Organism | Arabidopsis thaliana | |
ID | AtREG365 | |
Sequence | GGGCTTTA | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | ||
Total Entry Count | 543 |
Locus | Gene model | Sequence | Description |
AT1G01840 | AT1G01840.1 | TTAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G01990 | AT1G01990.1 | ATAATGGGCTTTAAAAGGCCTAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G02405 | AT1G02405.1 | TTGGCCCAATAAAGCCCAAAT | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G70990.1); Has 43114 Blast hits to 16780 proteins in 897 species: Archae - 84; Bacteria - 5479; Metazoa - 15161; Fungi - 3897; Plants - 10314; Viruses - 1979; Other Eukaryotes - 6200 (source: NCBI BLink).  |
AT1G02410 | AT1G02410.1 | ATTTGGGCTTTATTGGGCCAA | cytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink).  |
AT1G02780 | AT1G02780.1 | TTAAAGCCCAATAT | embryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).  |
AT1G02816 | AT1G02816.1 | TTAAAGCCCATGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G02960 | AT1G02960.1 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT1G02960.2 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  | |
AT1G02960.3 | AATTGGGCCTGTTAAAGCCCAATTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  | |
AT1G03040 | AT1G03040.1 | ATAAAGCCCACT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03090 | AT1G03090.1 | ATAAAGCCCATA | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  |
AT1G03090.2 | ATAAAGCCCATA | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  | |
AT1G03140 | AT1G03140.1 | ATAAAGCCCATTTA | splicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).  |
AT1G03150 | AT1G03150.1 | TAAATGGGCTTTAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink).  |
AT1G03600 | AT1G03600.1 | GGGCTTTA | photosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT1G03630 | AT1G03630.1 | TTAAAGCCCATCTCAAGGCCCAATAA | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.  |
AT1G03630.2 | TTAAAGCCCATCTCAAGGCCCAATAA | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.  | |
AT1G03680 | AT1G03680.1 | TTAATGGGCTTTAA | encodes a chloroplast thioredoxin similar to prokaryotic thioredoxins.  |
AT1G03687 | AT1G03687.1 | TTAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT1G03687.1 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  | |
AT1G03687.2 | TTAAAGCCCAATAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  | |
AT1G03687.2 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  | |
AT1G04230 | AT1G04230.1 | GTTGGGCTTTAAAGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43720.1); Has 1140 Blast hits to 725 proteins in 146 species: Archae - 0; Bacteria - 18; Metazoa - 635; Fungi - 256; Plants - 52; Viruses - 5; Other Eukaryotes - 174 (source: NCBI BLink).  |
AT1G05070 | AT1G05070.1 | TAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32580.1); Has 55 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G05340 | AT1G05340.1 | ATAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 122 Blast hits to 122 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 16; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G06190 | AT1G06190.1 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  |
AT1G06190.2 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  | |
AT1G07010 | AT1G07010.1 | TTGGGCTTTA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).  |
AT1G07010.2 | TTGGGCTTTA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).  | |
AT1G07010.3 | TTGGGCTTTA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).  | |
AT1G08700 | AT1G08700.1 | TTTTGGGCTTTAA | Encodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation.  |
AT1G08710 | AT1G08710.1 | TTAAAGCCCAAAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT1G08710.2 | TTAAAGCCCAAAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  | |
AT1G10230 | AT1G10230.1 | GTTTGGGCTTTAT | ARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink).  |
AT1G11240 | AT1G11240.1 | TTAAAGCCTAAAGCCCAATTAAAAGGCC | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink).  |
AT1G12920 | AT1G12920.1 | ATAAAGCCCATTAG | Encodes a eukaryotic release factor one homolog.  |
AT1G13030 | AT1G13030.1 | ATATGGGCTTAAATGGGCTTTAAATAAGGCCCAAT | sphere organelles protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; Has 13894 Blast hits to 8686 proteins in 584 species: Archae - 12; Bacteria - 813; Metazoa - 5398; Fungi - 1230; Plants - 486; Viruses - 98; Other Eukaryotes - 5857 (source: NCBI BLink).  |
AT1G13270 | AT1G13270.1 | CAAGCCCAATGGGCTTTAA | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C.  |
AT1G13270.2 | CAAGCCCAATGGGCTTTAA | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C.  | |
AT1G13950 | AT1G13950.1 | GGCTTTAAAGCCCATA | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced.  |
AT1G14010 | AT1G14010.1 | TTAAAGCCCAATT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
AT1G14140 | AT1G14140.1 | TTAAAGCCCAATAT | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).  |
AT1G14320 | AT1G14320.1 | TTAAAGCCCATTAG | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself.  |
AT1G14320.2 | TTAAAGCCCATTAG | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself.  | |
AT1G14450 | AT1G14450.1 | TTAAAGCCCATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02510.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G14450.1 | TTAAAGCCCATATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02510.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G15020 | AT1G15020.1 | ATAAAGCCCAGTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.  |
AT1G15020.2 | ATAAAGCCCAGTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.  | |
AT1G16030 | AT1G16030.1 | ATATGGGCTTTAATAGGCCCATTTA | heat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink).  |
AT1G16040 | AT1G16040.1 | TAAATGGGCCTATTAAAGCCCATAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G16445 | AT1G16445.1 | ATAAAGCCCAATAT | methylase-related; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Putative rRNA methylase (InterPro:IPR010719); Has 531 Blast hits to 531 proteins in 250 species: Archae - 2; Bacteria - 482; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT1G17070 | AT1G17070.1 | ATAAAGCCCAAGTCGGTT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink).  |
AT1G17210 | AT1G17210.1 | TAAAGCCCATTTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink).  |
AT1G17220 | AT1G17220.1 | TAAATGGGCTTTA | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal.  |
AT1G18540 | AT1G18540.1 | TTAAAGCCCAATAT | 60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT1G19480 | AT1G19480.1 | GTTTGGGCTTTAA | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).  |
AT1G19480.1 | TTTTGGGCTTTA | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).  | |
AT1G19480.2 | GTTTGGGCTTTAA | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).  | |
AT1G19480.2 | TTTTGGGCTTTA | HhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).  | |
AT1G19710 | AT1G19710.1 | AATAGGCCTTTTAAAGCCCATTAT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink).  |
AT1G19800 | AT1G19800.1 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.  |
AT1G19800.2 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.  | |
AT1G19800.3 | ATATTGGGCTTTACGGCCCA | Encodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.  | |
AT1G20575 | AT1G20575.1 | TTTTGGGCTTTATATAGGCCCATAT | dolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative; FUNCTIONS IN: elongation factor-2 kinase activity, dolichyl-phosphate beta-D-mannosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 2 protein (TAIR:AT2G39630.1); Has 14265 Blast hits to 14249 proteins in 1426 species: Archae - 553; Bacteria - 8256; Metazoa - 255; Fungi - 173; Plants - 49; Viruses - 21; Other Eukaryotes - 4958 (source: NCBI BLink).  |
AT1G20580 | AT1G20580.1 | ATATGGGCCTATATAAAGCCCAAAA | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SmD3 (snRNP core protein SmD3) (TAIR:AT1G76300.1); Has 893 Blast hits to 893 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 219; Plants - 128; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT1G21390 | AT1G21390.1 | TTAAAGCCCCAATAG | embryo defective 2170 (emb2170); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76980.2); Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT1G23400 | AT1G23400.1 | TAAAGCCC | Promotes the splicing of chloroplast group II introns.  |
AT1G23530 | AT1G23530.1 | TAAAGCCCACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70470.1); Has 25 Blast hits to 25 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G23750 | AT1G23750.1 | AATTGGGCTTTAT | DNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT1G24510 | AT1G24510.1 | AGATGGGCTTTAA | T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).  |
AT1G24510.2 | AGATGGGCTTTAA | T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).  | |
AT1G24520 | AT1G24520.1 | TTAAAGCCCATCT | Male fertility gene acting on tapetum and microspore  |
AT1G25490 | AT1G25490.1 | TTAAAGCCCAACA | One of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem  |
AT1G26460 | AT1G26460.1 | TTAATGGGCTGGGCTTTAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 4278 Blast hits to 2050 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 59; Plants - 4056; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).  |
AT1G28090 | AT1G28090.1 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).  |
AT1G28090.2 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).  | |
AT1G28090.3 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).  | |
AT1G28490 | AT1G28490.1 | CTTATTGGGCTTTAT | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  |
AT1G28490.2 | CTTATTGGGCTTTAT | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  | |
AT1G29965 | AT1G29965.1 | AAAAGGCCCAATGGGCTTTA | 60S ribosomal protein L18A (RPL18aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: RPL18AA (60S RIBOSOMAL PROTEIN L18A-1); structural constituent of ribosome (TAIR:AT1G29970.2); Has 545 Blast hits to 543 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 93; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT1G29990 | AT1G29990.1 | GGGCTTTAACGG | Encodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins.  |
AT1G30230 | AT1G30230.1 | TAAAGCCCAC | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).  |
AT1G30230.2 | TAAAGCCCAC | elongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).  | |
AT1G30520 | AT1G30520.1 | TAAAGCCCATTT | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal.  |
AT1G30845 | AT1G30845.1 | CAATGGGCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 71 Blast hits to 71 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 19; Plants - 11; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT1G32050 | AT1G32050.1 | TTAAAGCCC | secretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: secretory carrier membrane protein (SCAMP) family protein (TAIR:AT2G20840.1); Has 522 Blast hits to 522 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 335; Fungi - 12; Plants - 120; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT1G32210 | AT1G32210.1 | TAAAGCCCAAAT | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation.  |
AT1G32220 | AT1G32220.1 | ATTTGGGCTTTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).  |
AT1G32310 | AT1G32310.1 | TGTTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G32730 | AT1G32730.1 | ATATTGGGCTTTAA | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT1G33490 | AT1G33490.1 | ATAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G33500 | AT1G33500.1 | TAATTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink).  |
AT1G34130 | AT1G34130.1 | ATAATGGGCTCAATAAAGCCCAAAC | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase.  |
AT1G43170 | AT1G43170.1 | TGTTGGGCTTTAGGCCCAAAA | Encodes a cytoplasmic ribosomal protein.  |
AT1G43170.2 | TGTTGGGCTTTAGGCCCAAAA | Encodes a cytoplasmic ribosomal protein.  | |
AT1G43170.3 | TGTTGGGCTTTAGGCCCAAAA | Encodes a cytoplasmic ribosomal protein.  | |
AT1G43170.4 | TGTTGGGCTTTAGGCCCAAAA | Encodes a cytoplasmic ribosomal protein.  | |
AT1G48770 | AT1G48770.1 | GGGCTTTGTGGGCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18295.1); Has 142 Blast hits to 142 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 142; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G49245 | AT1G49245.1 | TAGGGCTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin (InterPro:IPR009053); Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G50170 | AT1G50170.1 | ATAAAGCCC | encodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis  |
AT1G50450 | AT1G50450.1 | ATAAAGCCCAACT | binding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saccharopine dehydrogenase (InterPro:IPR005097), NAD(P)-binding (InterPro:IPR016040); Has 934 Blast hits to 931 proteins in 259 species: Archae - 13; Bacteria - 434; Metazoa - 33; Fungi - 62; Plants - 25; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink).  |
AT1G51670 | AT1G51670.1 | ATAAAGCCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48180.1); Has 20 Blast hits to 20 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G54320 | AT1G54320.1 | TAAAGCCCATTATAAAGCCCAC | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); BEST Arabidopsis thaliana protein match is: ALIS1 (ALA-INTERACTING SUBUNIT 1); phospholipid transporter (TAIR:AT3G12740.1); Has 648 Blast hits to 646 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 139; Plants - 105; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink).  |
AT1G54490 | AT1G54490.1 | CCGGCCCAATAAAGCCCATTTA | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing.  |
AT1G55370 | AT1G55370.1 | TAAAGCCCAAA | NDH-DEPENDENT CYCLIC ELECTRON FLOW 5 (NDF5); FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: positive regulation of gene expression, photosynthetic electron transport in photosystem I; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013); BEST Arabidopsis thaliana protein match is: NDF2 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); carbohydrate binding / catalytic (TAIR:AT1G64770.1); Has 99 Blast hits to 98 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G55370.2 | TAAAGCCCAAA | NDH-DEPENDENT CYCLIC ELECTRON FLOW 5 (NDF5); FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: positive regulation of gene expression, photosynthetic electron transport in photosystem I; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013); BEST Arabidopsis thaliana protein match is: NDF2 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); carbohydrate binding / catalytic (TAIR:AT1G64770.1); Has 99 Blast hits to 98 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G56190 | AT1G56190.1 | TAAAGCCCATTTA | phosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink).  |
AT1G56190.2 | TAAAGCCCATTTA | phosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink).  | |
AT1G56590 | AT1G56590.1 | ATAAAGCCCAA | clathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: HAP13 (HAPLESS 13); protein binding (TAIR:AT1G60780.1); Has 1451 Blast hits to 1434 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 782; Fungi - 300; Plants - 105; Viruses - 0; Other Eukaryotes - 264 (source: NCBI BLink).  |
AT1G63970 | AT1G63970.1 | TAAATGGGCTTTA | Encodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF  |
AT1G63970.2 | TAAATGGGCTTTA | Encodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF  | |
AT1G63980 | AT1G63980.1 | TAAAGCCCATTTA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink).  |
AT1G63980.2 | TAAAGCCCATTTA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink).  | |
AT1G64628 | AT1G64628.1 | TATGGGCTTTAA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF57 represents a conserved upstream opening reading frame relative to major ORF AT1G64630.1  |
AT1G64630 | AT1G64630.1 | TATGGGCTTTAA | WITH NO LYSINE KINASE 10 (WNK10); FUNCTIONS IN: transcription factor activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: WNK8 (WITH NO LYSINE (K) KINASE 8); kinase/ protein kinase (TAIR:AT5G41990.1); Has 77185 Blast hits to 76497 proteins in 1905 species: Archae - 28; Bacteria - 5972; Metazoa - 32664; Fungi - 6701; Plants - 16849; Viruses - 382; Other Eukaryotes - 14589 (source: NCBI BLink).  |
AT1G64650 | AT1G64650.1 | ATAAAGCCCAAA | LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
AT1G64650.2 | ATAAAGCCCAAA | LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  | |
AT1G65040 | AT1G65040.2 | AGTTGGGCTTTAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).  |
AT1G65040.3 | AGTTGGGCTTTAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).  | |
AT1G66530 | AT1G66530.1 | TTAAAGCCC | arginyl-tRNA synthetase, putative / arginine--tRNA ligase, putative; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, arginine-tRNA ligase activity, ATP binding; INVOLVED IN: arginyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), DALR anticodon binding (InterPro:IPR008909), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Arginyl-tRNA synthetase, class Ic, core (InterPro:IPR015945), Arginyl tRNA synthetase, class Ic, N-terminal (InterPro:IPR005148), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Arginyl-tRNA synthetase, class Ic (InterPro:IPR001278); BEST Arabidopsis thaliana protein match is: emb1027 (embryo defective 1027); ATP binding / aminoacyl-tRNA ligase/ arginine-tRNA ligase/ nucleotide binding (TAIR:AT4G26300.1); Has 6538 Blast hits to 6477 proteins in 1602 species: Archae - 156; Bacteria - 2983; Metazoa - 242; Fungi - 116; Plants - 35; Viruses - 3; Other Eukaryotes - 3003 (source: NCBI BLink).  |
AT1G66730 | AT1G66730.1 | GGGCTTTAGTGGCCCATG | ATP dependent DNA ligase family protein; FUNCTIONS IN: DNA binding, DNA ligase (ATP) activity, ATP binding; INVOLVED IN: DNA repair, DNA replication, DNA recombination; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), DNA ligase, N-terminal (InterPro:IPR012308), ATP dependent DNA ligase, central (InterPro:IPR012310), ATP-dependent DNA ligase, conserved site (InterPro:IPR016059), DNA repair metallo-beta-lactamase (InterPro:IPR011084), ATP dependent DNA ligase, C-terminal (InterPro:IPR012309), ATP-dependent DNA ligase (InterPro:IPR000977); BEST Arabidopsis thaliana protein match is: ATLIG1 (ARABIDOPSIS THALIANA DNA LIGASE 1); ATP binding / DNA binding / DNA ligase (ATP) (TAIR:AT1G08130.1); Has 3133 Blast hits to 3071 proteins in 628 species: Archae - 227; Bacteria - 996; Metazoa - 564; Fungi - 431; Plants - 130; Viruses - 148; Other Eukaryotes - 637 (source: NCBI BLink).  |
AT1G66820 | AT1G66820.1 | TAAATGGGTTAAAGCCCAATAT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 4695 Blast hits to 1095 proteins in 171 species: Archae - 18; Bacteria - 305; Metazoa - 2068; Fungi - 95; Plants - 1647; Viruses - 112; Other Eukaryotes - 450 (source: NCBI BLink).  |
AT1G69620 | AT1G69620.1 | TAGGGCTTTA | putative 60S ribosomal protein L34  |
AT1G71530 | AT1G71530.1 | GGGCTTTA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G33770.1); Has 90308 Blast hits to 89264 proteins in 3118 species: Archae - 44; Bacteria - 7740; Metazoa - 39791; Fungi - 8259; Plants - 17488; Viruses - 392; Other Eukaryotes - 16594 (source: NCBI BLink).  |
AT1G71530.2 | GGGCTTTA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G33770.1); Has 90308 Blast hits to 89264 proteins in 3118 species: Archae - 44; Bacteria - 7740; Metazoa - 39791; Fungi - 8259; Plants - 17488; Viruses - 392; Other Eukaryotes - 16594 (source: NCBI BLink).  | |
AT1G72090 | AT1G72090.1 | AGTTGGGCTTTA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), Aldolase-type TIM barrel (InterPro:IPR013785), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792), MiaB-like tRNA modifying enzyme, archaeal-type (InterPro:IPR006466); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT4G36390.1); Has 10341 Blast hits to 10323 proteins in 1298 species: Archae - 269; Bacteria - 4639; Metazoa - 269; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5110 (source: NCBI BLink).  |
AT1G72320 | AT1G72320.1 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  |
AT1G72320.2 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  | |
AT1G72320.3 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).  | |
AT1G73710 | AT1G73710.1 | TAAAGCCCAATAG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23020.1); Has 27768 Blast hits to 6414 proteins in 199 species: Archae - 2; Bacteria - 35; Metazoa - 962; Fungi - 509; Plants - 25092; Viruses - 0; Other Eukaryotes - 1168 (source: NCBI BLink).  |
AT1G74050 | AT1G74050.1 | TAAAGCCCATGAGCCCAA | 60S ribosomal protein L6 (RPL6C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, intracellular, plasma membrane, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6B) (TAIR:AT1G74060.1); Has 552 Blast hits to 551 proteins in 201 species: Archae - 13; Bacteria - 0; Metazoa - 258; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT1G74060 | AT1G74060.1 | ATAAAGCCC | 60S ribosomal protein L6 (RPL6B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 551 Blast hits to 550 proteins in 201 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT1G74060.1 | TAAAGCCCAC | 60S ribosomal protein L6 (RPL6B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 551 Blast hits to 550 proteins in 201 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT1G74070 | AT1G74070.1 | TATATGGGCTTGGGCTTTAGTTTGGGCTTTTA | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase (TAIR:AT5G35100.1); Has 2382 Blast hits to 2382 proteins in 343 species: Archae - 0; Bacteria - 64; Metazoa - 1168; Fungi - 403; Plants - 432; Viruses - 0; Other Eukaryotes - 315 (source: NCBI BLink).  |
AT1G75560 | AT1G75560.1 | TAAATGGGCTATTGGGCTTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).  |
AT1G75560.2 | TAAATGGGCTATTGGGCTTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).  | |
AT1G76690 | AT1G76690.1 | TAGGGCTTTAT | Encodes one of two closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer.  |
AT1G77030 | AT1G77030.1 | TATAGGCCCAAGTAAAGCCC | ATP binding / ATP-dependent helicase/ RNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DBP10CT (InterPro:IPR012541), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 46457 Blast hits to 14119 proteins in 1029 species: Archae - 31; Bacteria - 19714; Metazoa - 12532; Fungi - 2798; Plants - 5760; Viruses - 615; Other Eukaryotes - 5007 (source: NCBI BLink).  |
AT1G78900 | AT1G78900.1 | ATAAAGCCCAATAA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.  |
AT1G78900.2 | ATAAAGCCCAATAA | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.  | |
AT2G01180 | AT2G01180.1 | TGGGCTTTA | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  |
AT2G01180.2 | TGGGCTTTA | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  | |
AT2G01250 | AT2G01250.1 | TTGGGCTTTA | 60S ribosomal protein L7 (RPL7B); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7C) (TAIR:AT2G44120.2); Has 979 Blast hits to 977 proteins in 287 species: Archae - 144; Bacteria - 0; Metazoa - 384; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  |
AT2G01250.2 | TTGGGCTTTA | 60S ribosomal protein L7 (RPL7B); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30 (InterPro:IPR018038), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7C) (TAIR:AT2G44120.2); Has 979 Blast hits to 977 proteins in 287 species: Archae - 144; Bacteria - 0; Metazoa - 384; Fungi - 146; Plants - 112; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  | |
AT2G01270 | AT2G01270.1 | ATAAAGCCCATTAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.  |
AT2G02790 | AT2G02790.1 | CCAATAAGCCCACTAATAAAGCCCATTAT | IQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink).  |
AT2G03270 | AT2G03270.1 | TTAAAGCCCAATTA | DNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae - 141; Bacteria - 1267; Metazoa - 1124; Fungi - 651; Plants - 305; Viruses - 8; Other Eukaryotes - 902 (source: NCBI BLink).  |
AT2G06990 | AT2G06990.1 | TTAAAGCCCAAAACGACA | encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl.  |
AT2G16510 | AT2G16510.1 | TAAATGGGCTTTAA | vacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink).  |
AT2G16780 | AT2G16780.1 | GAATGGGCTTTACAGGCCCATAA | Encodes a WD-40 repeat protein similar to yeast MSI1.  |
AT2G17200 | AT2G17200.1 | TAAAGCCCTTTGGGCCTCA | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17190.1); Has 11842 Blast hits to 6071 proteins in 720 species: Archae - 6; Bacteria - 2895; Metazoa - 3957; Fungi - 1228; Plants - 1619; Viruses - 162; Other Eukaryotes - 1975 (source: NCBI BLink).  |
AT2G18400 | AT2G18400.1 | GGGCTTTTGGGCTTTAT | ribosomal protein L6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: emb2394 (embryo defective 2394); structural constituent of ribosome (TAIR:AT1G05190.1); Has 5053 Blast hits to 5053 proteins in 1481 species: Archae - 1; Bacteria - 2961; Metazoa - 3; Fungi - 77; Plants - 71; Viruses - 0; Other Eukaryotes - 1940 (source: NCBI BLink).  |
AT2G19080 | AT2G19080.1 | TGTGGGCCTTTTAAAGCCCAAAA | metaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT2G19310 | AT2G19310.1 | AAAAGGCCTTTTCTATTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress, response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: HSP18.2 (heat shock protein 18.2) (TAIR:AT5G59720.1); Has 527 Blast hits to 527 proteins in 67 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 34; Plants - 479; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT2G20780 | AT2G20780.1 | TAAAGCCC | mannitol transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ATPLT5 (POLYOL TRANSPORTER 5); D-ribose transmembrane transporter/ D-xylose transmembrane transporter/ carbohydrate transmembrane transporter/ galactose transmembrane transporter/ glucose transmembrane transporter/ glycerol transmembrane transporter/ mannitol transmembrane transporter/ monosaccharide transmembrane transporter/ myo-inositol transmembrane transporter/ sorbitol transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G18830.1); Has 26744 Blast hits to 26333 proteins in 1492 species: Archae - 393; Bacteria - 13196; Metazoa - 4822; Fungi - 5202; Plants - 1590; Viruses - 2; Other Eukaryotes - 1539 (source: NCBI BLink).  |
AT2G20860 | AT2G20860.1 | ATAATGGGCTTTA | LIP1,Lipoic acid synthase,  |
AT2G20930 | AT2G20930.1 | ATAAAGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); Has 370 Blast hits to 370 proteins in 116 species: Archae - 0; Bacteria - 0; Metazoa - 216; Fungi - 55; Plants - 47; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT2G22400 | AT2G22400.1 | CTAATGGGCTTTATACGGCCCAAAA | NOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink).  |
AT2G22400.1 | TAAAGCCCAATTAAAAAGCC | NOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink).  | |
AT2G23390 | AT2G23390.1 | GTTTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF482 (InterPro:IPR007434), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 1806 Blast hits to 1806 proteins in 374 species: Archae - 0; Bacteria - 707; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 1084 (source: NCBI BLink).  |
AT2G24060 | AT2G24060.1 | TTAAAGCCCATAAGCCCATTAA | translation initiation factor 3 (IF-3) family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 3 (InterPro:IPR001288); BEST Arabidopsis thaliana protein match is: translation initiation factor 3 (IF-3) family protein (TAIR:AT4G30690.1); Has 17514 Blast hits to 8661 proteins in 1545 species: Archae - 56; Bacteria - 6187; Metazoa - 2053; Fungi - 689; Plants - 758; Viruses - 336; Other Eukaryotes - 7435 (source: NCBI BLink).  |
AT2G25625 | AT2G25625.1 | TTTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G25625.2 | TTTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G26840 | AT2G26840.1 | TTAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43910.1); Has 799 Blast hits to 799 proteins in 14 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 2; Other Eukaryotes - 768 (source: NCBI BLink).  |
AT2G27020 | AT2G27020.1 | ATAAAGCCCGTTA | Encodes 20S proteasome subunit PAG1 (PAG1).  |
AT2G28290 | AT2G28290.1 | ATTTGGGCTTTAT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  |
AT2G28290.2 | ATTTGGGCTTTAT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  | |
AT2G28290.3 | ATTTGGGCTTTAT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  | |
AT2G28480 | AT2G28480.1 | ATAAAGCCCATA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 212 Blast hits to 192 proteins in 26 species: Archae - 0; Bacteria - 3; Metazoa - 27; Fungi - 0; Plants - 169; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT2G28790 | AT2G28790.1 | TTAAAGCCC | osmotin-like protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1026 Blast hits to 1010 proteins in 136 species: Archae - 0; Bacteria - 12; Metazoa - 47; Fungi - 55; Plants - 906; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT2G29650 | AT2G29650.1 | ATTTGGGCCTTATATGGGCTTTAT | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane.  |
AT2G29650.2 | ATTTGGGCCTTATATGGGCTTTAT | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane.  | |
AT2G29650.3 | ATTTGGGCCTTATATGGGCTTTAT | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane.  | |
AT2G30000 | AT2G30000.1 | TTTGGGCTTTAA | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT2G31370 | AT2G31370.1 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  |
AT2G31370.2 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.3 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.4 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.5 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31610 | AT2G31610.1 | TTAAAGCCCATAA | 40S ribosomal protein S3 (RPS3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation, response to abiotic stimulus; LOCATED IN: in 6 components; EXPRESSED IN: root, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3B) (TAIR:AT3G53870.1); Has 3946 Blast hits to 3943 proteins in 1195 species: Archae - 174; Bacteria - 1992; Metazoa - 298; Fungi - 94; Plants - 101; Viruses - 0; Other Eukaryotes - 1287 (source: NCBI BLink).  |
AT2G32060 | AT2G32060.1 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
AT2G32060.2 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  | |
AT2G32060.3 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  | |
AT2G33220 | AT2G33220.1 | ATATGGGCCTTTTAAAGCCCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, plastid, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: MEE4 (maternal effect embryo arrest 4) (TAIR:AT1G04630.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT2G35620 | AT2G35620.1 | CAATGGGCTTTAGTAGGCCCAC | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.  |
AT2G36260 | AT2G36260.1 | GGGCTTTA | iron-sulfur cluster assembly complex protein, putative; FUNCTIONS IN: iron-sulfur cluster binding, structural molecule activity; INVOLVED IN: iron-sulfur cluster assembly; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361), FeS cluster insertion (InterPro:IPR016092); BEST Arabidopsis thaliana protein match is: hesB-like domain-containing protein (TAIR:AT2G16710.1); Has 7479 Blast hits to 7478 proteins in 1103 species: Archae - 25; Bacteria - 3491; Metazoa - 208; Fungi - 122; Plants - 90; Viruses - 0; Other Eukaryotes - 3543 (source: NCBI BLink).  |
AT2G38130 | AT2G38130.1 | ATTTGGGCTTTAA | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.  |
AT2G38130.1 | TTAAAGCCCAAAT | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.  | |
AT2G38130.2 | ATTTGGGCTTTAA | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.  | |
AT2G38130.2 | TTAAAGCCCAAAT | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.  | |
AT2G38140 | AT2G38140.1 | ATTTGGGCTTTAA | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete  |
AT2G38140.1 | TTAAAGCCCAAAT | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete  | |
AT2G38730 | AT2G38730.1 | TAAAGCCCAAAA | peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase (TAIR:AT2G21130.1); Has 10133 Blast hits to 10113 proteins in 1461 species: Archae - 80; Bacteria - 3058; Metazoa - 2388; Fungi - 954; Plants - 718; Viruses - 4; Other Eukaryotes - 2931 (source: NCBI BLink).  |
AT2G39160 | AT2G39160.1 | GGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: embryo, root, stamen; EXPRESSED DURING: 4 anthesis, C globular stage; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G39930 | AT2G39930.1 | TTAAGGCCCGGCCCTAAAGCCCATTTA | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex.  |
AT2G40510 | AT2G40510.1 | ATAAAGCCCAAGCCCACTA | 40S ribosomal protein S26 (RPS26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26B) (TAIR:AT2G40590.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT2G40510.1 | TTAAAGCCCAA | 40S ribosomal protein S26 (RPS26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26B) (TAIR:AT2G40590.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G40650 | AT2G40650.1 | TATGGGCTTTA | pre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae - 56; Bacteria - 20349; Metazoa - 26407; Fungi - 5687; Plants - 2913; Viruses - 323; Other Eukaryotes - 11922 (source: NCBI BLink).  |
AT2G40660 | AT2G40660.1 | TAAAGCCCATA | tRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae - 158; Bacteria - 2173; Metazoa - 404; Fungi - 148; Plants - 87; Viruses - 1; Other Eukaryotes - 649 (source: NCBI BLink).  |
AT2G41160 | AT2G41160.1 | ATTTGGGCTTTAT | ubiquitin-associated (UBA)/TS-N domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin-associated (UBA)/TS-N domain-containing protein (TAIR:AT3G56740.1); Has 179 Blast hits to 179 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 65; Plants - 43; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT2G41905 | AT2G41905.1 | GTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; Has 27 Blast hits to 27 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G42230 | AT2G42230.1 | CTTAATGGGCCGTTTAAAGCCCATTTA | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT2G42230.2 | CTTAATGGGCCGTTTAAAGCCCATTTA | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  | |
AT2G42300 | AT2G42300.1 | ATAAAGCCCAATAGGCCCAATT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G42300.2 | ATAAAGCCCAATAGGCCCAATT | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G57800.2); Has 1141 Blast hits to 1141 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 3; Plants - 1128; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G43350 | AT2G43350.1 | AGATGGGCTTTAA | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1.  |
AT2G43460 | AT2G43460.1 | ATTGGGCCTTAAAGCCCATTG | 60S ribosomal protein L38 (RPL38A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38B) (TAIR:AT3G59540.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT2G44640 | AT2G44640.1 | GGGCTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT2G45070 | AT2G45070.1 | ATTTGGGCTTTAA | Sec61 Beta Subunit  |
AT2G45070.2 | ATTTGGGCTTTAA | Sec61 Beta Subunit  | |
AT2G45070.3 | ATTTGGGCTTTAA | Sec61 Beta Subunit  | |
AT2G45070.4 | ATTTGGGCTTTAA | Sec61 Beta Subunit  | |
AT2G45500 | AT2G45500.1 | TAAAGCCCATTAG | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink).  |
AT2G45500.2 | TAAAGCCCATTAG | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink).  | |
AT2G45510 | AT2G45510.1 | CTAATGGGCTTTA | member of CYP704A  |
AT2G45730 | AT2G45730.1 | TTAAAGCCCAATAA | eukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT2G46220 | AT2G46220.1 | GAATGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G79510.2); Has 129 Blast hits to 129 proteins in 50 species: Archae - 0; Bacteria - 61; Metazoa - 17; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT2G46490 | AT2G46490.1 | ATAAAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35110.1); Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G46505 | AT2G46505.1 | AAAAGCCCAGTATAAAGCCCAACT | Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion.  |
AT2G47250 | AT2G47250.1 | ATGGGCTTTA | RNA helicase, putative; FUNCTIONS IN: in 7 functions; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT3G62310.1); Has 7386 Blast hits to 6689 proteins in 1000 species: Archae - 0; Bacteria - 1927; Metazoa - 2123; Fungi - 842; Plants - 395; Viruses - 601; Other Eukaryotes - 1498 (source: NCBI BLink).  |
AT2G47580 | AT2G47580.1 | TGATGGGCTTATTAGGGCTTTA | encodes spliceosomal protein U1A  |
AT2G47640 | AT2G47640.1 | TTAAAGCCC | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT2G47640.1 | TTAAAGCCCATATA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.2 | TTAAAGCCC | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.2 | TTAAAGCCCATATA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.3 | TTAAAGCCC | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.3 | TTAAAGCCCATATA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.4 | TTAAAGCCC | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.4 | TTAAAGCCCATATA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT3G01130 | AT3G01130.1 | TAAAGGCCCATATAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G01130.2 | TAAAGGCCCATATAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G01150 | AT3G01150.1 | ATGGGCTTTAT | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.  |
AT3G01150.2 | ATGGGCTTTAT | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.  | |
AT3G01560 | AT3G01560.1 | ATTTGGGCTTTAA | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Protein of unknown function DUF1421 (InterPro:IPR010820), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT5G14540.1); Has 76923 Blast hits to 40691 proteins in 1566 species: Archae - 110; Bacteria - 8440; Metazoa - 31149; Fungi - 13515; Plants - 10280; Viruses - 1804; Other Eukaryotes - 11625 (source: NCBI BLink).  |
AT3G01770 | AT3G01770.1 | CATTGGGCTTTA | Arabidopsis thaliana BROMODOMAIN AND EXTRATERMINAL DOMAIN PROTEIN 10 (ATBET10); FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: ATBET9 (Arabidopsis thaliana Bromodomain and Extraterminal Domain protein 9); DNA binding (TAIR:AT5G14270.1); Has 10636 Blast hits to 8190 proteins in 445 species: Archae - 19; Bacteria - 529; Metazoa - 5538; Fungi - 1309; Plants - 426; Viruses - 19; Other Eukaryotes - 2796 (source: NCBI BLink).  |
AT3G01780 | AT3G01780.1 | TAAAGCCCAATG | Encodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position.  |
AT3G02820 | AT3G02820.1 | TACTGGGCTTTAAGGCC | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT3G03070 | AT3G03070.1 | TAAAGCCCAAAT | NADH-ubiquinone oxidoreductase-related; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NADH dehydrogenase [ubiquinone] (complex I), iron-sulphur protein 6, mitochondria (InterPro:IPR016668); Has 203 Blast hits to 203 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 109; Fungi - 55; Plants - 28; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT3G03570 | AT3G03570.1 | ATAAAGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP013022 (InterPro:IPR016607); BEST Arabidopsis thaliana protein match is: signal transducer (TAIR:AT4G40050.1); Has 153 Blast hits to 150 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT3G04560 | AT3G04560.1 | GGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 174 Blast hits to 172 proteins in 62 species: Archae - 0; Bacteria - 13; Metazoa - 84; Fungi - 25; Plants - 27; Viruses - 2; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT3G04760 | AT3G04760.1 | TAAAGCCCAAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 26507 Blast hits to 6286 proteins in 193 species: Archae - 4; Bacteria - 28; Metazoa - 952; Fungi - 704; Plants - 23378; Viruses - 0; Other Eukaryotes - 1441 (source: NCBI BLink).  |
AT3G05210 | AT3G05210.1 | TTAATGGGCTTTA | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10.  |
AT3G05675 | AT3G05675.1 | GGCCTTAAAGCCC | protein binding; FUNCTIONS IN: protein binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10800.1); Has 155 Blast hits to 155 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 155; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G05675.2 | GGCCTTAAAGCCC | protein binding; FUNCTIONS IN: protein binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10800.1); Has 155 Blast hits to 155 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 155; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G06820 | AT3G06820.1 | TTAAAGCCCAC | mov34 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80210.1); Has 784 Blast hits to 714 proteins in 171 species: Archae - 0; Bacteria - 7; Metazoa - 410; Fungi - 154; Plants - 118; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  |
AT3G06820.2 | TTAAAGCCCAC | mov34 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80210.1); Has 784 Blast hits to 714 proteins in 171 species: Archae - 0; Bacteria - 7; Metazoa - 410; Fungi - 154; Plants - 118; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  | |
AT3G07150 | AT3G07150.1 | ATAAAGCCCAATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G07400 | AT3G07400.1 | ATTTGGGCCTAAAGCCCAATAG | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); Has 274 Blast hits to 273 proteins in 48 species: Archae - 0; Bacteria - 6; Metazoa - 26; Fungi - 34; Plants - 176; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT3G08510 | AT3G08510.1 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  |
AT3G08510.2 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  | |
AT3G08510.3 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  | |
AT3G08520 | AT3G08520.1 | ATAAAGCCCATTAAG | 60S ribosomal protein L41 (RPL41D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G08590 | AT3G08590.1 | TAAAGCCCATTAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink).  |
AT3G08590.2 | TAAAGCCCATTAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink).  | |
AT3G08780 | AT3G08780.1 | ATTGGGCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G08780.2 | ATTGGGCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT3G08950 | AT3G08950.1 | CTTAATGGGCTTTAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: copper ion transport, respiratory chain complex IV assembly, cellular copper ion homeostasis, cell redox homeostasis; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synthesis of cytochrome c oxidase, Sco1/Sco2 (InterPro:IPR017276), Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT4G39740.1); Has 3037 Blast hits to 3037 proteins in 688 species: Archae - 11; Bacteria - 1550; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 1204 (source: NCBI BLink).  |
AT3G08950.1 | GGGCTTTAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: copper ion transport, respiratory chain complex IV assembly, cellular copper ion homeostasis, cell redox homeostasis; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synthesis of cytochrome c oxidase, Sco1/Sco2 (InterPro:IPR017276), Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT4G39740.1); Has 3037 Blast hits to 3037 proteins in 688 species: Archae - 11; Bacteria - 1550; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 1204 (source: NCBI BLink).  | |
AT3G09630 | AT3G09630.1 | TTATTGGGCTTTAT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).  |
AT3G09630.2 | TTATTGGGCTTTAT | 60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).  | |
AT3G09720 | AT3G09720.1 | ATTTGGGCTTTAATAGGCCCATTTA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae - 599; Bacteria - 13582; Metazoa - 5089; Fungi - 3376; Plants - 1453; Viruses - 31; Other Eukaryotes - 7222 (source: NCBI BLink).  |
AT3G10940 | AT3G10940.1 | TTAAAGCCCATTAA | protein phosphatase-related; FUNCTIONS IN: phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: SEX4 (STARCH-EXCESS 4); polysaccharide binding / protein tyrosine/serine/threonine phosphatase (TAIR:AT3G52180.2); Has 743 Blast hits to 742 proteins in 92 species: Archae - 5; Bacteria - 8; Metazoa - 545; Fungi - 12; Plants - 77; Viruses - 11; Other Eukaryotes - 85 (source: NCBI BLink).  |
AT3G11120 | AT3G11120.1 | TATGGGCTTTATTGGGC | 60S ribosomal protein L41 (RPL41E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G11240 | AT3G11240.1 | AATTGGGCTTTAA | Encodes an arginyl-tRNA:protein arginyltransferase (ATE2), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination.  |
AT3G11250 | AT3G11250.1 | TTAAAGCCCAATT | 60S acidic ribosomal protein P0 (RPP0C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, translation; LOCATED IN: cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0B) (TAIR:AT3G09200.1); Has 1503 Blast hits to 1500 proteins in 380 species: Archae - 223; Bacteria - 1; Metazoa - 578; Fungi - 277; Plants - 141; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink).  |
AT3G11270 | AT3G11270.1 | TTTAGGCCCATATAATTGGGCTTTAT | maternal effect embryo arrest 34 (MEE34); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: RPN8A (RP NON-ATPASE SUBUNIT 8A) (TAIR:AT5G05780.1); Has 981 Blast hits to 977 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 210; Plants - 166; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT3G13230 | AT3G13230.1 | TTATGGGCTTTAT | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087); Has 526 Blast hits to 526 proteins in 226 species: Archae - 118; Bacteria - 0; Metazoa - 138; Fungi - 131; Plants - 49; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT3G14150 | AT3G14150.1 | TAAAGCCCATGGGCTGA | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink).  |
AT3G14150.2 | TAAAGCCCATGGGCTGA | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink).  | |
AT3G14160 | AT3G14160.1 | TCAGCCCATGGGCTTTA | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G14140.1); Has 756 Blast hits to 755 proteins in 353 species: Archae - 0; Bacteria - 523; Metazoa - 76; Fungi - 30; Plants - 41; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT3G14410 | AT3G14410.1 | ATTTGGGCTTTAA | transporter-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT1G53660.1); Has 1496 Blast hits to 1495 proteins in 199 species: Archae - 4; Bacteria - 38; Metazoa - 438; Fungi - 259; Plants - 598; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT3G14415 | AT3G14415.1 | TTAAAGCCCAAAT | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: cotyledon, fruit, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14420.2); Has 8872 Blast hits to 8856 proteins in 1094 species: Archae - 112; Bacteria - 3084; Metazoa - 295; Fungi - 423; Plants - 161; Viruses - 0; Other Eukaryotes - 4797 (source: NCBI BLink).  |
AT3G14890 | AT3G14890.1 | GTTAGGCCTTTAAAGCCCAAATAAGCCCAATG | phosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink).  |
AT3G14890.2 | GTTAGGCCTTTAAAGCCCAAATAAGCCCAATG | phosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink).  | |
AT3G15420 | AT3G15420.1 | TTTTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G15430 | AT3G15430.1 | TAAAGCCCAAAA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).  |
AT3G15430.2 | TAAAGCCCAAAA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).  | |
AT3G15820 | AT3G15820.1 | TAAAGCCCAC | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G15830.1); Has 40 Blast hits to 40 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT3G16480 | AT3G16480.1 | ATGGGCTTTAA | mitochondrial processing peptidase alpha subunit (MPPalpha); FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 4301 Blast hits to 4224 proteins in 886 species: Archae - 10; Bacteria - 2091; Metazoa - 526; Fungi - 394; Plants - 137; Viruses - 3; Other Eukaryotes - 1140 (source: NCBI BLink).  |
AT3G16640 | AT3G16640.1 | TTAAAGCCCAAAA | Encodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well.  |
AT3G16650 | AT3G16650.1 | TTTTGGGCTTTAA | PP1/PP2A phosphatases pleiotropic regulator 2 (PRL2); FUNCTIONS IN: nucleotide binding; INVOLVED IN: response to salt stress; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: PRL1 (PLEIOTROPIC REGULATORY LOCUS 1); basal transcription repressor/ nucleotide binding / protein binding (TAIR:AT4G15900.1); Has 58179 Blast hits to 24123 proteins in 639 species: Archae - 64; Bacteria - 6308; Metazoa - 27345; Fungi - 10914; Plants - 5200; Viruses - 0; Other Eukaryotes - 8348 (source: NCBI BLink).  |
AT3G16990 | AT3G16990.1 | TTAAAGCCCAATG | TENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT3G17430 | AT3G17430.1 | TATAGGCCCATAAAGCCCAAT | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT1G48230.1); Has 1446 Blast hits to 1445 proteins in 173 species: Archae - 0; Bacteria - 5; Metazoa - 374; Fungi - 259; Plants - 650; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).  |
AT3G17590 | AT3G17590.1 | TGAGCCCATTTAAAGCCCACTA | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes.  |
AT3G17590.1 | TTAAAGCCCAAAT | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes.  | |
AT3G17626 | AT3G17626.1 | TTATGGGCTTTATTATTGGGCTTTTAGCCCAACT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: ribosomal protein L18 family protein (TAIR:AT1G48350.1); Has 336 Blast hits to 336 proteins in 121 species: Archae - 0; Bacteria - 241; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT3G18940 | AT3G18940.1 | TTATTGGGCTTTAATATGGCCCATAT | clast3-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP010044 (InterPro:IPR016562); Has 170 Blast hits to 170 proteins in 73 species: Archae - 1; Bacteria - 0; Metazoa - 98; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT3G19590 | AT3G19590.1 | ATATGGGCTTTATTAGCCCAAT | WD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink).  |
AT3G19680 | AT3G19680.1 | ATAAAGCCCACT | unknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1005 (InterPro:IPR010410); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50040.1); Has 728 Blast hits to 127 proteins in 32 species: Archae - 0; Bacteria - 22; Metazoa - 26; Fungi - 20; Plants - 72; Viruses - 0; Other Eukaryotes - 588 (source: NCBI BLink).  |
AT3G20330 | AT3G20330.1 | TTATGGGCTTTAGAAGCCCAAAT | encodes aspartate carbamoyltransferase catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis  |
AT3G22150 | AT3G22150.1 | GTTTGGGCTTCTTAAAGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink).  |
AT3G24070 | AT3G24070.1 | GTTTGGGCTTTAGTAGGCCCAACT | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G13450.1); Has 72 Blast hits to 72 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G25520 | AT3G25520.1 | TAAAGCCCATTAA | Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2.  |
AT3G25800 | AT3G25800.1 | TGGGCCAAAAGGCCCGTTAAAGCCCATTTA | one of three genes encoding the protein phosphatase 2A regulatory subunit  |
AT3G25800.2 | TGGGCCAAAAGGCCCGTTAAAGCCCATTTA | one of three genes encoding the protein phosphatase 2A regulatory subunit  | |
AT3G26410 | AT3G26410.1 | TAAATGGGCTTTATTGGGCCCATG | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).  |
AT3G26420 | AT3G26420.1 | CATGGGCCCAATAAAGCCCATTTA | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance.  |
AT3G45030 | AT3G45030.1 | TTATTGGGCTTTAT | 40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  |
AT3G46100 | AT3G46100.1 | ATAAAGCCCAGCCCATTAG | histidyl-tRNA synthetase  |
AT3G46560 | AT3G46560.1 | ATAAAGCCCACCAGGCCCAATAA | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.  |
AT3G49730 | AT3G49730.1 | TAGGGCTTTA | EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G65820.1); Has 25923 Blast hits to 13097 proteins in 1477 species: Archae - 105; Bacteria - 3757; Metazoa - 995; Fungi - 405; Plants - 17052; Viruses - 21; Other Eukaryotes - 3588 (source: NCBI BLink).  |
AT3G49800 | AT3G49800.1 | TTATGGGCTTTA | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 131 Blast hits to 121 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 1; Plants - 111; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G50080 | AT3G50080.1 | ATAAAGCCCATTGGGCCAA | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes.  |
AT3G50590 | AT3G50590.1 | TTAAAGCCCATTTAGGCCCATTAAACGACA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G51430 | AT3G51430.1 | TTAAAGCCCAC | strictosidine synthase-like protein  |
AT3G51440 | AT3G51440.1 | TTAAAGCCCATAA | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 1156 Blast hits to 1151 proteins in 269 species: Archae - 13; Bacteria - 456; Metazoa - 195; Fungi - 19; Plants - 279; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).  |
AT3G51820 | AT3G51820.1 | TTTTGGGCTTTAT | Encodes a protein with chlorophyll synthase activity. This enzyme has been shown to perform the esterification of chlorophyllide (a and b), the last step of chlorophyll biosynthesis. Although it can use either geranylgeranyl pyrophosphate (GGPP) or phytyl pyrophosphate (PhyPP) as substrates, the esterification reaction was faster with GGPP than with PhyPP.  |
AT3G52750 | AT3G52750.1 | TAAAGCCCA | Nuclear gene that encodes a plastidial division protein (FtsZ2-2).  |
AT3G52750.1 | TATGGGCTTTAA | Nuclear gene that encodes a plastidial division protein (FtsZ2-2).  | |
AT3G53320 | AT3G53320.1 | TTATGGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37070.1); Has 10077 Blast hits to 5050 proteins in 411 species: Archae - 0; Bacteria - 1106; Metazoa - 4046; Fungi - 1512; Plants - 226; Viruses - 108; Other Eukaryotes - 3079 (source: NCBI BLink).  |
AT3G53500 | AT3G53500.2 | TTAATGGGCTTTA | RSZ32; FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, RNA splicing; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: RSZ33; nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT2G37340.1); Has 19457 Blast hits to 16188 proteins in 516 species: Archae - 6; Bacteria - 235; Metazoa - 7507; Fungi - 1066; Plants - 1444; Viruses - 8093; Other Eukaryotes - 1106 (source: NCBI BLink).  |
AT3G55440 | AT3G55440.1 | TTAATGGGCCTAAAGCCCATA | Encodes triosephosphate isomerase.  |
AT3G55480 | AT3G55480.1 | TGATGGGCTTTAT | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink).  |
AT3G55480.2 | TGATGGGCTTTAT | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink).  | |
AT3G55600 | AT3G55600.1 | TTAAAGCCCAGCCTAGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: cation exchanger, putative (CAX10) (TAIR:AT1G54110.1); Has 167 Blast hits to 167 proteins in 56 species: Archae - 0; Bacteria - 8; Metazoa - 84; Fungi - 28; Plants - 42; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT3G55850 | AT3G55850.1 | TAACGGGCTTTA | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.  |
AT3G56860 | AT3G56860.1 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  |
AT3G56860.2 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  | |
AT3G56860.3 | TTAAAGCCCAATAA | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  | |
AT3G57480 | AT3G57480.1 | TTAAAGCCCAA | zinc finger (C2H2 type, AN1-like) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type, AN1-like) family protein (TAIR:AT2G41835.1); Has 368 Blast hits to 368 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
AT3G57800 | AT3G57800.1 | ACCGGTTAAAGCCCAAAAGGCCCAAG | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G57800.2 | ACCGGTTAAAGCCCAAAAGGCCCAAG | basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G57900 | AT3G57900.1 | TTAATGGGCTTTAATTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: epidermis; Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G57910 | AT3G57910.1 | TTATTGGGCCTAATTAAAGCCCATTAA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT5G26610.2); Has 5088 Blast hits to 3153 proteins in 241 species: Archae - 10; Bacteria - 109; Metazoa - 2809; Fungi - 372; Plants - 190; Viruses - 44; Other Eukaryotes - 1554 (source: NCBI BLink).  |
AT3G59370 | AT3G59370.1 | TAAAGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, flower, root, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 1827 Blast hits to 444 proteins in 84 species: Archae - 12; Bacteria - 120; Metazoa - 1213; Fungi - 71; Plants - 63; Viruses - 49; Other Eukaryotes - 299 (source: NCBI BLink).  |
AT3G60770 | AT3G60770.1 | TAAAGCCCATATA | 40S ribosomal protein S13 (RPS13A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13/S15, N-terminal (InterPro:IPR012606), Ribosomal protein S15 (InterPro:IPR000589), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ATRPS13A (ARABIDOPSIS THALIANA RIBOSOMAL PROTEIN S13A); structural constituent of ribosome (TAIR:AT4G00100.1); Has 787 Blast hits to 787 proteins in 301 species: Archae - 177; Bacteria - 0; Metazoa - 232; Fungi - 99; Plants - 90; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).  |
AT3G60880 | AT3G60880.1 | TTAAAGCCCAATT | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast.  |
AT3G60880.2 | TTAAAGCCCAATT | Encodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast.  | |
AT3G62360 | AT3G62360.1 | TAGTGGGCTTTATAAAGCCCATTAAGCCCTA | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT3G62370 | AT3G62370.1 | TAGGGCTTAATGGGCTTTATAAAGCCCACTA | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G62680 | AT3G62680.1 | ATAAAGCCC | Proline-rich protein  |
AT3G62790 | AT3G62790.1 | TTAAAGCCCATAA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT2G47690.1); Has 85 Blast hits to 85 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 43; Plants - 36; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT3G62840 | AT3G62840.1 | TTAATGGGCTTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT3G62840.2 | TTAATGGGCTTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT3G63070 | AT3G63070.1 | TTAAAGCCCATA | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink).  |
AT4G00170 | AT4G00170.1 | TGGGCTTTA | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 758 Blast hits to 742 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 363; Fungi - 101; Plants - 232; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT4G00990 | AT4G00990.1 | TTAAAGCCCATA | transcription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: protein binding, transcription factor activity, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Zinc finger, RING-type (InterPro:IPR001841), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT1G62310.1); Has 700 Blast hits to 466 proteins in 80 species: Archae - 0; Bacteria - 8; Metazoa - 459; Fungi - 31; Plants - 147; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT4G01000 | AT4G01000.1 | ATAAAGCCCA | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: splicing factor-related (TAIR:AT3G06455.1); Has 6590 Blast hits to 3359 proteins in 562 species: Archae - 0; Bacteria - 34; Metazoa - 2857; Fungi - 799; Plants - 1435; Viruses - 158; Other Eukaryotes - 1307 (source: NCBI BLink).  |
AT4G01400 | AT4G01400.2 | GTGGGCCTTATTTGGGCTTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink).  |
AT4G02150 | AT4G02150.1 | TTTGGGCTTTAAAAAGCC | Encodes IMPORTIN ALPHA 3. Mutant plants act as suppressors of snc1 response and salicylic acid accumulation. Located in the nucleus. Involved in protein import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.  |
AT4G02460 | AT4G02460.1 | ATATGGGCTTTAA | Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination.  |
AT4G03260 | AT4G03260.1 | GGGCTTTAT | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink).  |
AT4G03260.2 | GGGCTTTAT | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink).  | |
AT4G07390 | AT4G07390.1 | GCCACGTATTAAAGCCCA | PQ-loop repeat family protein / transmembrane family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Mannose-P-dolichol utilization defect 1 protein (InterPro:IPR016817); BEST Arabidopsis thaliana protein match is: PQ-loop repeat family protein / transmembrane family protein (TAIR:AT5G59470.1); Has 451 Blast hits to 449 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 81; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT4G08940 | AT4G08940.1 | TAAAGCCCAATAA | ubiquitin thiolesterase; FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase (TAIR:AT4G01037.1); Has 214 Blast hits to 214 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G09000 | AT4G09000.1 | GGCTTTAAAGCCCATTC | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available.  |
AT4G09000.2 | GGCTTTAAAGCCCATTC | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available.  | |
AT4G10430 | AT4G10430.1 | TTTTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33230.1); Has 196 Blast hits to 196 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT4G10430.2 | TTTTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33230.1); Has 196 Blast hits to 196 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT4G10430.3 | TTTTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33230.1); Has 196 Blast hits to 196 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT4G13010 | AT4G13010.1 | TTAAAGCCCAAACAAGCCCAT | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink).  |
AT4G13170 | AT4G13170.1 | GGGCCAATATTGGGCTTTAA | 60S ribosomal protein L13A (RPL13aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1401 Blast hits to 1401 proteins in 423 species: Archae - 212; Bacteria - 236; Metazoa - 292; Fungi - 130; Plants - 165; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink).  |
AT4G13200 | AT4G13200.1 | GGCCTTTTAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G13200.1 | TATATGGGCCTTTTAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G13670 | AT4G13670.1 | ATAAGGGCTTTAT | PLASTID TRANSCRIPTIONALLY ACTIVE5 (PTAC5); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding, metabolic process; LOCATED IN: plastid chromosome, chloroplast thylakoid membrane, chloroplast, nucleoid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidoglycan binding-like (InterPro:IPR002477), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 536 Blast hits to 528 proteins in 143 species: Archae - 7; Bacteria - 168; Metazoa - 136; Fungi - 16; Plants - 42; Viruses - 2; Other Eukaryotes - 165 (source: NCBI BLink).  |
AT4G14455 | AT4G14455.1 | TAAAGCCCAGTAAGCCCAATT | Encodes a Bet1/Sft1-like SNARE protein, which can only partially suppresses the temperature-sensitive growth defect in <i>sft1-1</i> yeast cells; however, it cannot support the deletion of the yeast BET1 gene (<i>bet1Δ</i>). In yeast, Bet1p is the v-SNARE (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor, V-type) involved in trafficking between the ER and Golgi.  |
AT4G14615 | AT4G14615.1 | GTGGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52825.1); Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G14870 | AT4G14870.1 | ATTTGGGCTTTATAAGGCCCATAA | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecE subunit of protein translocation complex (InterPro:IPR005807); Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT4G14905 | AT4G14905.1 | AAATGGGCTTTATAGGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT4G14905.2 | AAATGGGCTTTATAGGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink).  | |
AT4G14950 | AT4G14950.1 | AAATGGGCTTTAAAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT4G14950.2 | AAATGGGCTTTAAAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  | |
AT4G14950.3 | AAATGGGCTTTAAAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  | |
AT4G15000 | AT4G15000.1 | ATAAAGCCCAAAT | 60S ribosomal protein L27 (RPL27C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27B) (TAIR:AT3G22230.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).  |
AT4G15000.2 | ATAAAGCCCAAAT | 60S ribosomal protein L27 (RPL27C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27B) (TAIR:AT3G22230.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).  | |
AT4G16265 | AT4G16265.1 | ATATGGGCCGGCCCATGGGCTTTA | One of two highly similar, non-catalytic subunits common to nuclear DNA-directed RNA polymerases II, IV and V; homologous to budding yeast RPB9. Appears to be redundant with At3g16980  |
AT4G16770 | AT4G16770.1 | TTATGGGCCTAAAGCCCAGTA | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G16765.2); Has 6031 Blast hits to 6015 proteins in 680 species: Archae - 0; Bacteria - 734; Metazoa - 132; Fungi - 691; Plants - 2939; Viruses - 0; Other Eukaryotes - 1535 (source: NCBI BLink).  |
AT4G17240 | AT4G17240.1 | TTAAAGCCCATAGTTAGGCCCAATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 43 Blast hits to 43 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT4G17650 | AT4G17650.1 | ATAAAGCCCATTGGGCCCAACA | aromatic-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); Has 1885 Blast hits to 1881 proteins in 667 species: Archae - 0; Bacteria - 1017; Metazoa - 157; Fungi - 73; Plants - 26; Viruses - 1; Other Eukaryotes - 611 (source: NCBI BLink).  |
AT4G18040 | AT4G18040.1 | TTAAAGCCCATAA | eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein.  |
AT4G20980 | AT4G20980.1 | TAAAGCCCATGAGCCCAAAC | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  |
AT4G20980.2 | TAAAGCCCATGAGCCCAAAC | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  | |
AT4G20980.3 | TAAAGCCCATGAGCCCAAAC | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  | |
AT4G22285 | AT4G22285.1 | TTAAAGCCCAAAT | ubiquitin thiolesterase/ zinc ion binding; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin carboxyl-terminal hydrolase family protein (TAIR:AT4G22350.1); Has 2853 Blast hits to 2457 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1787; Fungi - 363; Plants - 246; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink).  |
AT4G22840 | AT4G22840.1 | TTAAAGCCCA | bile acid:sodium symporter family protein; FUNCTIONS IN: transporter activity, bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657); BEST Arabidopsis thaliana protein match is: bile acid:sodium symporter family protein (TAIR:AT4G12030.2); Has 2570 Blast hits to 2568 proteins in 443 species: Archae - 24; Bacteria - 852; Metazoa - 337; Fungi - 0; Plants - 149; Viruses - 0; Other Eukaryotes - 1208 (source: NCBI BLink).  |
AT4G22850 | AT4G22850.1 | TGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  |
AT4G22850.2 | TGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  | |
AT4G23620 | AT4G23620.1 | TTAAAGCCCATAA | 50S ribosomal protein-related; FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25 (InterPro:IPR001021), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66860.1); Has 2862 Blast hits to 2862 proteins in 613 species: Archae - 0; Bacteria - 1307; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1515 (source: NCBI BLink).  |
AT4G23620.1 | TTAAAGCCCATTG | 50S ribosomal protein-related; FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25 (InterPro:IPR001021), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66860.1); Has 2862 Blast hits to 2862 proteins in 613 species: Archae - 0; Bacteria - 1307; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1515 (source: NCBI BLink).  | |
AT4G23820 | AT4G23820.1 | CTTATTGGGCCACTAAAGCCCAAAC | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G41870.1); Has 2405 Blast hits to 2400 proteins in 312 species: Archae - 2; Bacteria - 563; Metazoa - 8; Fungi - 896; Plants - 841; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).  |
AT4G23840 | AT4G23840.1 | GTTTGGGCTTTAGTGGCCCAATAAG | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G15740.1); Has 7635 Blast hits to 5145 proteins in 376 species: Archae - 2; Bacteria - 2863; Metazoa - 1987; Fungi - 78; Plants - 1868; Viruses - 40; Other Eukaryotes - 797 (source: NCBI BLink).  |
AT4G24280 | AT4G24280.1 | GTGGGCTTTA | chloroplast heat shock protein 70-1 (cpHsc70-1); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to cold, response to heat; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Chaperone DnaK (InterPro:IPR012725), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: CPHSC70-2EAT SHOCK PROTEIN 70-2 (CHLOROPLAST HEAT SHOCK PROTEIN 70-2); ATP binding / unfolded protein binding (TAIR:AT5G49910.1); Has 26366 Blast hits to 26267 proteins in 3135 species: Archae - 103; Bacteria - 10457; Metazoa - 2944; Fungi - 1164; Plants - 700; Viruses - 286; Other Eukaryotes - 10712 (source: NCBI BLink).  |
AT4G25450 | AT4G25450.3 | CGGTTTAAAGCCC | member of NAP subfamily  |
AT4G26400 | AT4G26400.1 | TTAATGGGCTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7059 Blast hits to 7033 proteins in 227 species: Archae - 0; Bacteria - 6; Metazoa - 2361; Fungi - 631; Plants - 2786; Viruses - 51; Other Eukaryotes - 1224 (source: NCBI BLink).  |
AT4G26400.2 | TTAATGGGCTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7059 Blast hits to 7033 proteins in 227 species: Archae - 0; Bacteria - 6; Metazoa - 2361; Fungi - 631; Plants - 2786; Viruses - 51; Other Eukaryotes - 1224 (source: NCBI BLink).  | |
AT4G26410 | AT4G26410.1 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022280 (InterPro:IPR016803); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45060.1); Has 47 Blast hits to 47 proteins in 12 species: Archae - 3; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 40; Viruses - 1; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G27500 | AT4G27500.1 | ATAAAGCCC | interacts with H+-ATPase, and regulates its activity  |
AT4G27585 | AT4G27585.1 | TAAAGCCCAATAA | band 7 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid, membrane; EXPRESSED IN: callus, leaf; CONTAINS InterPro DOMAIN/s: Stomatin (InterPro:IPR001972), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: band 7 family protein (TAIR:AT5G54100.1); Has 7621 Blast hits to 7607 proteins in 1311 species: Archae - 148; Bacteria - 4066; Metazoa - 810; Fungi - 128; Plants - 171; Viruses - 3; Other Eukaryotes - 2295 (source: NCBI BLink).  |
AT4G28010 | AT4G28010.1 | TAACGGGCTTTA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62670.1); Has 27713 Blast hits to 6108 proteins in 193 species: Archae - 5; Bacteria - 29; Metazoa - 747; Fungi - 685; Plants - 24892; Viruses - 0; Other Eukaryotes - 1355 (source: NCBI BLink).  |
AT4G30940 | AT4G30940.1 | TATATGGGCTTTA | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT2G24240.1); Has 948 Blast hits to 933 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 800; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT4G31080 | AT4G31080.1 | TTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24330.1); Has 251 Blast hits to 245 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G31120 | AT4G31120.1 | ATAAAGCCCATTAGAAAAGCCC | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification.  |
AT4G31120.2 | ATAAAGCCCATTAGAAAAGCCC | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification.  | |
AT4G31930 | AT4G31930.1 | AATTGGGCTTTAA | mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 212 Blast hits to 212 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 66; Plants - 109; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
AT4G34270 | AT4G34270.1 | TTAAAGCCCATTAAG | TIP41-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: TIP41-like protein (InterPro:IPR007303); Has 248 Blast hits to 248 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT4G34380 | AT4G34380.1 | TAAAGCCCAC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G18950.1); Has 22712 Blast hits to 12420 proteins in 443 species: Archae - 16; Bacteria - 3157; Metazoa - 9533; Fungi - 4921; Plants - 1930; Viruses - 0; Other Eukaryotes - 3155 (source: NCBI BLink).  |
AT4G34870 | AT4G34870.1 | ATATTGGGCTTTA | belongs to cyclophilin family  |
AT4G35580 | AT4G35580.1 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G35580.2 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G36660 | AT4G36660.1 | GTGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65650.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G36800 | AT4G36800.1 | AAATGGGCCTAACGGGCTTTAATGGGCCAA | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.  |
AT4G36800.2 | AAATGGGCCTAACGGGCTTTAATGGGCCAA | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.  | |
AT4G38380 | AT4G38380.1 | AGTGGGCTTTAATGGGCTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink).  |
AT4G39240 | AT4G39240.1 | TAATTGGGCTTTA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT4G39420 | AT4G39420.1 | ATAAAGCCCA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible.  |
AT4G39420.2 | ATAAAGCCCA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible.  | |
AT4G39630 | AT4G39630.1 | GGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G39740 | AT4G39740.1 | TTAAAGCCCAATAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT3G08950.1); Has 2451 Blast hits to 2451 proteins in 612 species: Archae - 9; Bacteria - 1265; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 905 (source: NCBI BLink).  |
AT5G01260 | AT5G01260.1 | TTGGCCCATGGGCTTTAA | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
AT5G01260.2 | TTGGCCCATGGGCTTTAA | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  | |
AT5G01300 | AT5G01300.1 | TTTAGGCCCAATAAAGCCCAATAT | phosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT5G01300.2 | TTTAGGCCCAATAAAGCCCAATAT | phosphatidylethanolamine-binding family protein; FUNCTIONS IN: phosphatidylethanolamine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, 4 leaf senescence stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: YbhB and YbcL (InterPro:IPR005247), Phosphatidylethanolamine-binding protein PEBP (InterPro:IPR008914); Has 1569 Blast hits to 1569 proteins in 571 species: Archae - 85; Bacteria - 1347; Metazoa - 0; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  | |
AT5G01520 | AT5G01520.1 | GGGCTTTAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G47160.1); Has 1238 Blast hits to 1237 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 593; Fungi - 65; Plants - 210; Viruses - 109; Other Eukaryotes - 261 (source: NCBI BLink).  |
AT5G01520.2 | GGGCTTTAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G47160.1); Has 1238 Blast hits to 1237 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 593; Fungi - 65; Plants - 210; Viruses - 109; Other Eukaryotes - 261 (source: NCBI BLink).  | |
AT5G01960 | AT5G01960.1 | TTAAAGCCCATTTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G65040.3); Has 3886 Blast hits to 3874 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 2090; Fungi - 415; Plants - 660; Viruses - 46; Other Eukaryotes - 675 (source: NCBI BLink).  |
AT5G02100 | AT5G02100.1 | ATAAAGCCCAACA | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent.  |
AT5G02410 | AT5G02410.1 | TTGGGCTTTA | DIE2/ALG10 family; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1, 2 glucosyltransferase Alg10 (InterPro:IPR016900), Glycosyltransferase, ALG10 (InterPro:IPR007006); Has 269 Blast hits to 222 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 131; Plants - 14; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT5G02450 | AT5G02450.1 | TTAAAGCCCA | 60S ribosomal protein L36 (RPL36C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
AT5G06150 | AT5G06150.1 | ATGGGCTTTA | Encodes a cyclin whose expression is reduced in response to high salt.  |
AT5G06260 | AT5G06260.1 | TTAAAGCCCATTT | nucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink).  |
AT5G07960 | AT5G07960.1 | TAGGGCTTTAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0139 (InterPro:IPR005351); Has 146 Blast hits to 146 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT5G08415 | AT5G08415.1 | TGTTGGGCTTTAA | lipoic acid synthase family protein; FUNCTIONS IN: lipoic acid synthase activity, iron-sulfur cluster binding, lipoate synthase activity, catalytic activity; INVOLVED IN: lipoic acid biosynthetic process, lipoate biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Lipoate synthase (InterPro:IPR003698), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: LIP1 (LIPOIC ACID SYNTHASE 1); lipoic acid synthase (TAIR:AT2G20860.1); Has 5746 Blast hits to 5746 proteins in 1192 species: Archae - 36; Bacteria - 2422; Metazoa - 113; Fungi - 91; Plants - 53; Viruses - 0; Other Eukaryotes - 3031 (source: NCBI BLink).  |
AT5G08420 | AT5G08420.1 | TTAAAGCCCAACA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); Has 2056 Blast hits to 1575 proteins in 229 species: Archae - 85; Bacteria - 30; Metazoa - 600; Fungi - 242; Plants - 75; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink).  |
AT5G10110 | AT5G10110.1 | CTATTGGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G10560 | AT5G10560.1 | ATAAAGCCC | glycosyl hydrolase family 3 protein; FUNCTIONS IN: xylan 1,4-beta-xylosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT1G78060.1); Has 5112 Blast hits to 4512 proteins in 661 species: Archae - 16; Bacteria - 2460; Metazoa - 12; Fungi - 920; Plants - 292; Viruses - 0; Other Eukaryotes - 1412 (source: NCBI BLink).  |
AT5G10690 | AT5G10690.1 | ATATTGGGCTTTAA | pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12775.1); Has 9217 Blast hits to 4059 proteins in 145 species: Archae - 2; Bacteria - 6; Metazoa - 124; Fungi - 115; Plants - 8658; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink).  |
AT5G10695 | AT5G10695.1 | TTAAAGCCCAATAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G11200 | AT5G11200.1 | TAAAGCCCATTC | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  |
AT5G11200.2 | TAAAGCCCATTC | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  | |
AT5G11200.3 | TAAAGCCCATTC | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  | |
AT5G11240 | AT5G11240.1 | GTGGGCTTTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink).  |
AT5G11380 | AT5G11380.1 | TTATGGGCTTTAA | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity.  |
AT5G11380.2 | TTATGGGCTTTAA | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity.  | |
AT5G13070 | AT5G13070.1 | TTAAAGCCCAATAA | MSF1-like family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PRELI/MSF1 (InterPro:IPR006797); Has 651 Blast hits to 651 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 458; Fungi - 150; Plants - 18; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT5G13300 | AT5G13300.1 | GGGCTTTAAAGGCGCGTG | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin.  |
AT5G13700 | AT5G13700.1 | TTATTGGGCTTTA | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants).  |
AT5G14050 | AT5G14050.1 | GGGCTTTATTGGGC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink).  |
AT5G14170 | AT5G14170.1 | GTGGGCTTTAA | CHC1 is predicted to encode a protein that belongs to the chromodomain remodeling complex. Two RNAi knock-down lines have a dwarf phenotype and reduced rates of Agrobacterium-mediated transformation. The low rate of root-mediated transformation rate may result from altered root morphology or reduced root growth rates.  |
AT5G14430 | AT5G14430.1 | ATAAAGCCCAATAAG | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G14430.1 | ATAAAGCCCAATAT | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT5G14430.2 | ATAAAGCCCAATAAG | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT5G14430.2 | ATAAAGCCCAATAT | dehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT5G15320 | AT5G15320.1 | AGAGGCCCATTTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G15320.2 | AGAGGCCCATTTAAAGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G15820 | AT5G15820.1 | TAAAGCCCAGCC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G02340.1); Has 5714 Blast hits to 5705 proteins in 197 species: Archae - 0; Bacteria - 6; Metazoa - 2140; Fungi - 398; Plants - 2247; Viruses - 17; Other Eukaryotes - 906 (source: NCBI BLink).  |
AT5G15860 | AT5G15860.1 | TAAAGCCCAT | Encodes a protein with prenylcysteine methylesterase activity.  |
AT5G15860.2 | TAAAGCCCAT | Encodes a protein with prenylcysteine methylesterase activity.  | |
AT5G16130 | AT5G16130.1 | GGGCTTTAA | 40S ribosomal protein S7 (RPS7C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 221 species: Archae - 0; Bacteria - 0; Metazoa - 253; Fungi - 94; Plants - 107; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
AT5G17360 | AT5G17360.1 | TTAAAGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: ATP dependent DNA ligase family protein (TAIR:AT1G66730.1); Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G18390 | AT5G18390.1 | TAGGGCTTTAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G65820.1); Has 14680 Blast hits to 4971 proteins in 159 species: Archae - 2; Bacteria - 2; Metazoa - 244; Fungi - 162; Plants - 13880; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).  |
AT5G18620 | AT5G18620.1 | GCCCATGGGCCTTTAAAGCCC | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).  |
AT5G18620.2 | GCCCATGGGCCTTTAAAGCCC | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).  | |
AT5G18630 | AT5G18630.1 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  |
AT5G18630.2 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  | |
AT5G18630.3 | GGGCTTTAAAGGCCCATGGGC | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  | |
AT5G19620 | AT5G19620.1 | TAAATGGGCTTTAA | AtOEP80 is paralog to the chloroplastic protein translocation channel Toc75  |
AT5G19750 | AT5G19750.1 | TAAAGCCCATATAAAAGCCCAAAA | peroxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisomal membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein 22 kDa, putative (TAIR:AT2G14860.1); Has 15236 Blast hits to 7051 proteins in 599 species: Archae - 10; Bacteria - 4387; Metazoa - 5579; Fungi - 966; Plants - 2426; Viruses - 138; Other Eukaryotes - 1730 (source: NCBI BLink).  |
AT5G20160 | AT5G20160.1 | TTTTGGGCTTTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
AT5G20160.2 | TTTTGGGCTTTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G20160.3 | TTTTGGGCTTTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G20170 | AT5G20170.1 | TTTTGGGCTTTTAATGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 35; Fungi - 3; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G20180 | AT5G20180.1 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
AT5G20180.2 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  | |
AT5G20500 | AT5G20500.1 | TTTTGGGCTTTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT1G77370.1); Has 4164 Blast hits to 4161 proteins in 811 species: Archae - 10; Bacteria - 1751; Metazoa - 378; Fungi - 232; Plants - 403; Viruses - 108; Other Eukaryotes - 1282 (source: NCBI BLink).  |
AT5G20520 | AT5G20520.1 | AGATGGGCTTTA | Encodes a Bem46-like protein. WAV2 negatively regulates root bending when roots alter their growth direction. It's not involved in sensing environmental stimuli (e.g. gravity, light, water, touch).  |
AT5G20850 | AT5G20850.1 | ATTTGGGCTTTAA | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation.  |
AT5G20850.1 | GCCTTTAAAGCCCAATAT | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation.  | |
AT5G22440 | AT5G22440.1 | TGTGGGCCTAAATACTGGGCTTTAA | 60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink).  |
AT5G22440.2 | TGTGGGCCTAAATACTGGGCTTTAA | 60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink).  | |
AT5G23420 | AT5G23420.1 | TAAAGCCCATCT | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain.  |
AT5G24640 | AT5G24640.1 | ATAAAGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41730.1); Has 13 Blast hits to 13 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G24650 | AT5G24650.1 | ATAAAGCCCAAAT | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G24710 | AT5G24710.1 | TGGGCTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 46946 Blast hits to 23834 proteins in 1336 species: Archae - 160; Bacteria - 9572; Metazoa - 15324; Fungi - 6794; Plants - 1938; Viruses - 1106; Other Eukaryotes - 12052 (source: NCBI BLink).  |
AT5G25510 | AT5G25510.1 | TAAATGGGCTTTAA | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: ATB' GAMMA; poly(U) binding / protein phosphatase type 2A regulator (TAIR:AT4G15415.2); Has 855 Blast hits to 848 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 492; Fungi - 97; Plants - 156; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT5G25520 | AT5G25520.1 | TTAAAGCCCATTTA | transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink).  |
AT5G25520.2 | TTAAAGCCCATTTA | transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink).  | |
AT5G27830 | AT5G27830.1 | TTAAAGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G27830.2 | TTAAAGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  | |
AT5G27830.3 | TTAAAGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  | |
AT5G35360 | AT5G35360.1 | CTTAATGGGCTTTAT | Encodes biotin carboxylase subunit (CAC2).  |
AT5G35360.2 | CTTAATGGGCTTTAT | Encodes biotin carboxylase subunit (CAC2).  | |
AT5G35730 | AT5G35730.1 | TAAAGCCCAAAT | EXS family protein / ERD1/XPR1/SYG1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EXS, C-terminal (InterPro:IPR004342); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32295.1); Has 598 Blast hits to 593 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 226; Fungi - 179; Plants - 106; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).  |
AT5G37510 | AT5G37510.1 | TAAAAGCCCATAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte.  |
AT5G37510.2 | TAAAAGCCCATAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte.  | |
AT5G39740 | AT5G39740.1 | TTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA | 60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT5G40370 | AT5G40370.1 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink).  |
AT5G40370.2 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink).  | |
AT5G42270 | AT5G42270.1 | TAAAGCCCAC | VAR1 contains a conserved motif for ATPase and a metalloprotease characteristic to FtsH proteins, and is targeted into chloroplasts. A VAR1-fusion protein synthesized in vitro exhibited ATPase activity and partial metalloprotease activity. This protein is located to the thylakoid membrane and forms a complex with VAR2. FtsH1 (VAR1) and FtsH5 are interchangeable in thylakoid membranes.  |
AT5G43330 | AT5G43330.1 | TAGGGCTTTA | malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: cellular carbohydrate metabolic process, glycolysis, malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT1G04410.1); Has 8255 Blast hits to 8253 proteins in 1762 species: Archae - 116; Bacteria - 4254; Metazoa - 1034; Fungi - 184; Plants - 466; Viruses - 0; Other Eukaryotes - 2201 (source: NCBI BLink).  |
AT5G44660 | AT5G44660.1 | TTAAAGCCCTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G20190.1); Has 881 Blast hits to 385 proteins in 98 species: Archae - 0; Bacteria - 247; Metazoa - 260; Fungi - 83; Plants - 38; Viruses - 6; Other Eukaryotes - 247 (source: NCBI BLink).  |
AT5G45420 | AT5G45420.1 | TATATGGGCTTTA | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Homeodomain-like (InterPro:IPR009057), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT3G11450.1); Has 321 Blast hits to 281 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 227; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT5G45775 | AT5G45775.1 | TTATGGGCTTTAT | 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).  |
AT5G45775.2 | TTATGGGCTTTAT | 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).  | |
AT5G45950 | AT5G45950.1 | TTAAAGCCCAAAA | GDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT5G45960.1); Has 1989 Blast hits to 1968 proteins in 231 species: Archae - 0; Bacteria - 404; Metazoa - 1; Fungi - 6; Plants - 1558; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT5G46840 | AT5G46840.2 | TTAAAGCCCAATG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink).  |
AT5G47030 | AT5G47030.1 | AAATGGGCTTTAA | Encodes the mitochondrial ATP synthase subunit delta.  |
AT5G47210 | AT5G47210.1 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  |
AT5G47210.2 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  | |
AT5G47210.3 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  | |
AT5G47630 | AT5G47630.1 | TTAAAGCCCAATAA | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis.  |
AT5G47630.2 | TTAAAGCCCAATAA | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis.  | |
AT5G47690 | AT5G47690.1 | ATGGGCTTTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  |
AT5G47690.2 | ATGGGCTTTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  | |
AT5G47690.3 | ATGGGCTTTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, nucleus; EXPRESSED IN: cotyledon, guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77600.1); Has 6765 Blast hits to 5235 proteins in 377 species: Archae - 10; Bacteria - 207; Metazoa - 2980; Fungi - 748; Plants - 470; Viruses - 130; Other Eukaryotes - 2220 (source: NCBI BLink).  | |
AT5G48500 | AT5G48500.1 | TAAAGCCCAACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G10930.1); Has 32 Blast hits to 32 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G50960 | AT5G50960.1 | CTTAATGGGCTTTAT | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal.  |
AT5G52180 | AT5G52180.1 | TTAAAGCCCATTGGGCCTTTT | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G53540 | AT5G53540.1 | GGGCTTTAA | MSP1 protein, putative / intramitochondrial sorting protein, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: MSP1 protein, putative / intramitochondrial sorting protein, putative (TAIR:AT4G27680.1); Has 21950 Blast hits to 20239 proteins in 1757 species: Archae - 878; Bacteria - 6604; Metazoa - 4050; Fungi - 2359; Plants - 1467; Viruses - 23; Other Eukaryotes - 6569 (source: NCBI BLink).  |
AT5G54520 | AT5G54520.1 | TGGCCCAATTAAAGCCCACTA | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G10580.1); Has 17905 Blast hits to 12742 proteins in 467 species: Archae - 38; Bacteria - 2465; Metazoa - 8443; Fungi - 2995; Plants - 1496; Viruses - 0; Other Eukaryotes - 2468 (source: NCBI BLink).  |
AT5G55000 | AT5G55000.1 | TATTGGGCTTTAA | FH protein interacting protein FIP2  |
AT5G55000.2 | TATTGGGCTTTAA | FH protein interacting protein FIP2  | |
AT5G55140 | AT5G55140.1 | TAATTGGGCCCAGATAAAGCCCAAAT | ribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT5G56670 | AT5G56670.1 | ATAAAGCCCAATAG | 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT5G56670.1 | TATGGGCCCATAAAGCCCAATAT | 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  | |
AT5G56710 | AT5G56710.1 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  |
AT5G56710.2 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  | |
AT5G57120 | AT5G57120.1 | CATTGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif (InterPro:IPR006594), SRP40, C-terminal (InterPro:IPR007718); Has 90949 Blast hits to 45608 proteins in 1620 species: Archae - 300; Bacteria - 8281; Metazoa - 37603; Fungi - 8095; Plants - 3374; Viruses - 548; Other Eukaryotes - 32748 (source: NCBI BLink).  |
AT5G57815 | AT5G57815.1 | TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT5G58560 | AT5G58560.1 | ATAAAGCCCAAACTAGGCCCACA | phosphatidate cytidylyltransferase family protein; FUNCTIONS IN: phosphatidate cytidylyltransferase activity, transferase activity, transferring phosphorus-containing groups; INVOLVED IN: phospholipid biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidate cytidylyltransferase (InterPro:IPR000374); BEST Arabidopsis thaliana protein match is: VTE5 (vitamin E pathway gene5); phosphatidate cytidylyltransferase/ phytol kinase (TAIR:AT5G04490.1); Has 383 Blast hits to 383 proteins in 126 species: Archae - 22; Bacteria - 164; Metazoa - 0; Fungi - 29; Plants - 70; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
AT5G58640 | AT5G58640.1 | AGTGGGCTTTAT | selenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT5G58640.2 | AGTGGGCTTTAT | selenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT5G59850 | AT5G59850.1 | AAAGGCCCAAAATAAAGCCCATTAT | 40S ribosomal protein S15A (RPS15aF); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: RPS15A (ribosomal protein s15a); structural constituent of ribosome (TAIR:AT1G07770.2); Has 2190 Blast hits to 2190 proteins in 758 species: Archae - 184; Bacteria - 927; Metazoa - 327; Fungi - 130; Plants - 162; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink).  |
AT5G60790 | AT5G60790.1 | TTAAAGCCCATATA | member of GCN subfamily  |
AT5G63520 | AT5G63520.1 | ATAAAGCCCAATG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FIST domain, N-terminal (InterPro:IPR013702); Has 96 Blast hits to 96 proteins in 46 species: Archae - 0; Bacteria - 72; Metazoa - 6; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G63670 | AT5G63670.1 | TTAAAGCCCATA | SPT4 HOMOLOG 2 (SPT42); FUNCTIONS IN: positive transcription elongation factor activity, zinc ion binding; INVOLVED IN: positive regulation of transcription, N-terminal protein myristoylation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation Spt4 (InterPro:IPR009287), Transcription initiation Spt4-like (InterPro:IPR016046); BEST Arabidopsis thaliana protein match is: positive transcription elongation factor/ zinc ion binding (TAIR:AT5G08565.1); Has 324 Blast hits to 324 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 119; Plants - 27; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).  |
AT5G63890 | AT5G63890.1 | GAATGGGCTTTACGGGCCTTAA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  |
AT5G63890.2 | GAATGGGCTTTACGGGCCTTAA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  | |
AT5G64370 | AT5G64370.1 | GTGGGCTTTA | PYD3 encodes a beta-ureidopropionase which, when expressed in E. coli, has been shown to convert beta-ureidopropionate into beta-alanine.  |
AT5G64370.1 | TAAAGCCCAATAA | PYD3 encodes a beta-ureidopropionase which, when expressed in E. coli, has been shown to convert beta-ureidopropionate into beta-alanine.  | |
AT5G64830 | AT5G64830.1 | AAAACCGGTTAGGGCTTTAT | programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).  |
AT5G64830.2 | AAAACCGGTTAGGGCTTTAT | programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: apoptosis; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320); BEST Arabidopsis thaliana protein match is: zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein (TAIR:AT4G02220.1); Has 526 Blast hits to 479 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 105; Plants - 49; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).  | |
AT5G65110 | AT5G65110.1 | ATAAAGCCCAAAAGCCCAC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis.  |
AT5G65110.2 | ATAAAGCCCAAAAGCCCAC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis.  | |
AT5G65220 | AT5G65220.1 | GGGCTTTA | ribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, nucleoid, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); Has 749 Blast hits to 747 proteins in 266 species: Archae - 0; Bacteria - 516; Metazoa - 5; Fungi - 12; Plants - 29; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).  |
AT5G65650 | AT5G65650.1 | AAATGGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G36660.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G65840 | AT5G65840.1 | ATATGGGCTTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37240.1); Has 167 Blast hits to 165 proteins in 51 species: Archae - 0; Bacteria - 28; Metazoa - 51; Fungi - 13; Plants - 59; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G65940 | AT5G65940.1 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA  |
AT5G65940.2 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA  | |
AT5G65940.3 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA  | |
AT5G66280 | AT5G66280.1 | TTAAAGCCCATCTTGGCCCAATAG | GDP-D-mannose 4,6-dehydratase  |
AT5G67100 | AT5G67100.1 | TTTTGGGCTTTAT | Encodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering.  |
AT5G67220 | AT5G67220.1 | ATAAAGCCCAT | nitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, oxidation reduction, tRNA processing, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7771 Blast hits to 7769 proteins in 1423 species: Archae - 42; Bacteria - 4261; Metazoa - 411; Fungi - 347; Plants - 96; Viruses - 0; Other Eukaryotes - 2614 (source: NCBI BLink).  |
AT5G67220.1 | TAAGCCCACTAAAGCCCAAAA | nitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, oxidation reduction, tRNA processing, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7771 Blast hits to 7769 proteins in 1423 species: Archae - 42; Bacteria - 4261; Metazoa - 411; Fungi - 347; Plants - 96; Viruses - 0; Other Eukaryotes - 2614 (source: NCBI BLink).  |