroplast Protein Translocation (tatC). Core subunit of the chloroplast Tat translocase. Integral chloroplast thylakoid membrane protein. |
| AT2G01120 | AT2G01120.1 | ATAAGGCCCATTA | Origin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT2G01270 | AT2G01270.1 | ATAAAGCCCATTAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT2G01400 | AT2G01400.1 | CTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G01400.1 | TAAGCCCATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G01470 | AT2G01470.1 | TAATGGGCCTTAA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT2G01470.1 | TTAGCCCATTAA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT2G01650 | AT2G01650.1 | TTGGCCCAAAAGGCCCATTAA | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. |
| AT2G01720 | AT2G01720.1 | ACGGCCCATTAA | ribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 87; Plants - 31; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G02500 | AT2G02500.1 | TTAATGGGCCTGATGGGCTTAT | Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity). |
| AT2G02500.1 | TTATGGGCCTTATTAAAAGCCCATTAG | Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity). |
| AT2G02510 | AT2G02510.1 | ATAAGCCCATCAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02510.1 | CTAATGGGCTTTTAATAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02790 | AT2G02790.1 | CCAATAAGCCCACTAATAAAGCCCATTAT | IQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink). |
| AT2G03140 | AT2G03140.1 | CTAATGGGCTA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G50790.1); Has 23018 Blast hits to 13463 proteins in 1126 species: Archae - 80; Bacteria - 6803; Metazoa - 6863; Fungi - 2179; Plants - 631; Viruses - 123; Other Eukaryotes - 6339 (source: NCBI BLink). |
| AT2G03150 | AT2G03150.1 | ATAAGCCCATTAA | embryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink). |
| AT2G03270 | AT2G03270.1 | CTAAGCCCATTAT | DNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae - 141; Bacteria - 1267; Metazoa - 1124; Fungi - 651; Plants - 305; Viruses - 8; Other Eukaryotes - 902 (source: NCBI BLink). |
| AT2G04030 | AT2G04030.1 | TATAGGCCCATTAT | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G04030.2 | TATAGGCCCATTAT | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G04410 | AT2G04410.1 | TAACGGGCCCATTAAGGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G17972 | AT2G17972.1 | TAAAAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 19 Blast hits to 19 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G17975 | AT2G17975.1 | TTAATGGGCCTAATGGGCCTAG | zinc finger (Ran-binding) family protein; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: zinc finger (Ran-binding) family protein (TAIR:AT5G25490.1); Has 893 Blast hits to 535 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 304; Fungi - 62; Plants - 313; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink). |
| AT2G17980 | AT2G17980.1 | CTAGGCCCATTAGGCCCATTAA | member of SLY1 Gene Family |
| AT2G18020 | AT2G18020.1 | CTTAGGCCCATTAG | embryo defective 2296 (EMB2296); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: in 7 components; EXPRESSED IN: male gametophyte, guard cell, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein L2, domain 3 (InterPro:IPR014726), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L8 (RPL8C) (TAIR:AT4G36130.1); Has 7419 Blast hits to 7417 proteins in 2201 species: Archae - 236; Bacteria - 3117; Metazoa - 334; Fungi - 188; Plants - 928; Viruses - 0; Other Eukaryotes - 2616 (source: NCBI BLink). |
| AT2G18510 | AT2G18510.1 | CTTAATGGGCTTATAGGCCCATTAG | embryo defective 2444 (emb2444); FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: PAB8 (POLY(A) BINDING PROTEIN 8); RNA binding / translation initiation factor (TAIR:AT1G49760.1); Has 56184 Blast hits to 33244 proteins in 1255 species: Archae - 48; Bacteria - 4095; Metazoa - 27429; Fungi - 7959; Plants - 8932; Viruses - 890; Other Eukaryotes - 6831 (source: NCBI BLink). |
| AT2G18710 | AT2G18710.1 | TATTGGGCCTAAAAGGCCTGGCCCATTAG | SecY Homolog 1 (SCY1); FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: EMB2289 (EMBRYO DEFECTIVE 2289); P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT2G31530.1); Has 6517 Blast hits to 6501 proteins in 1505 species: Archae - 48; Bacteria - 2805; Metazoa - 25; Fungi - 2; Plants - 53; Viruses - 0; Other Eukaryotes - 3584 (source: NCBI BLink). |
| AT2G19750 | AT2G19750.1 | TACGGCCCATTAA | 40S ribosomal protein S30 (RPS30A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT2G20210 | AT2G20210.1 | CGGCCCATTAT | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, ribonuclease inhibitor subtype (InterPro:IPR003590); Has 1691 Blast hits to 1352 proteins in 107 species: Archae - 0; Bacteria - 100; Metazoa - 1035; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 421 (source: NCBI BLink). |
| AT2G20410 | AT2G20410.1 | GAAGCCCATTAAG | activating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G20450 | AT2G20450.1 | TTAATGGGCCTTTAA | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink). |
| AT2G20530 | AT2G20530.1 | CTAATGGGCCTGA | PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink). |
| AT2G20530.2 | CTAATGGGCCTGA | PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink). |
| AT2G20580 | AT2G20580.1 | TAATGGGCTGA | encoding the RPN subunits of the 26S proteasome |
| AT2G20580.1 | TTAATGGGCT | encoding the RPN subunits of the 26S proteasome |
| AT2G20610 | AT2G20610.1 | GCCCATTAG | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. |
| AT2G20610.2 | GCCCATTAG | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. |
| AT2G20860 | AT2G20860.1 | ATAATGGGCTTTA | LIP1,Lipoic acid synthase, |
| AT2G20860.1 | TTAATGGGCCTAC | LIP1,Lipoic acid synthase, |
| AT2G21580 | AT2G21580.1 | TTAATGGGCTTG | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G21580.1 | TTAATGGGCTTT | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G21580.2 | TTAATGGGCTTG | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G21580.2 | TTAATGGGCTTT | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G22370 | AT2G22370.1 | CTAATGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 87 Blast hits to 87 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G22400 | AT2G22400.1 | CTAATGGGCTTTATACGGCCCAAAA | NOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). |
| AT2G23090 | AT2G23090.1 | AAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1909 (InterPro:IPR015023); Has 104 Blast hits to 104 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 33; Plants - 46; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT2G23390 | AT2G23390.1 | TTAATGGGCCTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF482 (InterPro:IPR007434), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 1806 Blast hits to 1806 proteins in 374 species: Archae - 0; Bacteria - 707; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 1084 (source: NCBI BLink). |
| AT2G24060 | AT2G24060.1 | TTAAAGCCCATAAGCCCATTAA | translation initiation factor 3 (IF-3) family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 3 (InterPro:IPR001288); BEST Arabidopsis thaliana protein match is: translation initiation factor 3 (IF-3) family protein (TAIR:AT4G30690.1); Has 17514 Blast hits to 8661 proteins in 1545 species: Archae - 56; Bacteria - 6187; Metazoa - 2053; Fungi - 689; Plants - 758; Viruses - 336; Other Eukaryotes - 7435 (source: NCBI BLink). |
| AT2G24395 | AT2G24395.1 | TTAATGGGCCTT | chaperone protein dnaJ-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT2G24500 | AT2G24500.1 | TAAAAGCCCATTAGAAAGCCCATTAG | Encodes a C2H2 zinc finger protein FZF. |
| AT2G24860 | AT2G24860.1 | TTAATGGGCCCAG | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 65 Blast hits to 65 proteins in 20 species: Archae - 0; Bacteria - 8; Metazoa - 8; Fungi - 2; Plants - 40; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT2G27030 | AT2G27030.1 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G27030.2 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G27030.3 | TTATTGGGCCTAATGGGCCTTTT | encodes a calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. |
| AT2G28290 | AT2G28290.1 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. |
| AT2G28290.2 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. |
| AT2G28290.3 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. |
| AT2G28480 | AT2G28480.1 | ATAATGGGCCTGT | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 212 Blast hits to 192 proteins in 26 species: Archae - 0; Bacteria - 3; Metazoa - 27; Fungi - 0; Plants - 169; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G28480.1 | ATAATGGGCTTG | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 212 Blast hits to 192 proteins in 26 species: Archae - 0; Bacteria - 3; Metazoa - 27; Fungi - 0; Plants - 169; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G30000 | AT2G30000.1 | ATAATGGGCTTTTA | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G30060 | AT2G30060.1 | AATAGGCCCAAAAGGGCCCATTAT | Ran-binding protein 1b (RanBP1b); FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: intracellular transport, protein import into nucleus, translocation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ran Binding Protein 1 (InterPro:IPR000156), Pleckstrin homology-type (InterPro:IPR011993); BEST Arabidopsis thaliana protein match is: SIRANBP; Ran GTPase binding (TAIR:AT1G07140.1); Has 1190 Blast hits to 924 proteins in 176 species: Archae - 0; Bacteria - 3; Metazoa - 728; Fungi - 225; Plants - 88; Viruses - 2; Other Eukaryotes - 144 (source: NCBI BLink). |
| AT2G31190 | AT2G31190.1 | TAAGCCCATTAG | LOCATED IN: mitochondrion, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: emb1879 (embryo defective 1879) (TAIR:AT5G49820.1); Has 274 Blast hits to 274 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 96; Fungi - 41; Plants - 94; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT2G31200 | AT2G31200.1 | CTAATGGGCTTA | Encodes actin depolymerizing factor 6 (ADF6). |
| AT2G31370 | AT2G31370.1 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.2 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.3 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.4 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.5 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G32060 | AT2G32060.1 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G32060.2 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G32060.3 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G33430 | AT2G33430.1 | TTAATGGGCTTTGAGCCCAACT | DIFFERENTIATION AND GREENING-LIKE 1 (DAL1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: plastid organization, endonucleolytic cleavage of tetracistronic rRNA transcript (SSU-rRNA, LSU-rRNA, 4.5S-rRNA, 5S-rRNA); LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 147 Blast hits to 134 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G33730 | AT2G33730.1 | CTAATGGGCCTAAA | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G28180.1); Has 105850 Blast hits to 52945 proteins in 1991 species: Archae - 661; Bacteria - 41429; Metazoa - 30663; Fungi - 9349; Plants - 3951; Viruses - 317; Other Eukaryotes - 19480 (source: NCBI BLink). |
| AT2G33730.1 | CTAATGGGCCTAAA | DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G28180.1); Has 105850 Blast hits to 52945 proteins in 1991 species: Archae - 661; Bacteria - 41429; Metazoa - 30663; Fungi - 9349; Plants - 3951; Viruses - 317; Other Eukaryotes - 19480 (source: NCBI BLink). |
| AT2G33840 | AT2G33840.1 | CTAATGGGCCTTT | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tyrosine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, tyrosyl-tRNA aminoacylation; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosine tRNA ligase, archaeal/eukaryotic (InterPro:IPR016485), Tyrosyl-tRNA synthetase, class Ib, archaeal/eukaryotic cytosolic (InterPro:IPR015624), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); BEST Arabidopsis thaliana protein match is: ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase (TAIR:AT1G28350.1); Has 3646 Blast hits to 3629 proteins in 1010 species: Archae - 254; Bacteria - 1669; Metazoa - 303; Fungi - 167; Plants - 79; Viruses - 5; Other Eukaryotes - 1169 (source: NCBI BLink). |
| AT2G34940 | AT2G34940.1 | TTAATGGGCTAATGAGGCCCATTAAG | vacuolar sorting receptor, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: protein targeting to vacuole; LOCATED IN: integral to plasma membrane, Golgi transport complex; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), EGF-like calcium-binding, conserved site (InterPro:IPR018097), EGF-like calcium-binding (InterPro:IPR001881), Growth factor, receptor (InterPro:IPR009030); BEST Arabidopsis thaliana protein match is: vacuolar sorting receptor, putative (TAIR:AT1G30900.1); Has 9390 Blast hits to 4743 proteins in 196 species: Archae - 0; Bacteria - 100; Metazoa - 8560; Fungi - 5; Plants - 215; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink). |
| AT2G35320 | AT2G35320.1 | ATAATGGGCCTTTAATTGGGCCGA | homologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent. |
| AT2G35480 | AT2G35480.1 | AAAAGCCCAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32260.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G35490 | AT2G35490.1 | ATAATGGGCCTGG | plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae - 0; Bacteria - 78; Metazoa - 1; Fungi - 0; Plants - 205; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G35490.1 | TCAGGCCCATTAG | plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae - 0; Bacteria - 78; Metazoa - 1; Fungi - 0; Plants - 205; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G35500 | AT2G35500.1 | CTAATGGGCCTGA | shikimate kinase-related; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); Has 282 Blast hits to 282 proteins in 67 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). |
| AT2G35720 | AT2G35720.1 | TTAAGGCCCATTAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT3G47940.1); Has 15787 Blast hits to 15749 proteins in 1885 species: Archae - 105; Bacteria - 5397; Metazoa - 3297; Fungi - 1386; Plants - 1147; Viruses - 13; Other Eukaryotes - 4442 (source: NCBI BLink). |
| AT2G35750 | AT2G35750.1 | CTAATGGGCTTAATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G36070 | AT2G36070.1 | AAACCGAACCTTAATGGGC | One of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP. |
| AT2G36170 | AT2G36170.1 | TTAATGGGCTTTG | ubiquitin extension protein 2 (UBQ2) / 60S ribosomal protein L40 (RPL40A); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein modification process, translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L40e (InterPro:IPR001975), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ1 (UBIQUITIN EXTENSION PROTEIN 1); protein binding / structural constituent of ribosome (TAIR:AT3G52590.1); Has 9155 Blast hits to 5428 proteins in 614 species: Archae - 0; Bacteria - 7; Metazoa - 4223; Fungi - 953; Plants - 1966; Viruses - 162; Other Eukaryotes - 1844 (source: NCBI BLink). |
| AT2G36620 | AT2G36620.1 | AAAAGGCCCATTAA | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
| AT2G36680 | AT2G36680.1 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT2G36680.2 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT2G36680.3 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT2G36680.4 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT2G36930 | AT2G36930.1 | TTAATGGGCCTAT | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type (InterPro:IPR007087); Has 506 Blast hits to 289 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 257; Fungi - 153; Plants - 39; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT2G37160 | AT2G37160.1 | TAATGGGCCTATA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae - 36; Bacteria - 3543; Metazoa - 4573; Fungi - 2572; Plants - 1053; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink). |
| AT2G37160.2 | TAATGGGCCTATA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae - 36; Bacteria - 3543; Metazoa - 4573; Fungi - 2572; Plants - 1053; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink). |
| AT2G39390 | AT2G39390.1 | TCAGCCCATTAG | 60S ribosomal protein L35 (RPL35B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 796 Blast hits to 796 proteins in 298 species: Archae - 108; Bacteria - 128; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT2G39460 | AT2G39460.1 | AAAAGGCCCATTAT | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT2G39460.2 | AAAAGGCCCATTAT | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT2G39760 | AT2G39760.1 | AGCCCATTA | BPM3; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), BTB/POZ fold (InterPro:IPR011333), BTB/POZ (InterPro:IPR013069), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: ATBPM1 (BTB-POZ and MATH domain 1); protein binding (TAIR:AT5G19000.1); Has 5596 Blast hits to 5441 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 4431; Fungi - 78; Plants - 862; Viruses - 29; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT2G39760.2 | AGCCCATTA | BPM3; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), BTB/POZ fold (InterPro:IPR011333), BTB/POZ (InterPro:IPR013069), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: ATBPM1 (BTB-POZ and MATH domain 1); protein binding (TAIR:AT5G19000.1); Has 5596 Blast hits to 5441 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 4431; Fungi - 78; Plants - 862; Viruses - 29; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT2G40060 | AT2G40060.1 | AAAAAGCCCATTAAG | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 403 Blast hits to 391 proteins in 99 species: Archae - 2; Bacteria - 32; Metazoa - 184; Fungi - 36; Plants - 54; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT2G40113 | AT2G40113.1 | GAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47635.1); Has 27 Blast hits to 27 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G40650 | AT2G40650.1 | AGCCCATTAA | pre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae - 56; Bacteria - 20349; Metazoa - 26407; Fungi - 5687; Plants - 2913; Viruses - 323; Other Eukaryotes - 11922 (source: NCBI BLink). |
| AT2G40650.1 | ATAATGGGCCTAG | pre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae - 56; Bacteria - 20349; Metazoa - 26407; Fungi - 5687; Plants - 2913; Viruses - 323; Other Eukaryotes - 11922 (source: NCBI BLink). |
| AT2G40660 | AT2G40660.1 | CTAGGCCCATTAT | tRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae - 158; Bacteria - 2173; Metazoa - 404; Fungi - 148; Plants - 87; Viruses - 1; Other Eukaryotes - 649 (source: NCBI BLink). |
| AT2G40660.1 | TTAATGGGCT | tRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae - 158; Bacteria - 2173; Metazoa - 404; Fungi - 148; Plants - 87; Viruses - 1; Other Eukaryotes - 649 (source: NCBI BLink). |
| AT2G40810 | AT2G40810.1 | TTAGCCCATTAT | AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT2G40810.2 | TTAGCCCATTAT | AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT2G42160 | AT2G42160.1 | CTAAGGCCCATTAA | zinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae - 0; Bacteria - 7; Metazoa - 531; Fungi - 172; Plants - 57; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). |
| AT2G42210 | AT2G42210.1 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.2 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.3 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.4 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42230 | AT2G42230.1 | CTTAATGGGCCGTTTAAAGCCCATTTA | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT2G42230.2 | CTTAATGGGCCGTTTAAAGCCCATTTA | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT2G42600 | AT2G42600.1 | GCCCATTAG | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins. |
| AT2G42600.2 | GCCCATTAG | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins. |
| AT2G43350 | AT2G43350.1 | TAAGCCCATTAA | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. |
| AT2G43640 | AT2G43640.1 | TACTGGGCCTAATAAGGCCCATTAT | signal recognition particle 14 kDa family protein / SRP14 family protein; FUNCTIONS IN: 7S RNA binding, protein binding, endoplasmic reticulum signal peptide binding, RNA binding; INVOLVED IN: negative regulation of translational elongation, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP14 subunit (InterPro:IPR003210), Signal recognition particle, SRP9/SRP14 subunit (InterPro:IPR009018); Has 170 Blast hits to 170 proteins in 73 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 27; Plants - 26; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT2G43640.2 | TACTGGGCCTAATAAGGCCCATTAT | signal recognition particle 14 kDa family protein / SRP14 family protein; FUNCTIONS IN: 7S RNA binding, protein binding, endoplasmic reticulum signal peptide binding, RNA binding; INVOLVED IN: negative regulation of translational elongation, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP14 subunit (InterPro:IPR003210), Signal recognition particle, SRP9/SRP14 subunit (InterPro:IPR009018); Has 170 Blast hits to 170 proteins in 73 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 27; Plants - 26; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT2G44640 | AT2G44640.1 | CAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G45500 | AT2G45500.1 | TAAAGCCCATTAG | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). |
| AT2G45500.2 | TAAAGCCCATTAG | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). |
| AT2G45510 | AT2G45510.1 | CTAATGGGCTTTA | member of CYP704A |
| AT2G45640 | AT2G45640.1 | AAAAGGCCCATTAG | Involved in the regulation of salt stress. Expression of AtSAP18 is induced by NaCl, cold, drought, ABA, and ethylene treatment. AtSAP18 and HDA19 associate with ERF3 and ERF4 both in vitro and in vivo. |
| AT2G46060 | AT2G46060.1 | TAAAAGCCCATTAA | transmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G46060.2 | TAAAAGCCCATTAA | transmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G46090 | AT2G46090.1 | TAAGCCCATTAG | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT2G46470 | AT2G46470.1 | TTAAGGCCCATTAAG | INNER MEMBRANE PROTEIN OXA1-LIKE (OXA1L); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein import into mitochondrial inner membrane; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 60 kDa inner membrane insertion protein (InterPro:IPR001708); BEST Arabidopsis thaliana protein match is: OXA1; P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT5G62050.1); Has 4383 Blast hits to 4383 proteins in 1328 species: Archae - 0; Bacteria - 2560; Metazoa - 212; Fungi - 138; Plants - 111; Viruses - 0; Other Eukaryotes - 1362 (source: NCBI BLink). |
| AT2G46540 | AT2G46540.1 | ATAATGGGCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46580 | AT2G46580.1 | ATAAGGCCTAATGGGCCTCA | pyridoxine 5'-phosphate oxidase-related; FUNCTIONS IN: FMN binding, pyridoxamine-phosphate oxidase activity; INVOLVED IN: pyridoxine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxamine 5'-phosphate oxidase (InterPro:IPR000659), FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002); Has 1089 Blast hits to 1089 proteins in 214 species: Archae - 0; Bacteria - 365; Metazoa - 49; Fungi - 36; Plants - 20; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). |
| AT2G47120 | AT2G47120.1 | AGAGGCCCATTAA | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G47130.1); Has 80311 Blast hits to 80158 proteins in 2201 species: Archae - 468; Bacteria - 43770; Metazoa - 4463; Fungi - 4181; Plants - 1494; Viruses - 4; Other Eukaryotes - 25931 (source: NCBI BLink). |
| AT2G47380 | AT2G47380.1 | TAATGGGCCGG | cytochrome c oxidase subunit Vc family protein / COX5C family protein; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase subunit Vc (InterPro:IPR008432); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit Vc, putative / COX5C, putative (TAIR:AT5G61310.4); Has 60 Blast hits to 60 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G47940 | AT2G47940.1 | AATAGGCCCATTAA | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
| AT2G47940.1 | GGGCCCATTAG | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
| AT2G47940.2 | AATAGGCCCATTAA | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
| AT2G47940.2 | GGGCCCATTAG | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
| AT2G47960 | AT2G47960.1 | AACGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF974 (InterPro:IPR010378); Has 215 Blast hits to 214 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 46; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT2G48160 | AT2G48160.1 | CTAATGGGCCTCA | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G63070.1); Has 1292 Blast hits to 1135 proteins in 175 species: Archae - 2; Bacteria - 174; Metazoa - 679; Fungi - 194; Plants - 113; Viruses - 2; Other Eukaryotes - 128 (source: NCBI BLink). |
| AT3G01100 | AT3G01100.1 | TTAATGGGCCTTTT | unknown protein, has cDNAs and ESTs associated to it |
| AT3G01100.2 | TTAATGGGCCTTTT | unknown protein, has cDNAs and ESTs associated to it |
| AT3G01540 | AT3G01540.1 | ATAATGGGCCTAG | RNA HELICASE DRH1 |
| AT3G01540.2 | ATAATGGGCCTAG | RNA HELICASE DRH1 |
| AT3G01540.3 | ATAATGGGCCTAG | RNA HELICASE DRH1 |
| AT3G01540.4 | ATAATGGGCCTAG | RNA HELICASE DRH1 |
| AT3G02050 | AT3G02050.1 | AGCCCATAATGGGCCTGA | potassium transporter KUP3p (KUP3) |
| AT3G02080 | AT3G02080.1 | ATTAGGCCCATTAG | 40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT3G02090 | AT3G02090.1 | CTAATGGGCCTAAT | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02090.2 | CTAATGGGCCTAAT | MPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT3G02320 | AT3G02320.1 | ATGGCCCATTAG | RNA binding / tRNA (guanine-N2-)-methyltransferase; FUNCTIONS IN: RNA binding, tRNA (guanine-N2-)-methyltransferase activity; INVOLVED IN: tRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: N2,N2-dimethylguanosine tRNA methyltransferase (InterPro:IPR002905); BEST Arabidopsis thaliana protein match is: N2,N2-dimethylguanosine tRNA methyltransferase family protein (TAIR:AT5G15810.1); Has 751 Blast hits to 711 proteins in 254 species: Archae - 149; Bacteria - 57; Metazoa - 179; Fungi - 100; Plants - 52; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink). |
| AT3G02555 | AT3G02555.1 | TAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G02560 | AT3G02560.1 | TTAATGGGCTA | 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). |
| AT3G02560.2 | TTAATGGGCTA | 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). |
| AT3G02820 | AT3G02820.1 | TTAATGGGCTTC | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT3G03130 | AT3G03130.1 | TTTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17160.1); Has 6511 Blast hits to 3260 proteins in 393 species: Archae - 10; Bacteria - 2333; Metazoa - 1613; Fungi - 601; Plants - 171; Viruses - 56; Other Eukaryotes - 1727 (source: NCBI BLink). |
| AT3G03920 | AT3G03920.1 | TGAGGCCCATTAG | Gar1 RNA-binding region family protein; FUNCTIONS IN: RNA binding, rRNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast thylakoid membrane, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gar1 protein RNA-binding region (InterPro:IPR007504); BEST Arabidopsis thaliana protein match is: Gar1 RNA-binding region family protein (TAIR:AT5G18180.1); Has 26246 Blast hits to 8264 proteins in 726 species: Archae - 15; Bacteria - 4613; Metazoa - 10704; Fungi - 2027; Plants - 5901; Viruses - 362; Other Eukaryotes - 2624 (source: NCBI BLink). |
| AT3G04160 | AT3G04160.1 | CTAATGGGCCTAATTAAATGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 1599 Blast hits to 1235 proteins in 157 species: Archae - 0; Bacteria - 45; Metazoa - 652; Fungi - 193; Plants - 164; Viruses - 0; Other Eukaryotes - 545 (source: NCBI BLink). |
| AT3G05060 | AT3G05060.1 | TCAGGCCCATTAA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein |
| AT3G05070 | AT3G05070.1 | TTAATGGGCCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT3G05210 | AT3G05210.1 | TTAATGGGCTTTA | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT3G05490 | AT3G05490.1 | CAAGCCCATTAT | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G05810 | AT3G05810.1 | TTAATGGGCTAGGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26800.1); Has 32 Blast hits to 32 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06030 | AT3G06030.1 | AAAAAGCCCAATAAGAAGGCCCATTAAG | NPK1-related protein kinase 3 |
| AT3G06270 | AT3G06270.1 | GGGCCTTAGGCCCATTAG | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae - 2; Bacteria - 83; Metazoa - 1132; Fungi - 383; Plants - 1219; Viruses - 4; Other Eukaryotes - 863 (source: NCBI BLink). |
| AT3G06540 | AT3G06540.1 | CTTAGGCCCATTA | GDP dissociation inhibitor family protein / Rab GTPase activator family protein; FUNCTIONS IN: RAB GDP-dissociation inhibitor activity; INVOLVED IN: intracellular protein transport, regulation of GTPase activity, protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rab GTPase activator (InterPro:IPR002005), Rab protein geranylgeranyltransferase component A, eukaryota (InterPro:IPR016664), Yeast Mrs6p protein (InterPro:IPR000632), GDP dissociation inhibitor (InterPro:IPR018203); BEST Arabidopsis thaliana protein match is: ATGDI1 (ARABIDOPSIS THALIANA GUANOSINE NUCLEOTIDE DIPHOSPHATE DISSOCIATION INHIBITOR 1); RAB GDP-dissociation inhibitor (TAIR:AT2G44100.2); Has 948 Blast hits to 858 proteins in 184 species: Archae - 0; Bacteria - 2; Metazoa - 512; Fungi - 195; Plants - 103; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). |
| AT3G07568 | AT3G07568.1 | CTAATGGGCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G07860 | AT3G07860.1 | TTAATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 107 Blast hits to 107 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G08510 | AT3G08510.1 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08510.2 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08510.3 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08520 | AT3G08520.1 | ATAAAGCCCATTAAG | 60S ribosomal protein L41 (RPL41D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G08590 | AT3G08590.1 | TAAAGCCCATTAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08590.2 | TAAAGCCCATTAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08610 | AT3G08610.1 | GAAGCCCAAAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G08950 | AT3G08950.1 | CTTAATGGGCTTTAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: copper ion transport, respiratory chain complex IV assembly, cellular copper ion homeostasis, cell redox homeostasis; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synthesis of cytochrome c oxidase, Sco1/Sco2 (InterPro:IPR017276), Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT4G39740.1); Has 3037 Blast hits to 3037 proteins in 688 species: Archae - 11; Bacteria - 1550; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 1204 (source: NCBI BLink). |
| AT3G09250 | AT3G09250.1 | CAAAGCCCATTAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10925.2); Has 169 Blast hits to 169 proteins in 54 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G09470 | AT3G09470.1 | AAAAGGCCAAGGCCCATTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G09470.2 | AAAAGGCCAAGGCCCATTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G09480 | AT3G09480.1 | AAAAGGCCAAGGCCCATTAG | histone H2B, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT5G02570.1); Has 2678 Blast hits to 2678 proteins in 284 species: Archae - 0; Bacteria - 0; Metazoa - 1868; Fungi - 162; Plants - 357; Viruses - 0; Other Eukaryotes - 291 (source: NCBI BLink). |
| AT3G09490 | AT3G09490.1 | CTAATGGGCCTTGGCCTTTT | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 637 Blast hits to 548 proteins in 146 species: Archae - 92; Bacteria - 301; Metazoa - 8; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink). |
| AT3G09500 | AT3G09500.1 | ATGGGCTAAGGCCCATTAAG | 60S ribosomal protein L35 (RPL35A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 829 Blast hits to 829 proteins in 305 species: Archae - 115; Bacteria - 131; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink). |
| AT3G10110 | AT3G10110.1 | CTAATGGGCCTAAA | maternal effect embryo arrest 67 (MEE67); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: embryonic development ending in seed dormancy, protein transport; LOCATED IN: mitochondrial inner membrane, chloroplast, mitochondrial inner membrane presequence translocase complex; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT1G18320.1); Has 509 Blast hits to 509 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 226; Fungi - 159; Plants - 86; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT3G10300 | AT3G10300.1 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). |
| AT3G10300.2 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). |
| AT3G10300.3 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). |
| AT3G10300.4 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). |
| AT3G10572 | AT3G10572.1 | ATGGCCCATTAA | 3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G10572.1 | GAAGCCCATTATATTGGCCCAATAG | 3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G10630 | AT3G10630.1 | CTTAATGGGCCTCT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 2500 Blast hits to 2492 proteins in 519 species: Archae - 97; Bacteria - 1438; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 3; Other Eukaryotes - 935 (source: NCBI BLink). |
| AT3G10940 | AT3G10940.1 | TTAAAGCCCATTAA | protein phosphatase-related; FUNCTIONS IN: phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: SEX4 (STARCH-EXCESS 4); polysaccharide binding / protein tyrosine/serine/threonine phosphatase (TAIR:AT3G52180.2); Has 743 Blast hits to 742 proteins in 92 species: Archae - 5; Bacteria - 8; Metazoa - 545; Fungi - 12; Plants - 77; Viruses - 11; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT3G10970 | AT3G10970.1 | TGGCCCATTAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G10970.2 | TGGCCCATTAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G10970.3 | TGGCCCATTAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
| AT3G11710 | AT3G11710.1 | CTAATGGGCTTG | ARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink). |
| AT3G12100 | AT3G12100.1 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G12100.1 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G12100.2 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G12100.2 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G12110 | AT3G12110.1 | AGCCCATTAA | Encodes an actin that is expressed predominantly during reproductive development. |
| AT3G12260 | AT3G12260.1 | CTTAGGCCCATAAAAAGCCCATTAG | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G12600 | AT3G12600.1 | TGGGCCCATTAAACCGAA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT3G12600.2 | TGGGCCCATTAAACCGAA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
| AT3G12870 | AT3G12870.1 | TTAATGGGCCA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56120.1); Has 45 Blast hits to 45 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13120 | AT3G13120.1 | TTAATGGGCTTAG | 30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink). |
| AT3G13190 | AT3G13190.1 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink). |
| AT3G13190.2 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink). |
| AT3G13190.3 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink). |
| AT3G13275 | AT3G13275.1 | TTAATGGGCCTTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 13 Blast hits to 13 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G13360 | AT3G13360.1 | TTAATGGGCCTTAT | WPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae - 0; Bacteria - 7; Metazoa - 18; Fungi - 8; Plants - 43; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
| AT3G13470 | AT3G13470.1 | TAATGGGCCTATT | chaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24486 Blast hits to 24452 proteins in 5132 species: Archae - 390; Bacteria - 14009; Metazoa - 1525; Fungi - 954; Plants - 450; Viruses - 2; Other Eukaryotes - 7156 (source: NCBI BLink). |
| AT3G13860 | AT3G13860.1 | ATAATGGGCCTAAG | HEAT SHOCK PROTEIN 60-3A (HSP60-3A); FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: HSP60 (HEAT SHOCK PROTEIN 60); ATP binding (TAIR:AT3G23990.1); Has 24236 Blast hits to 24217 proteins in 5120 species: Archae - 378; Bacteria - 14012; Metazoa - 1390; Fungi - 947; Plants - 418; Viruses - 2; Other Eukaryotes - 7089 (source: NCBI BLink). |
| AT3G13930 | AT3G13930.1 | ATTAGGCCCATTAA | dihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae - 43; Bacteria - 6315; Metazoa - 646; Fungi - 315; Plants - 198; Viruses - 0; Other Eukaryotes - 7611 (source: NCBI BLink). |
| AT3G14010 | AT3G14010.1 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G14010.2 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G14010.3 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G14290 | AT3G14290.1 | TTTAGGCCCATTAA | Encodes 20S proteasome subunit PAE2 (PAE2). |
| AT3G14830 | AT3G14830.1 | AGAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53450.2); Has 41 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G14830.2 | AGAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53450.2); Has 41 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G14860 | AT3G14860.1 | CTTAATGGGCCTATTATAAGGCCCATAA | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink). |
| AT3G14860.2 | CTTAATGGGCCTATTATAAGGCCCATAA | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink). |
| AT3G15180 | AT3G15180.1 | CTAATGGGCCTTAT | proteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae - 0; Bacteria - 1; Metazoa - 56; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G15280 | AT3G15280.1 | ATAATGGGCCTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15290 | AT3G15290.1 | TTTAGGCCCATTAT | 3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink). |
| AT3G15420 | AT3G15420.1 | TAATGGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15430 | AT3G15430.1 | TTTTGGGCCCATTA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). |
| AT3G15430.2 | TTTTGGGCCCATTA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). |
| AT3G15690 | AT3G15690.1 | GGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAAT | biotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). |
| AT3G15690.2 | GGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAAT | biotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). |
| AT3G16080 | AT3G16080.1 | ATAATGGGC | 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT3G16420 | AT3G16420.1 | TTAATGGGCCAA | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. |
| AT3G16420.2 | TTAATGGGCCAA | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. |
| AT3G16420.3 | TTAATGGGCCAA | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. |
| AT3G16700 | AT3G16700.1 | TATATGGGCCAATAATGGGCCATA | fumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). |
| AT3G16700.2 | TATATGGGCCAATAATGGGCCATA | fumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). |
| AT3G16780 | AT3G16780.1 | ATAATGGGCCAA | 60S ribosomal protein L19 (RPL19B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 106; Plants - 93; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). |
| AT3G16840 | AT3G16840.1 | CTAATGGGCTTC | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink). |
| AT3G16990 | AT3G16990.1 | AATAGGCCTTGGCCCATTAA | TENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT3G17000 | AT3G17000.1 | TTAATGGGCCAAGGCCTATT | ubiquitin-conjugating enzyme 32 (UBC32); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5810 Blast hits to 5810 proteins in 294 species: Archae - 0; Bacteria - 0; Metazoa - 2855; Fungi - 1053; Plants - 896; Viruses - 16; Other Eukaryotes - 990 (source: NCBI BLink). |
| AT3G18210 | AT3G18210.1 | TTAATGGGCCG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G18210.2 | TTAATGGGCCG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G18215 | AT3G18215.1 | CGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24600.1); Has 180 Blast hits to 180 proteins in 49 species: Archae - 0; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT3G18380 | AT3G18380.1 | TAAAAGCCCATTA | sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18380.2 | TAAAAGCCCATTA | sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18390 | AT3G18390.1 | TAATGGGCTTTTA | embryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae - 5; Bacteria - 10; Metazoa - 293; Fungi - 119; Plants - 305; Viruses - 46; Other Eukaryotes - 371 (source: NCBI BLink). |
| AT3G18520 | AT3G18520.1 | TAATGGGCTTAT | Encodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. |
| AT3G18520.2 | TAATGGGCTTAT | Encodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. |
| AT3G19508 | AT3G19508.1 | TTAAAGGCCCATTAAG | unknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G20020 | AT3G20020.1 | ATTGGCCCATTA | PROTEIN ARGININE METHYLTRANSFERASE 6 (PRMT6); FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: PRMT1A (PROTEIN ARGININE METHYLTRANSFERASE 1A); protein-arginine N-methyltransferase (TAIR:AT2G19670.1); Has 3635 Blast hits to 3579 proteins in 972 species: Archae - 81; Bacteria - 1747; Metazoa - 1005; Fungi - 174; Plants - 198; Viruses - 0; Other Eukaryotes - 430 (source: NCBI BLink). |
| AT3G20020.2 | ATTGGCCCATTA | PROTEIN ARGININE METHYLTRANSFERASE 6 (PRMT6); FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: PRMT1A (PROTEIN ARGININE METHYLTRANSFERASE 1A); protein-arginine N-methyltransferase (TAIR:AT2G19670.1); Has 3635 Blast hits to 3579 proteins in 972 species: Archae - 81; Bacteria - 1747; Metazoa - 1005; Fungi - 174; Plants - 198; Viruses - 0; Other Eukaryotes - 430 (source: NCBI BLink). |
| AT3G20630 | AT3G20630.1 | CTAATGGGCT | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. |
| AT3G21350 | AT3G21350.1 | ATAATGGGC | RNA polymerase transcriptional regulation mediator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit 6, metazoa/plant (InterPro:IPR016820), MED6 mediator (InterPro:IPR007018). |
| AT3G21350.2 | ATAATGGGC | RNA polymerase transcriptional regulation mediator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit 6, metazoa/plant (InterPro:IPR016820), MED6 mediator (InterPro:IPR007018). |
| AT3G21790 | AT3G21790.1 | CTAATGGGCCTTAA | UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B8 (UDP-GLUCOSYL TRANSFERASE 71B8); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 4'-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT3G21800.1); Has 4493 Blast hits to 4475 proteins in 265 species: Archae - 0; Bacteria - 82; Metazoa - 1698; Fungi - 10; Plants - 2668; Viruses - 11; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT3G22150 | AT3G22150.1 | GTTTGGGCTTCTTAAAGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink). |
| AT3G22230 | AT3G22230.1 | TTAATGGGCCGAA | 60S ribosomal protein L27 (RPL27B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27C) (TAIR:AT4G15000.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT3G22590 | AT3G22590.1 | AAAAAGCCCATTAT | RNA pol II accessory factor Cdc73 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II accessory factor, Cdc73 (InterPro:IPR007852); Has 392 Blast hits to 300 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 87; Plants - 21; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT3G24070 | AT3G24070.1 | TTAATGGGC | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G13450.1); Has 72 Blast hits to 72 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G24490 | AT3G24490.1 | TTGGCCCATTAG | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 2488 Blast hits to 1665 proteins in 165 species: Archae - 0; Bacteria - 71; Metazoa - 1163; Fungi - 123; Plants - 222; Viruses - 36; Other Eukaryotes - 873 (source: NCBI BLink). |
| AT3G24570 | AT3G24570.1 | TTAATGGGCCGG | peroxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, integral to membrane, peroxisomal membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane 22 kDa family protein (TAIR:AT5G43140.1); Has 898 Blast hits to 898 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 471; Fungi - 216; Plants - 153; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). |
| AT3G25220 | AT3G25220.1 | ATAGGCCCATTA | immunophilin (FKBP15-1) |
| AT3G25520 | AT3G25520.1 | TAAAAGCCCATAGGCCCATTAA | Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. |
| AT3G25520.1 | TAAAGCCCATTAA | Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. |
| AT3G26400 | AT3G26400.1 | CTAATGGGCTATTGTTGGGCTC | member of eIF4B - eukaryotic initiation factor 4B |
| AT3G26560 | AT3G26560.1 | AAAGCCCATTAA | ATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink). |
| AT3G26618 | AT3G26618.1 | ATAATGGGCTTTTA | eukaryotic release factor 1-3 (ERF1-3); FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube, leaf; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: eRF1 domain 2 (InterPro:IPR005141), eRF1 domain 3 (InterPro:IPR005142), eRF1 domain 1 (InterPro:IPR005140), Peptide chain release factor eRF/aRF subunit 1 (InterPro:IPR004403); BEST Arabidopsis thaliana protein match is: ERF1-2 (EUKARYOTIC RELEASE FACTOR 1-2); translation release factor (TAIR:AT1G12920.1); Has 801 Blast hits to 799 proteins in 274 species: Archae - 191; Bacteria - 2; Metazoa - 164; Fungi - 97; Plants - 79; Viruses - 1; Other Eukaryotes - 267 (source: NCBI BLink). |
| AT3G27110 | AT3G27110.1 | GAAGCCCATTAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). |
| AT3G27110.2 | GAAGCCCATTAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). |
| AT3G27160 | AT3G27160.1 | ATAATGGGCCTTAT | GHS1 encodes plastid ribosomal protein S21 |
| AT3G27240 | AT3G27240.1 | TTGGCCCATTAAGGCCCAAAT | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT5G40810.1); Has 2901 Blast hits to 2901 proteins in 507 species: Archae - 0; Bacteria - 704; Metazoa - 170; Fungi - 165; Plants - 63; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT3G27770 | AT3G27770.1 | ATAATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27770.2 | ATAATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G28500 | AT3G28500.1 | AAAAGGCCCATTAA | 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae - 48; Bacteria - 1; Metazoa - 282; Fungi - 204; Plants - 184; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink). |
| AT3G28500.1 | ATAAGGCCCATTAA | 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae - 48; Bacteria - 1; Metazoa - 282; Fungi - 204; Plants - 184; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink). |
| AT3G46040 | AT3G46040.1 | ATAATGGGCCTAG | Regulated by TCP20. |
| AT3G46040.1 | ATAATGGGCTTAG | Regulated by TCP20. |
| AT3G46100 | AT3G46100.1 | ATAAAGCCCAGCCCATTAG | histidyl-tRNA synthetase |
| AT3G46230 | AT3G46230.1 | TTAAGGCCCATTAA | member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds |
| AT3G46430 | AT3G46430.1 | AAAAAGCCCATTATGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59613.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G46580 | AT3G46580.1 | CTTAATGGGCCCAAAAGCCCAAAA | Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G47700 | AT3G47700.1 | AGGGCCCATTAA | Involved in transportation of seed storage proteins from the ER to the vacuole. Mutant seed cell accumulates the precursors of 12S globulin and 2S albumin instead of the vacuolar-located mature proteins. |
| AT3G48680 | AT3G48680.1 | CTAATGGGCCTCT | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT3G49500 | AT3G49500.1 | TAAAAGCCCATTAA | Encodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance. |
| AT3G49910 | AT3G49910.1 | AGAGGCCCATTAT | 60S ribosomal protein L26 (RPL26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, translation; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), KOW (InterPro:IPR005824), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26B) (TAIR:AT5G67510.1); Has 870 Blast hits to 870 proteins in 315 species: Archae - 232; Bacteria - 6; Metazoa - 311; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT3G50080 | AT3G50080.1 | TTATTGGGCCTTTATGGCCCATTAG | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT3G50210 | AT3G50210.1 | AGCCCATTAG | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G50210.2 | AGCCCATTAG | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G50210.3 | AGCCCATTAG | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G50590 | AT3G50590.1 | TTAAAGCCCATTTAGGCCCATTAAACGACA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink). |
| AT3G50808 | AT3G50808.1 | CTTAATGGGCCGA | unknown protein. |
| AT3G50920 | AT3G50920.1 | AAAAGCCCATTAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT3G50920.2 | AAAAGCCCATTAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT3G51010 | AT3G51010.1 | TATAGGCCCATAAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52040 | AT3G52040.1 | AGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52050 | AT3G52050.1 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.2 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.3 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.4 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.5 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52140 | AT3G52140.1 | AAAAAGCCCAAACAAAGCCCATTAG | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G15290.1); Has 9395 Blast hits to 2929 proteins in 282 species: Archae - 109; Bacteria - 2193; Metazoa - 5294; Fungi - 854; Plants - 176; Viruses - 9; Other Eukaryotes - 760 (source: NCBI BLink). |
| AT3G52220 | AT3G52220.1 | CTAATGGGCCTAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae - 10; Bacteria - 152; Metazoa - 4787; Fungi - 1223; Plants - 656; Viruses - 23; Other Eukaryotes - 2756 (source: NCBI BLink). |
| AT3G52230 | AT3G52230.1 | TTTAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52340 | AT3G52340.1 | TAATGGGCCAT | sucrose-phosphatase (SPP2) |
| AT3G52340.2 | TAATGGGCCAT | sucrose-phosphatase (SPP2) |
| AT3G52340.3 | TAATGGGCCAT | sucrose-phosphatase (SPP2) |
| AT3G52960 | AT3G52960.1 | GTAGGCCCATTAAGGCCCAATAACGGCGT | peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink). |
| AT3G53500 | AT3G53500.2 | TTAATGGGCTTTA | RSZ32; FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, RNA splicing; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: RSZ33; nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT2G37340.1); Has 19457 Blast hits to 16188 proteins in 516 species: Archae - 6; Bacteria - 235; Metazoa - 7507; Fungi - 1066; Plants - 1444; Viruses - 8093; Other Eukaryotes - 1106 (source: NCBI BLink). |
| AT3G53580 | AT3G53580.1 | CTTAATGGGCTTTTT | diaminopimelate epimerase family protein; FUNCTIONS IN: diaminopimelate epimerase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diaminopimelate epimerase, active site (InterPro:IPR018510), Diaminopimelate epimerase (InterPro:IPR001653); Has 5079 Blast hits to 5075 proteins in 1167 species: Archae - 51; Bacteria - 2343; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 2658 (source: NCBI BLink). |
| AT3G54210 | AT3G54210.1 | TATAGGCCCATTAAGGCCCATCA | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5385 Blast hits to 5385 proteins in 1530 species: Archae - 0; Bacteria - 3017; Metazoa - 102; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2110 (source: NCBI BLink). |
| AT3G54860 | AT3G54860.1 | TGAGGCCCATTA | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. |
| AT3G54860.2 | TGAGGCCCATTA | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. |
| AT3G55440 | AT3G55440.1 | TTAATGGGCCTAAAGCCCATA | Encodes triosephosphate isomerase. |
| AT3G55600 | AT3G55600.1 | TTAAAGCCCAGCCTAGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: cation exchanger, putative (CAX10) (TAIR:AT1G54110.1); Has 167 Blast hits to 167 proteins in 56 species: Archae - 0; Bacteria - 8; Metazoa - 84; Fungi - 28; Plants - 42; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G56210 | AT3G56210.1 | AAGGCCCATTAG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G56210.2 | AAGGCCCATTAG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G56210.4 | AAGGCCCATTAG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G56440 | AT3G56440.1 | AGAGGCCCATTAAG | AtATG18d; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18c (TAIR:AT2G40810.2); Has 1093 Blast hits to 1046 proteins in 176 species: Archae - 0; Bacteria - 24; Metazoa - 508; Fungi - 305; Plants - 110; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT3G56720 | AT3G56720.1 | TCAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5618 Blast hits to 4117 proteins in 284 species: Archae - 6; Bacteria - 147; Metazoa - 3194; Fungi - 606; Plants - 492; Viruses - 13; Other Eukaryotes - 1160 (source: NCBI BLink). |
| AT3G56860 | AT3G56860.1 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G56860.2 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G56860.3 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G56990 | AT3G56990.1 | AATAGGCCCATTAAG | embryo sac development arrest 7 (EDA7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: megagametogenesis; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NUC153 (InterPro:IPR012580), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 3435 Blast hits to 2597 proteins in 327 species: Archae - 0; Bacteria - 215; Metazoa - 1552; Fungi - 648; Plants - 432; Viruses - 52; Other Eukaryotes - 536 (source: NCBI BLink). |
| AT3G57000 | AT3G57000.1 | CTTAATGGGCCTATT | nucleolar essential protein-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis, methyltransferase, EMG1/NEP1 (InterPro:IPR005304); Has 1252 Blast hits to 912 proteins in 202 species: Archae - 94; Bacteria - 9; Metazoa - 674; Fungi - 138; Plants - 36; Viruses - 2; Other Eukaryotes - 299 (source: NCBI BLink). |
| AT3G57490 | AT3G57490.1 | TAATGGGCTTAT | 40S ribosomal protein S2 (RPS2D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 6002 Blast hits to 5992 proteins in 1677 species: Archae - 183; Bacteria - 2906; Metazoa - 580; Fungi - 160; Plants - 108; Viruses - 0; Other Eukaryotes - 2065 (source: NCBI BLink). |
| AT3G57900 | AT3G57900.1 | TTAATGGGCTTTAATTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: epidermis; Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G57910 | AT3G57910.1 | TTATTGGGCCTAATTAAAGCCCATTAA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT5G26610.2); Has 5088 Blast hits to 3153 proteins in 241 species: Archae - 10; Bacteria - 109; Metazoa - 2809; Fungi - 372; Plants - 190; Viruses - 44; Other Eukaryotes - 1554 (source: NCBI BLink). |
| AT3G57930 | AT3G57930.1 | CTAATGGGCCAAAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink). |
| AT3G57930.2 | CTAATGGGCCAAAGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42190.1); Has 1665 Blast hits to 1254 proteins in 137 species: Archae - 0; Bacteria - 32; Metazoa - 833; Fungi - 105; Plants - 87; Viruses - 30; Other Eukaryotes - 578 (source: NCBI BLink). |
| AT3G57940 | AT3G57940.1 | GTTTGGGCTTTGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1726 (InterPro:IPR013562), Protein of unknown function DUF699, ATPase putative (InterPro:IPR007807); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10490.1); Has 915 Blast hits to 873 proteins in 391 species: Archae - 82; Bacteria - 412; Metazoa - 163; Fungi - 92; Plants - 21; Viruses - 3; Other Eukaryotes - 142 (source: NCBI BLink). |
| AT3G58600 | AT3G58600.1 | AAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 43; Plants - 52; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT3G58600.1 | ATAATGGGCCTAGGCCTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 43; Plants - 52; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). |
| AT3G58610 | AT3G58610.1 | AATAGGCCTAGGCCCATTAT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink). |
| AT3G58610.1 | TTAATGGGCCTTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink). |
| AT3G58610.2 | AATAGGCCTAGGCCCATTAT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink). |
| AT3G58610.2 | TTAATGGGCCTTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink). |
| AT3G59540 | AT3G59540.1 | TTAATGGGCCTAAGGGGT | 60S ribosomal protein L38 (RPL38B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38A) (TAIR:AT2G43460.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT3G59990 | AT3G59990.1 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase |
| AT3G59990.2 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase |
| AT3G59990.3 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase |
| AT3G60640 | AT3G60640.1 | ATAATGGGCTTC | AUTOPHAGY 8G (ATG8G); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: ATG8F (autophagy 8f); microtubule binding (TAIR:AT4G16520.2); Has 1156 Blast hits to 1154 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 574; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink). |
| AT3G60820 | AT3G60820.1 | CAAAGCCCAAATAAGGCCCATTATAAAGCC | Encodes 20S proteasome beta subunit PBF1 (PBF1). |
| AT3G60820.2 | CAAAGCCCAAATAAGGCCCATTATAAAGCC | Encodes 20S proteasome beta subunit PBF1 (PBF1). |
| AT3G61860 | AT3G61860.1 | AAGGCCCATTAT | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. |
| AT3G61870 | AT3G61870.1 | ATAATGGGCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G61870.2 | ATAATGGGCCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT3G62080 | AT3G62080.1 | TTAATGGGCCGGGCCTAAT | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT3G62080.1 | TTAATGGGCCTGG | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT3G62360 | AT3G62360.1 | TAGTGGGCTTTATAAAGCCCATTAAGCCCTA | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT3G62370 | AT3G62370.1 | TAGGGCTTAATGGGCTTTATAAAGCCCACTA | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G62680 | AT3G62680.1 | TTAATGGGCCTAT | Proline-rich protein |
| AT3G62800 | AT3G62800.1 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. |
| AT3G62800.2 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. |
| AT3G62800.3 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression. |
| AT3G62810 | AT3G62810.1 | TTAATGGGCCAAAATTGGGCTTAT | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 68 Blast hits to 68 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 22; Plants - 17; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT3G62840 | AT3G62840.1 | TTAATGGGCTTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G62840.2 | TTAATGGGCTTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G63000 | AT3G63000.1 | TAAAAGCCCATTAT | NPL4-LIKE PROTEIN 1 (NPL41); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NPL4 (InterPro:IPR007717); BEST Arabidopsis thaliana protein match is: NPL4 family protein (TAIR:AT2G47970.1); Has 296 Blast hits to 296 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 86; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G63070 | AT3G63070.1 | ATAATGGGCTGA | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink). |
| AT3G63190 | AT3G63190.1 | TACGGCCCATTAAGGCCCACA | RIBOSOME RECYCLING FACTOR, CHLOROPLAST PRECURSOR (RRF); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: defense response to bacterium, translation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosome recycling factor, bacterial-like (InterPro:IPR015998), Ribosome recycling factor (InterPro:IPR002661); BEST Arabidopsis thaliana protein match is: ribosome recycling factor family protein / ribosome releasing factor family protein (TAIR:AT3G01800.1); Has 5492 Blast hits to 5492 proteins in 1475 species: Archae - 0; Bacteria - 2924; Metazoa - 104; Fungi - 52; Plants - 56; Viruses - 0; Other Eukaryotes - 2356 (source: NCBI BLink). |
| AT4G00500 | AT4G00500.1 | TTAATGGGCCTATA | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G00500.2 | TTAATGGGCCTATA | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G00520 | AT4G00520.2 | TATAGGCCCATTAA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink). |
| AT4G00520.3 | TATAGGCCCATTAA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink). |
| AT4G00840 | AT4G00840.1 | TTATTGGGCCTGTTAATGGGCCTTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G60800.1); Has 3992 Blast hits to 3990 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1955; Fungi - 533; Plants - 396; Viruses - 0; Other Eukaryotes - 1108 (source: NCBI BLink). |
| AT4G00850 | AT4G00850.1 | ATAAGGCCCATTAACAGGCCCAATAA | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA |
| AT4G01860 | AT4G01860.1 | TAAGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT4G01860.2 | TAAGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT4G02080 | AT4G02080.1 | CTAATGGGCTTG | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT4G02230 | AT4G02230.1 | AGGCCTATAATGGGCTTAG | 60S ribosomal protein L19 (RPL19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: emb2386 (embryo defective 2386); structural constituent of ribosome (TAIR:AT1G02780.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). |
| AT4G03280 | AT4G03280.1 | TAAGCCCATTAAG | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03280.2 | TAAGCCCATTAAG | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03430 | AT4G03430.1 | AAAAAGCCCATTAAAAAGCCCACTA | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G05410 | AT4G05410.1 | TTAATGGGCTCA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink). |
| AT4G09000 | AT4G09000.1 | AAAAAGCCCATTAA | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09000.2 | AAAAAGCCCATTAA | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09730 | AT4G09730.1 | CTTAATGGGCCAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT3G06980.1); Has 26614 Blast hits to 26065 proteins in 1716 species: Archae - 427; Bacteria - 10484; Metazoa - 4922; Fungi - 3195; Plants - 1331; Viruses - 9; Other Eukaryotes - 6246 (source: NCBI BLink). |
| AT4G10180 | AT4G10180.1 | TCAGGCCCATTAA | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling. |
| AT4G10250 | AT4G10250.1 | ATAATGGGCCAAT | Columbia endomembrane-localized small heat shock protein |
| AT4G10320 | AT4G10320.1 | TACGGCCCATTAA | isoleucyl-tRNA synthetase, putative / isoleucine--tRNA ligase, putative; FUNCTIONS IN: isoleucine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: male gametophyte, guard cell, epidermis, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Isoleucyl-tRNA synthetase (InterPro:IPR018353), Isoleucyl-tRNA synthetase, class Ia (InterPro:IPR002301), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Isoleucyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015905), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ catalytic/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.1); Has 27648 Blast hits to 24183 proteins in 1801 species: Archae - 699; Bacteria - 11987; Metazoa - 692; Fungi - 480; Plants - 135; Viruses - 0; Other Eukaryotes - 13655 (source: NCBI BLink). |
| AT4G10320.1 | TTAATGGGCTTA | isoleucyl-tRNA synthetase, putative / isoleucine--tRNA ligase, putative; FUNCTIONS IN: isoleucine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: male gametophyte, guard cell, epidermis, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Isoleucyl-tRNA synthetase (InterPro:IPR018353), Isoleucyl-tRNA synthetase, class Ia (InterPro:IPR002301), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Isoleucyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015905), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ catalytic/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.1); Has 27648 Blast hits to 24183 proteins in 1801 species: Archae - 699; Bacteria - 11987; Metazoa - 692; Fungi - 480; Plants - 135; Viruses - 0; Other Eukaryotes - 13655 (source: NCBI BLink). |
| AT4G10480 | AT4G10480.1 | CTAAGGCCCATTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G10480.1 | CTAATGGGCTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G10480.2 | CTAAGGCCCATTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G10480.2 | CTAATGGGCTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G11120 | AT4G11120.1 | CTTAATGGGCCAT | translation elongation factor Ts (EF-Ts), putative; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Translation elongation factor Ts, conserved site (InterPro:IPR018101), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), UBA-like (InterPro:IPR009060), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039); BEST Arabidopsis thaliana protein match is: emb2726 (embryo defective 2726); RNA binding / translation elongation factor (TAIR:AT4G29060.1); Has 6692 Blast hits to 6063 proteins in 1504 species: Archae - 0; Bacteria - 3293; Metazoa - 104; Fungi - 16; Plants - 114; Viruses - 0; Other Eukaryotes - 3165 (source: NCBI BLink). |
| AT4G13830 | AT4G13830.1 | CTAATGGGCT | DnaJ-like protein (J20); nuclear gene |
| AT4G13830.2 | CTAATGGGCT | DnaJ-like protein (J20); nuclear gene |
| AT4G14145 | AT4G14145.1 | TACTGGGCTGGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14270 | AT4G14270.1 | CTTAATGGGCTTATGGGCTTC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G14270.2 | CTTAATGGGCTTATGGGCTTC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G14300 | AT4G14300.1 | TAGCCCATTAT | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT2G33410.1); Has 82956 Blast hits to 37358 proteins in 1472 species: Archae - 56; Bacteria - 18252; Metazoa - 33610; Fungi - 7047; Plants - 9752; Viruses - 546; Other Eukaryotes - 13693 (source: NCBI BLink). |
| AT4G14320 | AT4G14320.1 | TTAATGGGCTTTTT | 60S ribosomal protein L36a/L44 (RPL36aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aA) (TAIR:AT3G23390.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT4G14330 | AT4G14330.1 | AAAAAGCCCATTAA | phragmoplast-associated kinesin-related protein 2 (PAKRP2); FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: phragmoplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATK1 (ARABIDOPSIS THALIANA KINESIN 1); microtubule motor/ minus-end-directed microtubule motor (TAIR:AT4G21270.1); Has 19997 Blast hits to 14982 proteins in 632 species: Archae - 102; Bacteria - 784; Metazoa - 9932; Fungi - 1679; Plants - 1066; Viruses - 71; Other Eukaryotes - 6363 (source: NCBI BLink). |
| AT4G14490 | AT4G14490.1 | TAAAAGCCCATTTAAGGCCCATTAA | forkhead-associated domain-containing protein / FHA domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253); BEST Arabidopsis thaliana protein match is: forkhead-associated domain-containing protein / FHA domain-containing protein / AT hook motif-containing protein (TAIR:AT3G02400.1); Has 1075 Blast hits to 1048 proteins in 243 species: Archae - 14; Bacteria - 671; Metazoa - 68; Fungi - 54; Plants - 81; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink). |
| AT4G15030 | AT4G15030.1 | TACGGCCCAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT4G15030.2 | TACGGCCCAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT4G15240 | AT4G15240.1 | TTAATGGGCCGA | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT1G05280.1); Has 368 Blast hits to 364 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 109; Plants - 125; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT4G15410 | AT4G15410.1 | TTTGGGCCCATTAA | Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma (PUX5); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBX (InterPro:IPR001012), SEP (InterPro:IPR012989), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: PUX4; protein binding (TAIR:AT4G04210.1); Has 2169 Blast hits to 897 proteins in 184 species: Archae - 0; Bacteria - 87; Metazoa - 456; Fungi - 202; Plants - 88; Viruses - 16; Other Eukaryotes - 1320 (source: NCBI BLink). |
| AT4G15930 | AT4G15930.1 | ATAATGGGCCTGA | microtubule motor; FUNCTIONS IN: microtubule motor activity; INVOLVED IN: microtubule-based process; LOCATED IN: microtubule associated complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dynein light chain, type 1 and 2 (InterPro:IPR001372); BEST Arabidopsis thaliana protein match is: dynein light chain, putative (TAIR:AT5G20110.1); Has 980 Blast hits to 980 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 538; Fungi - 74; Plants - 124; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT4G16580 | AT4G16580.1 | GCCCATTAA | catalytic; FUNCTIONS IN: catalytic activity; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932); BEST Arabidopsis thaliana protein match is: 5-azacytidine resistance protein -related (TAIR:AT5G66720.1); Has 560 Blast hits to 550 proteins in 150 species: Archae - 0; Bacteria - 2; Metazoa - 153; Fungi - 152; Plants - 117; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). |
| AT4G16630 | AT4G16630.1 | ATAAGCCCATTAA | DEAD/DEAH box helicase, putative (RH28); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G16280.1); Has 75014 Blast hits to 49574 proteins in 2104 species: Archae - 542; Bacteria - 21437; Metazoa - 22382; Fungi - 7369; Plants - 2826; Viruses - 629; Other Eukaryotes - 19829 (source: NCBI BLink). |
| AT4G16695 | AT4G16695.1 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.1 | CAAAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.2 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.2 | CAAAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.3 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16695.3 | CAAAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G17020 | AT4G17020.1 | ATAGGCCCATTAG | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT4G17020.1 | CAAGGCCCATTAA | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT4G17020.2 | ATAGGCCCATTAG | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT4G17020.2 | CAAGGCCCATTAA | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT4G17390 | AT4G17390.1 | ATAATGGGCCATA | 60S ribosomal protein L15 (RPL15B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15A) (TAIR:AT4G16720.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT4G17410 | AT4G17410.1 | TATGGCCCATTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G47430.1); Has 8731 Blast hits to 6294 proteins in 276 species: Archae - 2; Bacteria - 71; Metazoa - 5540; Fungi - 1215; Plants - 632; Viruses - 56; Other Eukaryotes - 1215 (source: NCBI BLink). |
| AT4G17530 | AT4G17530.1 | ATTAGGCCCATTAT | ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae - 17; Bacteria - 111; Metazoa - 13220; Fungi - 2827; Plants - 2160; Viruses - 19; Other Eukaryotes - 5239 (source: NCBI BLink). |
| AT4G17530.1 | TTAATGGGCCTTAG | ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae - 17; Bacteria - 111; Metazoa - 13220; Fungi - 2827; Plants - 2160; Viruses - 19; Other Eukaryotes - 5239 (source: NCBI BLink). |
| AT4G17540 | AT4G17540.1 | ATAATGGGCCTAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae - 4; Bacteria - 22; Metazoa - 9; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G17540.1 | CTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae - 4; Bacteria - 22; Metazoa - 9; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G17840 | AT4G17840.1 | AAAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35260.1); Has 1905 Blast hits to 183 proteins in 52 species: Archae - 0; Bacteria - 24; Metazoa - 708; Fungi - 70; Plants - 25; Viruses - 2; Other Eukaryotes - 1076 (source: NCBI BLink). |
| AT4G17960 | AT4G17960.1 | GTGGGCTTTTATTAATGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46620.1); Has 22 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18140 | AT4G18140.1 | ATATGGGCCTAAGCCCATTAT | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18140.2 | ATATGGGCCTAAGCCCATTAT | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18975 | AT4G18975.1 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18975.2 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18975.3 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G19350 | AT4G19350.1 | TAATGGGCCGT | embryo defective 3006 (EMB3006); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G20300 | AT4G20300.1 | TAGTGGGCCTGATAATGGGCCGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G20300.2 | TAGTGGGCCTGATAATGGGCCGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G20480 | AT4G20480.1 | GTAGGCCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G06810.1); Has 76 Blast hits to 74 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G21190 | AT4G21190.1 | TTAATGGGCCTATT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G21190.1 | TTAATGGGCCTATT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G21190.1 | TTAATGGGCCTTAT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT4G21192 | AT4G21192.1 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G21192.1 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G21192.1 | ATAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G21192.2 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G21192.2 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G21192.2 | ATAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G22756 | AT4G22756.1 | ATAATGGGCTTTTA | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase. |
| AT4G22910 | AT4G22910.1 | CAAGCCCATTAA | FIZZY-RELATED 2 (FZR2); FUNCTIONS IN: signal transducer activity; INVOLVED IN: trichome branching, signal transduction, DNA endoreduplication, cell growth; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: CCS52A2; signal transducer (TAIR:AT4G11920.1); Has 32185 Blast hits to 17091 proteins in 521 species: Archae - 40; Bacteria - 4571; Metazoa - 14163; Fungi - 6386; Plants - 2781; Viruses - 0; Other Eukaryotes - 4244 (source: NCBI BLink). |
| AT4G23680 | AT4G23680.1 | GCCCATTAA | major latex protein-related / MLP-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT4G23670.1); Has 219 Blast hits to 199 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 219; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G23710 | AT4G23710.1 | TTAATGGGCCTGA | VAG2; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances; INVOLVED IN: proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar (H+)-ATPase G subunit (InterPro:IPR005124); BEST Arabidopsis thaliana protein match is: VMA10 (VACUOLAR MEMBRANE ATPASE 10); hydrogen ion transporting ATP synthase, rotational mechanism (TAIR:AT3G01390.2); Has 470 Blast hits to 470 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 268; Fungi - 80; Plants - 75; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT4G24500 | AT4G24500.1 | TTAATGGGCCGGTTTAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G24500.2 | TTAATGGGCCGGTTTAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). |
| AT4G24690 | AT4G24690.1 | AGGGCCCATTAA | ubiquitin-associated (UBA)/TS-N domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Zinc finger, ZZ-type (InterPro:IPR000433); Has 492 Blast hits to 472 proteins in 101 species: Archae - 0; Bacteria - 6; Metazoa - 329; Fungi - 68; Plants - 57; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G25360 | AT4G25360.1 | TTAATGGGCT | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: YLS7 (TAIR:AT5G51640.1); Has 699 Blast hits to 688 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25360.2 | TTAATGGGCT | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: YLS7 (TAIR:AT5G51640.1); Has 699 Blast hits to 688 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25570 | AT4G25570.1 | ATAATGGGCCTTAA | Encodes cytochrome b561. |
| AT4G26310 | AT4G26310.1 | TTAAGGCCCATTAT | elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink). |
| AT4G26310.1 | TTAATGGGCTA | elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink). |
| AT4G26400 | AT4G26400.1 | TTAATGGGCTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7059 Blast hits to 7033 proteins in 227 species: Archae - 0; Bacteria - 6; Metazoa - 2361; Fungi - 631; Plants - 2786; Viruses - 51; Other Eukaryotes - 1224 (source: NCBI BLink). |
| AT4G26400.2 | TTAATGGGCTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7059 Blast hits to 7033 proteins in 227 species: Archae - 0; Bacteria - 6; Metazoa - 2361; Fungi - 631; Plants - 2786; Viruses - 51; Other Eukaryotes - 1224 (source: NCBI BLink). |
| AT4G26410 | AT4G26410.1 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022280 (InterPro:IPR016803); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45060.1); Has 47 Blast hits to 47 proteins in 12 species: Archae - 3; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 40; Viruses - 1; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G26600 | AT4G26600.1 | AGCCCATTAG | nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink). |
| AT4G26600.1 | CAAGCCCATTAAG | nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink). |
| AT4G26600.1 | TCAGGCCCATTAG | nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink). |
| AT4G26720 | AT4G26720.1 | TCTGGGCCCATTAT | Encodes catalytic subunit of protein phosphatase X. Expressed at very low levels in A. thaliana flowers, leaves, stems and roots. |
| AT4G26760 | AT4G26760.1 | TAAGCCCATTAAG | MAP65-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anaphase; LOCATED IN: cortical microtubule, preprophase band, phragmoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MAP65/ASE1 (InterPro:IPR007145); BEST Arabidopsis thaliana protein match is: ATMAP65-1 (MICROTUBULE-ASSOCIATED PROTEINS 65-1); microtubule binding (TAIR:AT5G55230.1); Has 7158 Blast hits to 5289 proteins in 462 species: Archae - 120; Bacteria - 495; Metazoa - 4190; Fungi - 430; Plants - 357; Viruses - 13; Other Eukaryotes - 1553 (source: NCBI BLink). |
| AT4G26840 | AT4G26840.1 | ATAAGCCCATTAT | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
| AT4G26990 | AT4G26990.1 | ATAAGGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54920.1); Has 176 Blast hits to 161 proteins in 44 species: Archae - 0; Bacteria - 4; Metazoa - 71; Fungi - 20; Plants - 57; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT4G27000 | AT4G27000.1 | ATAATGGGCCGA | ATRBP45C; FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45A (RNA-binding protein 45A); RNA binding (TAIR:AT5G54900.1); Has 24066 Blast hits to 14859 proteins in 588 species: Archae - 10; Bacteria - 1237; Metazoa - 14401; Fungi - 2729; Plants - 3582; Viruses - 5; Other Eukaryotes - 2102 (source: NCBI BLink). |
| AT4G27320 | AT4G27320.1 | ACGGCCCATTAT | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
| AT4G27520 | AT4G27520.1 | TTAGCCCATTAT | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT5G53870.1); Has 143503 Blast hits to 63556 proteins in 1855 species: Archae - 183; Bacteria - 22350; Metazoa - 60212; Fungi - 22770; Plants - 10839; Viruses - 3626; Other Eukaryotes - 23523 (source: NCBI BLink). |
| AT4G27740 | AT4G27740.1 | ATGGCCCATTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27745.1); Has 684 Blast hits to 682 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). |
| AT4G28060 | AT4G28060.1 | CTTAGGCCCATTAG | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT5G57815.1); Has 406 Blast hits to 406 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 235; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT4G28450 | AT4G28450.1 | AAAAAGCCCATTAAG | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT4G28730 | AT4G28730.1 | AAAACGCCCATTAG | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae - 0; Bacteria - 1253; Metazoa - 362; Fungi - 221; Plants - 386; Viruses - 107; Other Eukaryotes - 817 (source: NCBI BLink). |
| AT4G28730.1 | TATAGGCCCATTAAG | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae - 0; Bacteria - 1253; Metazoa - 362; Fungi - 221; Plants - 386; Viruses - 107; Other Eukaryotes - 817 (source: NCBI BLink). |
| AT4G29390 | AT4G29390.1 | CTAATGGGCCGTA | 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT4G29390.1 | TATAGGCCCATTAAG | 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT4G29400 | AT4G29400.1 | CTTAATGGGCCTATA | unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink). |
| AT4G29400.1 | TACGGCCCATTAG | unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink). |
| AT4G29520 | AT4G29520.1 | TTAATGGGCCTTAC | LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 120 Blast hits to 120 proteins in 43 species: Archae - 2; Bacteria - 0; Metazoa - 42; Fungi - 10; Plants - 19; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT4G29530 | AT4G29530.1 | GTAAGGCCCATTAA | 2,3-diketo-5-methylthio-1-phosphopentane phosphatase family; FUNCTIONS IN: phosphatase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G17710.1); Has 269 Blast hits to 267 proteins in 80 species: Archae - 0; Bacteria - 19; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT4G29820 | AT4G29820.1 | ACAGGCCCATTA | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit. |
| AT4G29820.1 | TAAAGGCCCATTAA | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit. |
| AT4G29830 | AT4G29830.1 | TTAATGGGCCTGT | The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin. |
| AT4G29830.1 | TTAATGGGCCTTTA | The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin. |
| AT4G29840 | AT4G29840.1 | TTAATGGGCCCAAAA | threonine synthase |
| AT4G30220 | AT4G30220.1 | ATAATGGGCCTTAT | SMALL NUCLEAR RIBONUCLEOPROTEIN F (RUXF); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small nuclear ribonucleoprotein SmF (InterPro:IPR016487), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14285.1); Has 865 Blast hits to 865 proteins in 209 species: Archae - 256; Bacteria - 0; Metazoa - 220; Fungi - 185; Plants - 64; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT4G30220.1 | CAGGCCCATTAT | SMALL NUCLEAR RIBONUCLEOPROTEIN F (RUXF); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small nuclear ribonucleoprotein SmF (InterPro:IPR016487), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14285.1); Has 865 Blast hits to 865 proteins in 209 species: Archae - 256; Bacteria - 0; Metazoa - 220; Fungi - 185; Plants - 64; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT4G30480 | AT4G30480.1 | CTTAATGGGCCAAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). |
| AT4G30480.2 | CTTAATGGGCCAAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). |
| AT4G30480.3 | CTTAATGGGCCAAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink). |
| AT4G30620 | AT4G30620.1 | TAAAAGCCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24020.1); Has 1303 Blast hits to 1303 proteins in 522 species: Archae - 0; Bacteria - 1050; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT4G30630 | AT4G30630.1 | TAATGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57910.1); Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30750 | AT4G30750.1 | CTTAATGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30760 | AT4G30760.1 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30760.2 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31010 | AT4G31010.1 | CTAATGGGCCCTA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31010.2 | CTAATGGGCCCTA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31120 | AT4G31120.1 | ATAAAGCCCATTAGAAAAGCCC | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
| AT4G31120.2 | ATAAAGCCCATTAGAAAAGCCC | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
| AT4G31150 | AT4G31150.1 | ATAATGGGCCTTTTAAAGGCCC | endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G31150.2 | ATAATGGGCCTTTTAAAGGCCC | endonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT4G31560 | AT4G31560.1 | TTAATGGGCCTC | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane. |
| AT4G31930 | AT4G31930.1 | GAAGCCCATTAA | mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 212 Blast hits to 212 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 66; Plants - 109; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT4G32390 | AT4G32390.1 | ATAAGCCCATTAG | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT2G25520.1); Has 1575 Blast hits to 1573 proteins in 180 species: Archae - 0; Bacteria - 6; Metazoa - 425; Fungi - 287; Plants - 687; Viruses - 0; Other Eukaryotes - 170 (source: NCBI BLink). |
| AT4G32680 | AT4G32680.1 | GAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G32690 | AT4G32690.1 | ATAATGGGCTTC | Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. |
| AT4G32820 | AT4G32820.1 | AATAGGCCCATTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026). |
| AT4G32820.2 | AATAGGCCCATTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026). |
| AT4G33060 | AT4G33060.1 | TTAATGGGCTGGGCTTAG | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 18511 Blast hits to 16644 proteins in 1616 species: Archae - 90; Bacteria - 4190; Metazoa - 5100; Fungi - 1622; Plants - 926; Viruses - 34; Other Eukaryotes - 6549 (source: NCBI BLink). |
| AT4G34270 | AT4G34270.1 | TTAAAGCCCATTAAG | TIP41-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: TIP41-like protein (InterPro:IPR007303); Has 248 Blast hits to 248 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G34620 | AT4G34620.1 | CTAATGGGCTTA | Encodes ribosomal protein S16, has embryo-defective lethal mutant phenotype |
| AT4G34700 | AT4G34700.1 | TTAATGGGCCGAT | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 51; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT4G34960 | AT4G34960.1 | ATGGCCCATTAG | peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP5 (CYCLOPHILIN 5); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G29960.1); Has 11230 Blast hits to 11218 proteins in 1505 species: Archae - 82; Bacteria - 3582; Metazoa - 2365; Fungi - 952; Plants - 729; Viruses - 4; Other Eukaryotes - 3516 (source: NCBI BLink). |
| AT4G35140 | AT4G35140.1 | TTAGCCCATTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae - 10; Bacteria - 1449; Metazoa - 3242; Fungi - 1387; Plants - 483; Viruses - 0; Other Eukaryotes - 1167 (source: NCBI BLink). |
| AT4G35490 | AT4G35490.1 | CTAATGGGCTAA | MITOCHONDRIAL RIBOSOMAL PROTEIN L11 (MRPL11); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11, bacterial-type (InterPro:IPR006519), Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: PRPL11 (PLASTID RIBOSOMAL PROTEIN L11); structural constituent of ribosome (TAIR:AT1G32990.1); Has 5744 Blast hits to 5744 proteins in 1575 species: Archae - 191; Bacteria - 2960; Metazoa - 99; Fungi - 83; Plants - 65; Viruses - 0; Other Eukaryotes - 2346 (source: NCBI BLink). |
| AT4G35730 | AT4G35730.1 | CAAAGCCCATCTAAGCCCATTAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT4G35730.1 | GAAGCCCATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT4G35890 | AT4G35890.1 | GCCCATTA | La domain-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630); BEST Arabidopsis thaliana protein match is: La domain-containing protein (TAIR:AT5G66100.1); Has 8713 Blast hits to 4009 proteins in 397 species: Archae - 0; Bacteria - 644; Metazoa - 2811; Fungi - 1022; Plants - 283; Viruses - 52; Other Eukaryotes - 3901 (source: NCBI BLink). |
| AT4G36690 | AT4G36690.1 | ATAATGGGCCTTAT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G36690.2 | ATAATGGGCCTTAT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G36690.3 | ATAATGGGCCTTAT | ATU2AF65A; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: U2 snRNP auxiliary factor large subunit, putative (TAIR:AT1G60900.1); Has 58634 Blast hits to 28369 proteins in 1184 species: Archae - 55; Bacteria - 3616; Metazoa - 33617; Fungi - 6101; Plants - 4473; Viruses - 271; Other Eukaryotes - 10501 (source: NCBI BLink). |
| AT4G36800 | AT4G36800.1 | AAATGGGCCTAACGGGCTTTAATGGGCCAA | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1. |
| AT4G36800.2 | AAATGGGCCTAACGGGCTTTAATGGGCCAA | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1. |
| AT4G37040 | AT4G37040.1 | TTGGCCCATTAATAGCCCAATAT | encodes a methionine aminopeptidase |
| AT4G37090 | AT4G37090.1 | TTAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). |
| AT4G37090.2 | TTAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). |
| AT4G37340 | AT4G37340.1 | TAAACGACTAATGGGC | member of CYP81D |
| AT4G37830 | AT4G37830.1 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT4G37830.2 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT4G37880 | AT4G37880.1 | ATAATGGGCTTTTT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22690.2); Has 631 Blast hits to 627 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 324; Fungi - 158; Plants - 74; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G38225 | AT4G38225.1 | ATTAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.2 | ATTAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.3 | ATTAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38280 | AT4G38280.1 | ATAATGGGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45250.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38380 | AT4G38380.1 | AGTGGGCTTTAATGGGCTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink). |
| AT4G38890 | AT4G38890.1 | TTATGGGCCGGTTTTTGGCCCATTAA | dihydrouridine synthase family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: oxidation reduction, tRNA processing, metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7322 Blast hits to 7247 proteins in 1396 species: Archae - 11; Bacteria - 4174; Metazoa - 431; Fungi - 362; Plants - 91; Viruses - 0; Other Eukaryotes - 2253 (source: NCBI BLink). |
| AT4G39080 | AT4G39080.1 | GAAGCCCATTAAAAGCCCAATA | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. |
| AT4G39460 | AT4G39460.1 | TATAGGCCCATTAG | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
| AT4G39470 | AT4G39470.1 | CTAATGGGCTATT | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: tetratricopeptide repeat (TPR)-containing protein (TAIR:AT3G18420.1); Has 1025 Blast hits to 856 proteins in 182 species: Archae - 118; Bacteria - 326; Metazoa - 111; Fungi - 9; Plants - 62; Viruses - 0; Other Eukaryotes - 399 (source: NCBI BLink). |
| AT4G39560 | AT4G39560.1 | TGAGGCCCATTAAG | kelch repeat-containing F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), EF-HAND 1 (InterPro:IPR018247), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2608 Blast hits to 2033 proteins in 134 species: Archae - 4; Bacteria - 110; Metazoa - 1739; Fungi - 7; Plants - 628; Viruses - 37; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT4G39560.2 | TGAGGCCCATTAAG | kelch repeat-containing F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), EF-HAND 1 (InterPro:IPR018247), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2608 Blast hits to 2033 proteins in 134 species: Archae - 4; Bacteria - 110; Metazoa - 1739; Fungi - 7; Plants - 628; Viruses - 37; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT4G39880 | AT4G39880.1 | TTCGGCCCATTAAGGCCCATTAA | ribosomal protein L23 family protein; FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L23/L15e, core (InterPro:IPR012678), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal protein L25/L23 (InterPro:IPR013025); Has 2011 Blast hits to 2011 proteins in 690 species: Archae - 0; Bacteria - 1392; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 592 (source: NCBI BLink). |
| AT4G40040 | AT4G40040.1 | TGAGCCCATTAA | histone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink). |
| AT4G40040.2 | TGAGCCCATTAA | histone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink). |
| AT4G40042 | AT4G40042.1 | TTAATGGGCTCA | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, integral to membrane, signal peptidase complex; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT2G22425.2); Has 218 Blast hits to 218 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 56; Plants - 39; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G01020 | AT5G01020.1 | ATAATGGGCCTAG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G05940.1); Has 84930 Blast hits to 83819 proteins in 2999 species: Archae - 48; Bacteria - 7829; Metazoa - 37401; Fungi - 6493; Plants - 18635; Viruses - 347; Other Eukaryotes - 14177 (source: NCBI BLink). |
| AT5G01400 | AT5G01400.1 | AATAGGCCCACATCGGCCCATTAT | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
| AT5G02050 | AT5G02050.1 | TATGGCCCATTAAGTAATTGGGCCTTAT | mitochondrial glycoprotein family protein / MAM33 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT3G55605.1); Has 329 Blast hits to 328 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 39; Fungi - 94; Plants - 115; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT5G02150 | AT5G02150.1 | CAATTGGGCCTGTTAAGCCCATTAT | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT5G02150.2 | CAATTGGGCCTGTTAAGCCCATTAT | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT5G02160 | AT5G02160.1 | ATAATGGGCTTAACAGGCCCAATTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G02530 | AT5G02530.1 | AAAAGGCCCATTAAG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G59950.4); Has 10734 Blast hits to 7876 proteins in 597 species: Archae - 2; Bacteria - 1111; Metazoa - 4776; Fungi - 1622; Plants - 1564; Viruses - 50; Other Eukaryotes - 1609 (source: NCBI BLink). |
| AT5G02610 | AT5G02610.1 | ACGGCCCATTAT | 60S ribosomal protein L35 (RPL35D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 840 Blast hits to 840 proteins in 308 species: Archae - 109; Bacteria - 145; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink). |
| AT5G02790 | AT5G02790.1 | TACGGCCCATTAT | In2-1 protein, putative; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: In2-1 protein, putative (TAIR:AT5G02780.1); Has 2811 Blast hits to 2774 proteins in 481 species: Archae - 2; Bacteria - 698; Metazoa - 592; Fungi - 122; Plants - 984; Viruses - 0; Other Eukaryotes - 413 (source: NCBI BLink). |
| AT5G02960 | AT5G02960.1 | CTTAATGGGCCTAC | 40S ribosomal protein S23 (RPS23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S23, eukaryotic/archaeal (InterPro:IPR005680), Ribosomal protein S12/S23 (InterPro:IPR006032), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S23 (RPS23A) (TAIR:AT3G09680.1); Has 6124 Blast hits to 6121 proteins in 1817 species: Archae - 180; Bacteria - 2807; Metazoa - 329; Fungi - 198; Plants - 755; Viruses - 0; Other Eukaryotes - 1855 (source: NCBI BLink). |
| AT5G03030 | AT5G03030.1 | CAAAGCCCATTAG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G35795.1); Has 692 Blast hits to 692 proteins in 215 species: Archae - 0; Bacteria - 135; Metazoa - 169; Fungi - 136; Plants - 46; Viruses - 2; Other Eukaryotes - 204 (source: NCBI BLink). |
| AT5G03430 | AT5G03430.1 | GAAGCCCATTAT | phosphoadenosine phosphosulfate (PAPS) reductase family protein; FUNCTIONS IN: transferase activity; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Molybdopterin binding (InterPro:IPR001453), Phosphoadenosine phosphosulphate reductase (InterPro:IPR002500); Has 3440 Blast hits to 3362 proteins in 916 species: Archae - 114; Bacteria - 1592; Metazoa - 215; Fungi - 195; Plants - 24; Viruses - 0; Other Eukaryotes - 1300 (source: NCBI BLink). |
| AT5G03770 | AT5G03770.1 | TTAATGGGCTTAAGGCC | 3-deoxy-D-manno-octulosonic acid transferase-related; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Three-deoxy-D-manno-octulosonic-acid transferase, N-terminal (InterPro:IPR007507); Has 3832 Blast hits to 3832 proteins in 736 species: Archae - 0; Bacteria - 1449; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 2371 (source: NCBI BLink). |
| AT5G03880 | AT5G03880.1 | TTAAGGCCCAAAAGTAAGGCCCATTAAG | electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae - 48; Bacteria - 196; Metazoa - 1; Fungi - 33; Plants - 60; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT5G03880.1 | TTAAGGCCCAAAATTAAGGCCCATTAT | electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae - 48; Bacteria - 196; Metazoa - 1; Fungi - 33; Plants - 60; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT5G04800 | AT5G04800.1 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G04800.2 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G04800.3 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G04800.4 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G05670 | AT5G05670.1 | TTAATGGGCTTTTATTCGGCCCATTAA | signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae - 2; Bacteria - 40; Metazoa - 443; Fungi - 156; Plants - 102; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT5G05670.2 | TTAATGGGCTTTTATTCGGCCCATTAA | signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae - 2; Bacteria - 40; Metazoa - 443; Fungi - 156; Plants - 102; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT5G05680 | AT5G05680.1 | TTAATGGGCCGAATAAAAGCCCATTAA | nuclear pore complex protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; Has 361 Blast hits to 348 proteins in 84 species: Archae - 2; Bacteria - 20; Metazoa - 218; Fungi - 31; Plants - 27; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT5G06310 | AT5G06310.1 | CGGCCCATTAA | Encodes AtPOT1b. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b. |
| AT5G06360 | AT5G06360.1 | AAAGCCCATTAT | ribosomal protein S8e family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047); Has 361 Blast hits to 360 proteins in 172 species: Archae - 6; Bacteria - 2; Metazoa - 152; Fungi - 111; Plants - 23; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G06360.1 | TTAGCCCATTAA | ribosomal protein S8e family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047); Has 361 Blast hits to 360 proteins in 172 species: Archae - 6; Bacteria - 2; Metazoa - 152; Fungi - 111; Plants - 23; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G07920 | AT5G07920.1 | TAATGGGCCTGGGCCCT | diacylglycerol kinase |
| AT5G08270 | AT5G08270.1 | CCATTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23200.1); Has 51 Blast hits to 51 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G08270.1 | TTAAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23200.1); Has 51 Blast hits to 51 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G08540 | AT5G08540.1 | AAAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G08670 | AT5G08670.1 | ATAGGCCCAACTAAGCCCATTAACTAAGCCCAC | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G08690 | AT5G08690.1 | ATAAGCCCATTAT | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G08690.1 | ATAAGCCCATTAT | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G09390 | AT5G09390.1 | TCAGCCCATTAATACGGCCCAATT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT5G09390.2 | TCAGCCCATTAATACGGCCCAATT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT5G09450 | AT5G09450.1 | CATGGGCCCATTAG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G09450.1 | CTAATGGGCTGA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G09740 | AT5G09740.1 | CTAATGGGCCTGA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT5G09740.2 | CTAATGGGCCTGA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT5G09900 | AT5G09900.1 | ATGGCCCATTAG | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT5G09900.2 | ATGGCCCATTAG | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT5G09900.3 | ATGGCCCATTAG | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT5G10110 | AT5G10110.1 | ATAATGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10160 | AT5G10160.1 | CTAATGGGCTTAG | beta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). |
| AT5G10350 | AT5G10350.1 | ATAATGGGCT | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10350.2 | ATAATGGGCT | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10700 | AT5G10700.1 | TAAAAGCCCATTAAG | aminoacyl-tRNA hydrolase/ protein tyrosine phosphatase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity, protein tyrosine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, translation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833), Protein-tyrosine phosphatase, low molecular weight (InterPro:IPR017867); Has 128 Blast hits to 128 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 81; Fungi - 6; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT5G10710 | AT5G10710.1 | CTTAATGGGCTTTTA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10710.2 | CTTAATGGGCTTTTA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10740 | AT5G10740.1 | AATAGGCCCATTAGCCCAATTG | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae - 9; Bacteria - 1045; Metazoa - 1489; Fungi - 552; Plants - 1360; Viruses - 11; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT5G10745 | AT5G10745.1 | CAATTGGGCTAATGGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10780 | AT5G10780.1 | TAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT5G10780.2 | TAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT5G11150 | AT5G11150.1 | ATAATGGGCCTTG | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. |
| AT5G11170 | AT5G11170.1 | TTTAGGCCCATTAA | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus; EXPRESSED IN: guard cell, root, cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G11200.1); Has 28546 Blast hits to 28139 proteins in 1749 species: Archae - 514; Bacteria - 11832; Metazoa - 5046; Fungi - 3322; Plants - 1384; Viruses - 50; Other Eukaryotes - 6398 (source: NCBI BLink). |
| AT5G11200 | AT5G11200.1 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G11200.2 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G11200.3 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G11580 | AT5G11580.1 | TTAATGGGCCTATT | UVB-resistance protein-related / regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: chromatin binding, Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15654 Blast hits to 4338 proteins in 271 species: Archae - 65; Bacteria - 1617; Metazoa - 6245; Fungi - 716; Plants - 1411; Viruses - 0; Other Eukaryotes - 5600 (source: NCBI BLink). |
| AT5G12290 | AT5G12290.1 | TACTGGGCCCATTAAAAGCCCAATAAG | Encodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background. |
| AT5G13190 | AT5G13190.1 | AAAAGGCCCATTAAG | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LPS-induced tumor necrosis factor alpha factor (InterPro:IPR006629); Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G13250 | AT5G13250.1 | GCCCATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28080.1); Has 1127 Blast hits to 1024 proteins in 44 species: Archae - 0; Bacteria - 2; Metazoa - 35; Fungi - 35; Plants - 7; Viruses - 0; Other Eukaryotes - 1048 (source: NCBI BLink). |
| AT5G13310 | AT5G13310.1 | CCATTAAGCCAGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13970.1); Has 356 Blast hits to 305 proteins in 95 species: Archae - 0; Bacteria - 44; Metazoa - 138; Fungi - 38; Plants - 34; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT5G13970 | AT5G13970.1 | TGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13310.1); Has 608 Blast hits to 543 proteins in 119 species: Archae - 2; Bacteria - 47; Metazoa - 119; Fungi - 63; Plants - 38; Viruses - 17; Other Eukaryotes - 322 (source: NCBI BLink). |
| AT5G14030 | AT5G14030.1 | GTAGGCCCATTAT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.2 | GTAGGCCCATTAT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.3 | GTAGGCCCATTAT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.4 | GTAGGCCCATTAT | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14220 | AT5G14220.1 | ATAATGGGCCTGA | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. |
| AT5G15020 | AT5G15020.1 | TAAGCCCATTAT | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT5G15020.1 | TTAATGGGCCTAAT | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT5G16140 | AT5G16140.1 | TAAGCCCATTAA | peptidyl-tRNA hydrolase family protein; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G38290.2); Has 5393 Blast hits to 5390 proteins in 1416 species: Archae - 0; Bacteria - 2886; Metazoa - 37; Fungi - 45; Plants - 77; Viruses - 0; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT5G16140.2 | TAAGCCCATTAA | peptidyl-tRNA hydrolase family protein; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G38290.2); Has 5393 Blast hits to 5390 proteins in 1416 species: Archae - 0; Bacteria - 2886; Metazoa - 37; Fungi - 45; Plants - 77; Viruses - 0; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT5G16250 | AT5G16250.1 | ACGGCCCATTAGGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02640.1); Has 56 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16260 | AT5G16260.1 | GGGCCTAATGGGCCG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae - 0; Bacteria - 82; Metazoa - 1049; Fungi - 296; Plants - 184; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). |
| AT5G16610 | AT5G16610.1 | ATTGGCCCATTAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G16610.2 | ATTGGCCCATTAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 12 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT5G16710 | AT5G16710.1 | TAATGGGCTGA | The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. |
| AT5G17190 | AT5G17190.1 | AATAGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G17520 | AT5G17520.1 | ATAATGGGCTTA | Encodes a maltose transporter that is expressed in leaves and roots. Mutations at the MEX1 locus cause accumulation of both starch and maltose in leaves, with maltose levels at least 40 times higher than that of wild-type. This gene encodes a protein located in the chloroplast envelope. |
| AT5G17550 | AT5G17550.1 | CTTAATGGGCTTT | PEX19-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome; CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); BEST Arabidopsis thaliana protein match is: PEX19-1 (peroxin 19-1) (TAIR:AT3G03490.1); Has 291 Blast hits to 285 proteins in 122 species: Archae - 0; Bacteria - 4; Metazoa - 130; Fungi - 93; Plants - 19; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT5G17560 | AT5G17560.1 | AAAGCCCATTAAG | BolA-like family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BolA-like protein (InterPro:IPR002634); BEST Arabidopsis thaliana protein match is: BolA-like family protein (TAIR:AT1G55805.1); Has 1368 Blast hits to 1368 proteins in 267 species: Archae - 2; Bacteria - 509; Metazoa - 31; Fungi - 15; Plants - 67; Viruses - 0; Other Eukaryotes - 744 (source: NCBI BLink). |
| AT5G18770 | AT5G18770.1 | TAGCCCATTAT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G18780.1); Has 1198 Blast hits to 1165 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1198; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G18790 | AT5G18790.1 | TTAATGGGCCGAA | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT3G06320.1); Has 1786 Blast hits to 1786 proteins in 750 species: Archae - 0; Bacteria - 1570; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT5G18800 | AT5G18800.1 | TTCGGCCCATTAA | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 73; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G18800.2 | TTCGGCCCATTAA | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 73; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G19300 | AT5G19300.1 | TGAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Protein of unknown function DUF171 (InterPro:IPR003750); Has 4766 Blast hits to 2044 proteins in 217 species: Archae - 72; Bacteria - 102; Metazoa - 2264; Fungi - 372; Plants - 195; Viruses - 4; Other Eukaryotes - 1757 (source: NCBI BLink). |
| AT5G20160 | AT5G20160.1 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT5G20160.2 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT5G20160.3 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). |
| AT5G20170 | AT5G20170.1 | TTTTGGGCTTTTAATGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 35; Fungi - 3; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20180 | AT5G20180.1 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G20180.2 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G22210 | AT5G22210.1 | CTAATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G22210.2 | CTAATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G23080 | AT5G23080.1 | CTAATGGGCCGAA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. |
| AT5G23080.2 | CTAATGGGCCGAA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. |
| AT5G23090 | AT5G23090.1 | TTCGGCCCATTAG | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G23090.2 | TTCGGCCCATTAG | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G23090.3 | TTCGGCCCATTAG | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G23090.4 | TTCGGCCCATTAG | NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G23200 | AT5G23200.1 | TTTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G23420 | AT5G23420.1 | ATAATGGGCCTCA | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. |
| AT5G23630 | AT5G23630.1 | TTAATGGGCTA | A novel member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. |
| AT5G24165 | AT5G24165.1 | TCAGCCCATTAGCCCATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23885.1); Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G24520 | AT5G24520.1 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.1 | GAAGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.2 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.2 | GAAGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.3 | AAAAGGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.3 | GAAGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24580 | AT5G24580.1 | GCCCATTAT | copper-binding family protein; FUNCTIONS IN: copper ion binding, metal ion binding; INVOLVED IN: copper ion transport, metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: ATFP3; metal ion binding / transition metal ion binding (TAIR:AT5G63530.2); Has 7818 Blast hits to 2913 proteins in 264 species: Archae - 24; Bacteria - 308; Metazoa - 4768; Fungi - 268; Plants - 1006; Viruses - 159; Other Eukaryotes - 1285 (source: NCBI BLink). |
| AT5G24580.2 | GCCCATTAT | copper-binding family protein; FUNCTIONS IN: copper ion binding, metal ion binding; INVOLVED IN: copper ion transport, metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: ATFP3; metal ion binding / transition metal ion binding (TAIR:AT5G63530.2); Has 7818 Blast hits to 2913 proteins in 264 species: Archae - 24; Bacteria - 308; Metazoa - 4768; Fungi - 268; Plants - 1006; Viruses - 159; Other Eukaryotes - 1285 (source: NCBI BLink). |
| AT5G24580.3 | GCCCATTAT | copper-binding family protein; FUNCTIONS IN: copper ion binding, metal ion binding; INVOLVED IN: copper ion transport, metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: ATFP3; metal ion binding / transition metal ion binding (TAIR:AT5G63530.2); Has 7818 Blast hits to 2913 proteins in 264 species: Archae - 24; Bacteria - 308; Metazoa - 4768; Fungi - 268; Plants - 1006; Viruses - 159; Other Eukaryotes - 1285 (source: NCBI BLink). |
| AT5G24640 | AT5G24640.1 | TAATGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41730.1); Has 13 Blast hits to 13 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G24650 | AT5G24650.1 | ATAATGGGC | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G24650.1 | TAATGGGCTTT | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G24830 | AT5G24830.1 | TTAATGGGCCATAGCCCAAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 22335 Blast hits to 5701 proteins in 178 species: Archae - 6; Bacteria - 14; Metazoa - 418; Fungi - 405; Plants - 20611; Viruses - 0; Other Eukaryotes - 881 (source: NCBI BLink). |
| AT5G24840 | AT5G24840.1 | GAAGCCCATTAAG | tRNA (guanine-N7-)-methyltransferase; FUNCTIONS IN: tRNA (guanine-N7-)-methyltransferase activity; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, tRNA modification; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA (guanine-N-7) methyltransferase (InterPro:IPR003358); BEST Arabidopsis thaliana protein match is: tRNA (guanine-N7-)-methyltransferase (TAIR:AT5G17660.1); Has 3254 Blast hits to 3250 proteins in 1207 species: Archae - 0; Bacteria - 2194; Metazoa - 104; Fungi - 94; Plants - 68; Viruses - 0; Other Eukaryotes - 794 (source: NCBI BLink). |
| AT5G24840.1 | TAATGGGCT | tRNA (guanine-N7-)-methyltransferase; FUNCTIONS IN: tRNA (guanine-N7-)-methyltransferase activity; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, tRNA modification; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA (guanine-N-7) methyltransferase (InterPro:IPR003358); BEST Arabidopsis thaliana protein match is: tRNA (guanine-N7-)-methyltransferase (TAIR:AT5G17660.1); Has 3254 Blast hits to 3250 proteins in 1207 species: Archae - 0; Bacteria - 2194; Metazoa - 104; Fungi - 94; Plants - 68; Viruses - 0; Other Eukaryotes - 794 (source: NCBI BLink). |
| AT5G24970 | AT5G24970.1 | TTAATGGGCCTGA | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink). |
| AT5G24980 | AT5G24980.1 | TCAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G25070 | AT5G25070.1 | TTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 81684 Blast hits to 44791 proteins in 1880 species: Archae - 1252; Bacteria - 11295; Metazoa - 39436; Fungi - 6166; Plants - 3117; Viruses - 367; Other Eukaryotes - 20051 (source: NCBI BLink). |
| AT5G25080 | AT5G25080.1 | TTAATGGGCCTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146), Exosome-associated factor Rrp47/DNA strand repair C1D (InterPro:IPR011082); Has 137 Blast hits to 137 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 42; Plants - 16; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G25780 | AT5G25780.1 | ATAATGGGCTTTG | member of eIF3b - eukaryotic initiation factor 3b |
| AT5G25780.1 | ATAATGGGCTTTG | member of eIF3b - eukaryotic initiation factor 3b |
| AT5G26360 | AT5G26360.1 | TTAATGGGCCTTAG | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, gamma subunit (InterPro:IPR012719), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G11830.1); Has 12411 Blast hits to 12269 proteins in 2241 species: Archae - 394; Bacteria - 5329; Metazoa - 1841; Fungi - 951; Plants - 480; Viruses - 2; Other Eukaryotes - 3414 (source: NCBI BLink). |
| AT5G27120 | AT5G27120.1 | CTAATGGGCCAA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein |
| AT5G27400 | AT5G27400.1 | TATAGGCCCATTAGGCCCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 806 Blast hits to 806 proteins in 171 species: Archae - 0; Bacteria - 62; Metazoa - 389; Fungi - 161; Plants - 105; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). |
| AT5G27770 | AT5G27770.1 | TCGGCCCATTAG | 60S ribosomal protein L22 (RPL22C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22e (InterPro:IPR002671); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L22-2 (RPL22B) (TAIR:AT3G05560.3); Has 492 Blast hits to 492 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 89; Plants - 73; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT5G28370 | AT5G28370.1 | TAAGCCCATTAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G28460.1); Has 22506 Blast hits to 6026 proteins in 190 species: Archae - 7; Bacteria - 27; Metazoa - 841; Fungi - 534; Plants - 20012; Viruses - 0; Other Eukaryotes - 1085 (source: NCBI BLink). |
| AT5G28750 | AT5G28750.1 | AAAGCCCATTAG | thylakoid assembly protein, putative; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast thylakoid membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Twin-arginine translocation protein TatB (InterPro:IPR003998), Bacterial sec-independent translocation protein mttA/Hcf106 (InterPro:IPR003369), Twin-arginine translocation protein TatA/E (InterPro:IPR006312); BEST Arabidopsis thaliana protein match is: HCF106; proton motive force dependent protein transmembrane transporter (TAIR:AT5G52440.1); Has 1888 Blast hits to 1888 proteins in 601 species: Archae - 44; Bacteria - 1428; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 356 (source: NCBI BLink). |
| AT5G35360 | AT5G35360.1 | CTTAATGGGCTTTAT | Encodes biotin carboxylase subunit (CAC2). |
| AT5G35360.2 | CTTAATGGGCTTTAT | Encodes biotin carboxylase subunit (CAC2). |
| AT5G38040 | AT5G38040.1 | CTAATGGGCCAAT | UDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, stem, embryo, sepal, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT5G38010.1); Has 4566 Blast hits to 4539 proteins in 305 species: Archae - 0; Bacteria - 130; Metazoa - 1639; Fungi - 14; Plants - 2694; Viruses - 70; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G39210 | AT5G39210.1 | GTGGCCCATTAA | Encodes a protein of the chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved in respiration, photosystem I (PSI) cyclic electron transport and CO2 uptake. The product of this gene appears to be essential for the stable formation of the NDH Complex. |
| AT5G39250 | AT5G39250.1 | CTAATGGGCTTTGGGCCGGGCCGTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G39740 | AT5G39740.1 | TTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA | 60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT5G40370 | AT5G40370.1 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink). |
| AT5G40370.2 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink). |
| AT5G40770 | AT5G40770.1 | TTGGCCCATTAA | prohibitin 3 |
| AT5G40810 | AT5G40810.1 | ATAGGCCCTTAATGGGCTTTTA | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink). |
| AT5G40810.2 | ATAGGCCCTTAATGGGCTTTTA | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink). |
| AT5G41520 | AT5G41520.1 | TTAGCCCATTAA | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT5G41520.2 | TTAGCCCATTAA | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT5G41940 | AT5G41940.1 | AAGGCCCATTAA | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3483 Blast hits to 2868 proteins in 186 species: Archae - 2; Bacteria - 83; Metazoa - 1894; Fungi - 490; Plants - 337; Viruses - 5; Other Eukaryotes - 672 (source: NCBI BLink). |
| AT5G41960 | AT5G41960.1 | GGCTTTAACGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G41960.1 | TGTTGGGCTAATGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G42000 | AT5G42000.1 | TAATGGGCCTCT | ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G42000.2 | TAATGGGCCTCT | ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G42790 | AT5G42790.1 | GAAGCCCATTAA | encodes a protein with extensive homology to the largest subunit of the multicatalytic proteinase complex (proteasome) |
| AT5G43060 | AT5G43060.1 | TAGCCCATTAA | cysteine proteinase, putative / thiol protease, putative; FUNCTIONS IN: cysteine-type peptidase activity, cysteine-type endopeptidase activity; INVOLVED IN: response to salt stress; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Granulin (InterPro:IPR000118), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: RD21 (responsive to dehydration 21); cysteine-type endopeptidase/ cysteine-type peptidase (TAIR:AT1G47128.1); Has 7000 Blast hits to 6290 proteins in 593 species: Archae - 25; Bacteria - 79; Metazoa - 3655; Fungi - 4; Plants - 1235; Viruses - 122; Other Eukaryotes - 1880 (source: NCBI BLink). |
| AT5G43330 | AT5G43330.1 | ATTGGCCCATTAT | malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: cellular carbohydrate metabolic process, glycolysis, malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT1G04410.1); Has 8255 Blast hits to 8253 proteins in 1762 species: Archae - 116; Bacteria - 4254; Metazoa - 1034; Fungi - 184; Plants - 466; Viruses - 0; Other Eukaryotes - 2201 (source: NCBI BLink). |
| AT5G44040 | AT5G44040.1 | AAAACGGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G04030.1); Has 753 Blast hits to 701 proteins in 137 species: Archae - 2; Bacteria - 60; Metazoa - 161; Fungi - 91; Plants - 57; Viruses - 6; Other Eukaryotes - 376 (source: NCBI BLink). |
| AT5G44320 | AT5G44320.1 | AAAAGCCCATTGAGGCCCATTAAG | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 40; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G44320.1 | ATAATGGGCTTA | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 40; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G45775 | AT5G45775.1 | ATTGGCCCATTAA | 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink). |
| AT5G45775.2 | ATTGGCCCATTAA | 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink). |
| AT5G45930 | AT5G45930.1 | CAAGCCCATTAT | encodes a second Chl I gene (CHLI2), a subunit of magnesium chelatase which is required for chlorophyll biosynthesis. Has ATPase activity, regulated by TRX-f. Involved in the assembly of the Mg chelatase complex. |
| AT5G45990 | AT5G45990.1 | TTTAGGCCCATTAAG | crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink). |
| AT5G46030 | AT5G46030.1 | CAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF701, zinc-binding putative (InterPro:IPR007808); Has 2456 Blast hits to 1418 proteins in 196 species: Archae - 2; Bacteria - 26; Metazoa - 1582; Fungi - 186; Plants - 111; Viruses - 40; Other Eukaryotes - 509 (source: NCBI BLink). |
| AT5G46840 | AT5G46840.2 | CTAATGGGCTGA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). |
| AT5G46840.2 | CTAATGGGCTTAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). |
| AT5G47110 | AT5G47110.1 | CAAAGCCCATTAA | lil3 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis, light harvesting; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LIL3:1; transcription factor (TAIR:AT4G17600.1); Has 51 Blast hits to 51 proteins in 19 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G47210 | AT5G47210.1 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.1 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.2 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.2 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.3 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.3 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47320 | AT5G47320.1 | CATTGGGCCCATTAT | Nuclear encoded mitochondrial ribosome subunit. |
| AT5G47690 | AT5G47690.1 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.2 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47690.3 | CTAATGGGCCTGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink). |
| AT5G47860 | AT5G47860.1 | GTGGCCCATTAAG | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1350 (InterPro:IPR010765); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43540.1); Has 289 Blast hits to 289 proteins in 66 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT5G47880 | AT5G47880.1 | TACTGGGCTTAGGCCCATTAA | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. |
| AT5G47880.1 | TTCGGCCCATTAAG | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. |
| AT5G47880.2 | TACTGGGCTTAGGCCCATTAA | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. |
| AT5G47880.2 | TTCGGCCCATTAAG | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. |
| AT5G48710 | AT5G48710.1 | TCAGCCCATTAAGGCCCAACT | ubiquitin-related; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin-related (TAIR:AT5G48700.1); Has 703 Blast hits to 702 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 438; Fungi - 87; Plants - 102; Viruses - 1; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT5G49000 | AT5G49000.1 | ATAAGGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT5G49000.2 | ATAAGGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT5G49510 | AT5G49510.1 | TAATGGGCCTG | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G49510.2 | TAATGGGCCTG | PREFOLDIN 3 (PDF3); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin, subunit 3 (InterPro:IPR016655); Has 310 Blast hits to 310 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT5G49610 | AT5G49610.1 | ATAATGGGCCTTGGGCCTAG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G33530.1); Has 993 Blast hits to 986 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 0; Plants - 981; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT5G50870 | AT5G50870.1 | ATAATGGGCCTAG | ubiquitin-conjugating enzyme 27 (UBC27); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: UBC8 (UBIQUITIN CONJUGATING ENZYME 8); protein binding / ubiquitin-protein ligase (TAIR:AT5G41700.4); Has 7501 Blast hits to 7499 proteins in 306 species: Archae - 0; Bacteria - 0; Metazoa - 3692; Fungi - 1438; Plants - 1085; Viruses - 19; Other Eukaryotes - 1267 (source: NCBI BLink). |
| AT5G50960 | AT5G50960.1 | CTTAATGGGCTTTAT | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT5G51300 | AT5G51300.1 | ATTTGGGCTTATAATGGGCCAA | splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). |
| AT5G51300.2 | ATTTGGGCTTATAATGGGCCAA | splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). |
| AT5G51300.3 | ATTTGGGCTTATAATGGGCCAA | splicing factor-related; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), RNA recognition motif, RNP-1 (InterPro:IPR000504), K Homology, type 1 (InterPro:IPR004088), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT3G08620.1); Has 69221 Blast hits to 42347 proteins in 1380 species: Archae - 38; Bacteria - 5736; Metazoa - 34755; Fungi - 10953; Plants - 9084; Viruses - 1148; Other Eukaryotes - 7507 (source: NCBI BLink). |
| AT5G51910 | AT5G51910.1 | CAAGGCCCATTAG | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G51910.2 | CAAGGCCCATTAG | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT2G45680.1); Has 547 Blast hits to 546 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 547; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G51960 | AT5G51960.1 | AAAAGCCCATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATP synthase assembly factor FMC1, mitochondrial (InterPro:IPR018471); Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G52470 | AT5G52470.1 | ATCGGCCCATTAT | encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. |
| AT5G52470.2 | ATCGGCCCATTAT | encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. |
| AT5G52660 | AT5G52660.1 | GCCCATTAG | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). |
| AT5G52660.1 | GCCCATTAG | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). |
| AT5G52660.2 | GCCCATTAG | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). |
| AT5G52660.2 | GCCCATTAG | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). |
| AT5G52820 | AT5G52820.1 | TTCGGCCCATTAATTAAAGGC | WD-40 repeat family protein / notchless protein, putative; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), G-protein, beta subunit (InterPro:IPR001632); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 92804 Blast hits to 28593 proteins in 717 species: Archae - 60; Bacteria - 7422; Metazoa - 44321; Fungi - 18160; Plants - 9806; Viruses - 6; Other Eukaryotes - 13029 (source: NCBI BLink). |
| AT5G52840 | AT5G52840.1 | ATAAGGCCCATTAT | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, chloroplast, respiratory chain complex I, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ETC complex I subunit (InterPro:IPR006806); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28005.1); Has 272 Blast hits to 272 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 69; Plants - 31; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G52840.1 | ATTAGGCCCATTAA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, chloroplast, respiratory chain complex I, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ETC complex I subunit (InterPro:IPR006806); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28005.1); Has 272 Blast hits to 272 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 69; Plants - 31; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G54600 | AT5G54600.1 | TAGCCCATTAAG | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT5G54600.2 | TAGCCCATTAAG | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT5G54900 | AT5G54900.1 | CTAATGGGCTGA | RNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). |
| AT5G54940 | AT5G54940.1 | CTTAATGGGCCTAC | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT5G54940.2 | CTTAATGGGCCTAC | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink). |
| AT5G55160 | AT5G55160.1 | AGCCCATTTGAGCCCATTAAG | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays. |
| AT5G55160.2 | AGCCCATTTGAGCCCATTAAG | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays. |
| AT5G55610 | AT5G55610.1 | TTAATGGGCCTTAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55610.2 | TTAATGGGCCTTAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55670 | AT5G55670.1 | TGAGCCCATTAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G13190.1); Has 39714 Blast hits to 21553 proteins in 936 species: Archae - 21; Bacteria - 7210; Metazoa - 18978; Fungi - 3959; Plants - 3841; Viruses - 192; Other Eukaryotes - 5513 (source: NCBI BLink). |
| AT5G56120 | AT5G56120.1 | TTCGGCCCATTAAAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12870.1); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G56360 | AT5G56360.1 | CTAATGGGCCTATT | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink). |
| AT5G56360.1 | TATAGGCCCATTAG | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Low density lipoprotein-receptor, class A, cysteine-rich (InterPro:IPR002172), Mannose-6-phosphate receptor, binding (InterPro:IPR009011), Glucosidase II beta subunit-like (InterPro:IPR012913); BEST Arabidopsis thaliana protein match is: protein kinase C substrate, heavy chain-related (TAIR:AT2G42390.1); Has 52492 Blast hits to 29968 proteins in 1344 species: Archae - 253; Bacteria - 7152; Metazoa - 21077; Fungi - 6018; Plants - 1646; Viruses - 404; Other Eukaryotes - 15942 (source: NCBI BLink). |
| AT5G56710 | AT5G56710.1 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT5G56710.2 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT5G56900 | AT5G56900.1 | GAAGCCCATTAAG | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G56900.2 | GAAGCCCATTAAG | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G56910 | AT5G56910.1 | CTTAATGGGCTTC | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56920.1); Has 34 Blast hits to 34 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57300 | AT5G57300.1 | ATAATGGGCCTTTT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57300.2 | ATAATGGGCCTTTT | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink). |
| AT5G57590 | AT5G57590.1 | CCAGGCCCATTAG | Mutant complemented by E coli Bio A gene encoding 7,8-diaminopelargonic acid aminotransferase. |
| AT5G57815 | AT5G57815.1 | TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G57930 | AT5G57930.1 | GCCCATTAAAGGCCCATTAT | ACCUMULATION OF PHOTOSYSTEM ONE 2 |
| AT5G57930.2 | GCCCATTAAAGGCCCATTAT | ACCUMULATION OF PHOTOSYSTEM ONE 2 |
| AT5G58130 | AT5G58130.1 | CTAATGGGCCTTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G50690.1); Has 13214 Blast hits to 6289 proteins in 622 species: Archae - 145; Bacteria - 5890; Metazoa - 2525; Fungi - 1196; Plants - 360; Viruses - 129; Other Eukaryotes - 2969 (source: NCBI BLink). |
| AT5G58130.1 | TAAAAGCCCATTAAG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G50690.1); Has 13214 Blast hits to 6289 proteins in 622 species: Archae - 145; Bacteria - 5890; Metazoa - 2525; Fungi - 1196; Plants - 360; Viruses - 129; Other Eukaryotes - 2969 (source: NCBI BLink). |
| AT5G58140 | AT5G58140.1 | ATAAGGCCCATTAG | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.1 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.2 | ATAAGGCCCATTAG | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.2 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.3 | ATAAGGCCCATTAG | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.3 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.4 | ATAAGGCCCATTAG | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.4 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58410 | AT5G58410.1 | ATGGCCCATTAT | binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Armadillo-type fold (InterPro:IPR016024); Has 531 Blast hits to 394 proteins in 135 species: Archae - 0; Bacteria - 2; Metazoa - 226; Fungi - 140; Plants - 48; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). |
| AT5G58440 | AT5G58440.1 | CTAATGGGCCTAAACAAGCCCAT | SORTING NEXIN 2a (SNX2a); FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2b (SORTING NEXIN 2b); phosphoinositide binding / protein binding (TAIR:AT5G07120.1); Has 1775 Blast hits to 1763 proteins in 175 species: Archae - 7; Bacteria - 6; Metazoa - 1144; Fungi - 391; Plants - 81; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT5G58510 | AT5G58510.1 | ATAATGGGCCAATATTAGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55060.1); Has 187 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G58590 | AT5G58590.1 | GGGCCTTAATGGGCTTA | Encodes a Ran-binding protein 1 homolog (RanBP1). |
| AT5G58710 | AT5G58710.1 | TTAATGGGCT | Encodes cyclophilin ROC7. |
| AT5G58710.1 | TTAGCCCATTA | Encodes cyclophilin ROC7. |
| AT5G58950 | AT5G58950.1 | TTAATGGGCCGAA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G46930.1); Has 97287 Blast hits to 95864 proteins in 3755 species: Archae - 57; Bacteria - 8154; Metazoa - 43395; Fungi - 8207; Plants - 19435; Viruses - 506; Other Eukaryotes - 17533 (source: NCBI BLink). |
| AT5G59140 | AT5G59140.1 | ATAATGGGCCTC | SKP1 family protein; FUNCTIONS IN: protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); Has 313 Blast hits to 313 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 77; Plants - 28; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G59500 | AT5G59500.1 | CAAAGCCCATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 491 Blast hits to 491 proteins in 204 species: Archae - 22; Bacteria - 353; Metazoa - 4; Fungi - 21; Plants - 20; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT5G59613 | AT5G59613.1 | TAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial respiratory chain complex III; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46430.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59850 | AT5G59850.1 | AAAGGCCCAAAATAAAGCCCATTAT | 40S ribosomal protein S15A (RPS15aF); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: RPS15A (ribosomal protein s15a); structural constituent of ribosome (TAIR:AT1G07770.2); Has 2190 Blast hits to 2190 proteins in 758 species: Archae - 184; Bacteria - 927; Metazoa - 327; Fungi - 130; Plants - 162; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink). |
| AT5G59970 | AT5G59970.1 | ATAACCGGCCCATTAA | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59690.1); Has 2716 Blast hits to 2716 proteins in 361 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 282; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
| AT5G60160 | AT5G60160.1 | CAATTGGGCTTTGTAATGGGCCAAT | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink). |
| AT5G60620 | AT5G60620.1 | ATAATGGGCCTGA | phospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: triglyceride biosynthetic process, diacylglycerol biosynthetic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: phospholipid/glycerol acyltransferase family protein (TAIR:AT1G80950.1); Has 820 Blast hits to 786 proteins in 139 species: Archae - 0; Bacteria - 81; Metazoa - 535; Fungi - 2; Plants - 72; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT5G60820 | AT5G60820.1 | TTCGGCCCATTAG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G08139.1); Has 6800 Blast hits to 6591 proteins in 264 species: Archae - 0; Bacteria - 123; Metazoa - 2390; Fungi - 543; Plants - 2247; Viruses - 74; Other Eukaryotes - 1423 (source: NCBI BLink). |
| AT5G60940 | AT5G60940.1 | ATAGGCCCATTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). |
| AT5G60940.1 | CAAAGGCCCATTAG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). |
| AT5G60940.2 | ATAGGCCCATTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). |
| AT5G60940.2 | CAAAGGCCCATTAG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). |
| AT5G61840 | AT5G61840.1 | GCCCATTAAATAATGGGCT | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G61840.1 | TCAGCCCATTA | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G61865 | AT5G61865.1 | ATAATGGGCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; Has 51 Blast hits to 51 proteins in 26 species: Archae - 3; Bacteria - 6; Metazoa - 23; Fungi - 3; Plants - 4; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G62810 | AT5G62810.1 | ATAATGGGCTCA | mutant has a defect in the intracellular transport of thiolase from the cytosol to glyoxysomes (formerly known as ped2) |
| AT5G63080 | AT5G63080.1 | ATAATGGGCCTATAAATGGGCCGTA | transcription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT1G78280.1); Has 1321 Blast hits to 1316 proteins in 215 species: Archae - 0; Bacteria - 213; Metazoa - 766; Fungi - 131; Plants - 81; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). |
| AT5G63520 | AT5G63520.1 | ATAATGGGCCTATT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FIST domain, N-terminal (InterPro:IPR013702); Has 96 Blast hits to 96 proteins in 46 species: Archae - 0; Bacteria - 72; Metazoa - 6; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
| AT5G64330 | AT5G64330.1 | TAAGCCCATTA | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1.Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT5G64330.2 | TAAGCCCATTA | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1.Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT5G64350 | AT5G64350.1 | ATAATGGGCCTAAA | FK506-BINDING PROTEIN (FKBP12); FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin-related / FKBP-type peptidyl-prolyl cis-trans isomerase-related (TAIR:AT4G25340.1); Has 5723 Blast hits to 5615 proteins in 1032 species: Archae - 25; Bacteria - 2709; Metazoa - 1179; Fungi - 351; Plants - 350; Viruses - 0; Other Eukaryotes - 1109 (source: NCBI BLink). |
| AT5G64680 | AT5G64680.1 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT5G64680.2 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT5G64680.3 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT5G65110 | AT5G65110.1 | CTTAATGGGCCAC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65110.2 | CTTAATGGGCCAC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65260 | AT5G65260.1 | AATTGGGCCTTATTAGGCCCATTAAG | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G10350.1); Has 5533 Blast hits to 5115 proteins in 414 species: Archae - 6; Bacteria - 543; Metazoa - 2461; Fungi - 1041; Plants - 837; Viruses - 0; Other Eukaryotes - 645 (source: NCBI BLink). |
| AT5G65270 | AT5G65270.1 | CTTAATGGGCCTAATAAGGCCCAATT | Arabidopsis Rab GTPase homolog A4a (AtRABA4a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RABA4B (RAB GTPASE HOMOLOG A4B); GTP binding (TAIR:AT4G39990.1); Has 23029 Blast hits to 22998 proteins in 639 species: Archae - 17; Bacteria - 108; Metazoa - 12691; Fungi - 2978; Plants - 2157; Viruses - 19; Other Eukaryotes - 5059 (source: NCBI BLink). |
| AT5G65720 | AT5G65720.1 | TATAGGCCCATTAT | cysteine desulfurase whose activity is dependent on AtSufE activation. |
| AT5G65720.2 | TATAGGCCCATTAT | cysteine desulfurase whose activity is dependent on AtSufE activation. |
| AT5G65940 | AT5G65940.1 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65940.2 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65940.3 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65950 | AT5G65950.1 | AGTGGGCTTATAATGGGCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT5G66030 | AT5G66030.1 | ATAATGGGCCTAAG | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT5G66030.2 | ATAATGGGCCTAAG | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT5G66040 | AT5G66040.2 | CTTAGGCCCATTAT | SULFURTRANSFERASE PROTEIN 16 (STR16); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: SEN1 (SENESCENCE 1) (TAIR:AT4G35770.1); Has 2229 Blast hits to 2226 proteins in 583 species: Archae - 32; Bacteria - 1489; Metazoa - 53; Fungi - 31; Plants - 139; Viruses - 0; Other Eukaryotes - 485 (source: NCBI BLink). |
| AT5G66055 | AT5G66055.1 | GTAAGGCCCATTAG | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink). |
| AT5G66055.2 | GTAAGGCCCATTAG | ANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink). |
| AT5G66060 | AT5G66060.1 | CTAATGGGCCTTAC | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae - 0; Bacteria - 195; Metazoa - 891; Fungi - 57; Plants - 219; Viruses - 14; Other Eukaryotes - 403 (source: NCBI BLink). |
| AT5G66140 | AT5G66140.1 | TTAATGGGCCTGT | Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation. |
| AT5G66190 | AT5G66190.1 | TGAGCCCATTAG | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G66190.2 | TGAGCCCATTAG | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G66450 | AT5G66450.1 | TTAATGGGCTTTTA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT5G66450.2 | TTAATGGGCTTTTA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT5G66590 | AT5G66590.1 | TTAATGGGCCTGA | allergen V5/Tpx-1-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: allergen V5/Tpx-1-related family protein (TAIR:AT5G57625.1); Has 1763 Blast hits to 1704 proteins in 235 species: Archae - 0; Bacteria - 47; Metazoa - 893; Fungi - 192; Plants - 589; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT5G66680 | AT5G66680.1 | TAAGCCCATTAA | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. |
| AT5G67070 | AT5G67070.1 | TGGCCCATTAA | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT5G67100 | AT5G67100.1 | GTAAGGCCCATTAAG | Encodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering. |
| AT5G67150 | AT5G67150.1 | ATAATGGGCCTAG | transferase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G50280.1); Has 1367 Blast hits to 1362 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 151; Plants - 1216; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G67150.1 | TTAATGGGCTTA | transferase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G50280.1); Has 1367 Blast hits to 1362 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 151; Plants - 1216; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G67320 | AT5G67320.1 | ATAGGCCCATTA | Encodes a WD-40 protein involved in histone deacetylation in response to abiotic stress.Identified in a screen for mutations with altered expression of stress induced genes. Functions as a repressor of cold tolerance induced genes. Loss of function mutants are hypersensitive to freezing. |
| AT5G67510 | AT5G67510.1 | ATAAGCCCATTAT | 60S ribosomal protein L26 (RPL26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26A) (TAIR:AT3G49910.1); Has 893 Blast hits to 893 proteins in 319 species: Archae - 233; Bacteria - 15; Metazoa - 308; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). |