AtREG366

Summary of AtREG366 (All List)

Organism Arabidopsis thaliana
ID AtREG366
Sequence CACGTGTC
Annotation ABA
PPDB Motif ACGT bZIP-binding motif, environmental responses
PLACE Motif ACGT ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;
ACGTG ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;
CACGTG "CACGTG motif"; "G-box"; Binding site of Arabidopsis GBF4; C. roseus G-box binding factor 1 (CrGBF1) and 1 (CrGBF2) can act as transcriptional repressors of the Str promoter via direct interaction with the G-box; See S000345; Essential for expression of beta-phaseolin gene during embryogenesis in bean, tobacco, Arabidopsis; Tomato Pti4 (ERF) regulates defense-related gene expression via GCC box and non-GCC box cis-element (Myb1 (GTTAGTT) and G-box (CACGTG)); A prominent hit by in silico analysis in both induced and repressed phyA-responsive promoters (Hudson and Quail 2003); Review by Terzaghi WB, Cashmore AR. "Light-regulated transcription" in Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995);
ACGTGKC Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;
ACACNNG A novel class of bZIP transcription factors, DPBF-1 and 2 (Dc3 promoter-binding factor-1 and 2) binding core sequence; Found in the carrot (D.c.) Dc3 gene promoter; Dc3 expression is normally embryo-specific, and also can be induced by ABA; The Arabidopsis abscisic acid response gene ABI5 encodes a bZIP transcription factor; abi5 mutant have a pleiotropic defects in ABA response; ABI5 regulates a subset of late embryogenesis-abundant genes; GIA1 (growth-insensitivity to ABA) is identical to ABI5;
ACGTGTC Sequence present in 24 genes in the GA-down regulated d1 cluster (106 genes) found in Arabidopsis seed germination; This motif is similar to ABRE (Busk and Pages 1998);
Total Entry Count 644

Organism	Arabidopsis thaliana
ID	AtREG366
Sequence	`CACGTGTC`
Annotation	`ABA`
PPDB Motif	`ACGT`	`bZIP-binding motif, environmental responses`
PLACE Motif	`ACGT`	`ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;`
`ACGTG`	`ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;`
`CACGTG`	"CACGTG motif"; "G-box"; Binding site of Arabidopsis GBF4; C. roseus G-box binding factor 1 (CrGBF1) and 1 (CrGBF2) can act as transcriptional repressors of the Str promoter via direct interaction with the G-box; See S000345; Essential for expression of beta-phaseolin gene during embryogenesis in bean, tobacco, Arabidopsis; Tomato Pti4 (ERF) regulates defense-related gene expression via GCC box and non-GCC box cis-element (Myb1 (GTTAGTT) and G-box (CACGTG)); A prominent hit by in silico analysis in both induced and repressed phyA-responsive promoters (Hudson and Quail 2003); Review by Terzaghi WB, Cashmore AR. "Light-regulated transcription" in Annu Rev Plant Physiol Plant Mol Biol 46:445-474 (1995);
`ACGTGKC`	`Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;`
`ACACNNG`	A novel class of bZIP transcription factors, DPBF-1 and 2 (Dc3 promoter-binding factor-1 and 2) binding core sequence; Found in the carrot (D.c.) Dc3 gene promoter; Dc3 expression is normally embryo-specific, and also can be induced by ABA; The Arabidopsis abscisic acid response gene ABI5 encodes a bZIP transcription factor; abi5 mutant have a pleiotropic defects in ABA response; ABI5 regulates a subset of late embryogenesis-abundant genes; GIA1 (growth-insensitivity to ABA) is identical to ABI5;
`ACGTGTC`	`Sequence present in 24 genes in the GA-down regulated d1 cluster (106 genes) found in Arabidopsis seed germination; This motif is similar to ABRE (Busk and Pages 1998);`
Total Entry Count	`644`

Entry Sequences (644 entries)

Locus Gene model Sequence Description
AT1G01060 AT1G01060.1 ACCACGTGTCG LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1

AT1G01060.2 ACCACGTGTCG LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1

AT1G01060.3 ACCACGTGTCG LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1

AT1G01060.4 ACCACGTGTCG LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1

AT1G01720 AT1G01720.1 CGACACGTGTCC Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA.

AT1G02700 AT1G02700.1 AACACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02140.1); Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT1G02816 AT1G02816.1 ATGACACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G03030 AT1G03030.1 ATGACACGTGTCT phosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: kinase activity, phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uridine kinase (InterPro:IPR000764); Has 1794 Blast hits to 1794 proteins in 581 species: Archae - 7; Bacteria - 1124; Metazoa - 151; Fungi - 173; Plants - 39; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink).

AT1G03600 AT1G03600.1 GGACACGTGTCA photosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).

AT1G03630 AT1G03630.1 AGACACGTGTCAC Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.

AT1G03630.2 AGACACGTGTCAC Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.

AT1G04010 AT1G04010.1 AGACACGTGTAC phosphatidate-sterol O-acyltransferase/ phosphatidylcholine-sterol O-acyltransferase/ phosphatidylethanolamine-sterol O-acyltransferase; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity, phosphatidylethanolamine-sterol O-acyltransferase activity, phosphatidate-sterol O-acyltransferase activity; INVOLVED IN: sterol esterification, lipid metabolic process; LOCATED IN: microsome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: ATPDAT; phosphatidylcholine-sterol O-acyltransferase (TAIR:AT5G13640.1); Has 448 Blast hits to 445 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 76; Plants - 80; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).

AT1G04020 AT1G04020.1 GTACACGTGTCT Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression.

AT1G04020.2 GTACACGTGTCT Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression.

AT1G04250 AT1G04250.1 ATCCACGTGTCT Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.

AT1G04560 AT1G04560.1 AGACACGTGTCC AWPM-19-like membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: AWPM-19-like (InterPro:IPR008390); BEST Arabidopsis thaliana protein match is: AWPM-19-like membrane family protein (TAIR:AT1G29520.1); Has 99 Blast hits to 99 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 99; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G04820 AT1G04820.1 TACACGTGTCGTT Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers.

AT1G04920 AT1G04920.1 AACACGTGTCAT Encodes a protein with putative sucrose-phosphate synthase activity.

AT1G05360 AT1G05360.1 ATGACACGTGGT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).

AT1G07080 AT1G07080.1 AGACACGTGGCTT gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: OSH1 (OAS HIGH ACCUMULATION 1); catalytic (TAIR:AT5G01580.1); Has 339 Blast hits to 336 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 260; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).

AT1G07080.1 TACACGTGTCT gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: OSH1 (OAS HIGH ACCUMULATION 1); catalytic (TAIR:AT5G01580.1); Has 339 Blast hits to 336 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 260; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).

AT1G07470 AT1G07470.1 CACGTGTCA transcription factor IIA large subunit, putative / TFIIA large subunit, putative; FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor IIA, alpha/beta subunit (InterPro:IPR004855), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription factor IIA, alpha subunit, N-terminal (InterPro:IPR013028), Transcription factor IIA, helical (InterPro:IPR009083); BEST Arabidopsis thaliana protein match is: transcription factor IIA large subunit / TFIIA large subunit (TFIIA-L) (TAIR:AT1G07480.2); Has 561 Blast hits to 467 proteins in 136 species: Archae - 0; Bacteria - 14; Metazoa - 345; Fungi - 107; Plants - 45; Viruses - 6; Other Eukaryotes - 44 (source: NCBI BLink).

AT1G07480 AT1G07480.1 CACGTGTCC transcription factor IIA large subunit / TFIIA large subunit (TFIIA-L); FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription; LOCATED IN: transcription factor TFIIA complex; CONTAINS InterPro DOMAIN/s: Transcription factor IIA, alpha/beta subunit (InterPro:IPR004855), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription factor IIA, alpha subunit, N-terminal (InterPro:IPR013028), Transcription factor IIA, helical (InterPro:IPR009083); BEST Arabidopsis thaliana protein match is: transcription factor IIA large subunit, putative / TFIIA large subunit, putative (TAIR:AT1G07470.1); Has 582 Blast hits to 492 proteins in 138 species: Archae - 0; Bacteria - 27; Metazoa - 349; Fungi - 106; Plants - 45; Viruses - 9; Other Eukaryotes - 46 (source: NCBI BLink).

AT1G07480.2 CACGTGTCC transcription factor IIA large subunit / TFIIA large subunit (TFIIA-L); FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription; LOCATED IN: transcription factor TFIIA complex; CONTAINS InterPro DOMAIN/s: Transcription factor IIA, alpha/beta subunit (InterPro:IPR004855), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription factor IIA, alpha subunit, N-terminal (InterPro:IPR013028), Transcription factor IIA, helical (InterPro:IPR009083); BEST Arabidopsis thaliana protein match is: transcription factor IIA large subunit, putative / TFIIA large subunit, putative (TAIR:AT1G07470.1); Has 582 Blast hits to 492 proteins in 138 species: Archae - 0; Bacteria - 27; Metazoa - 349; Fungi - 106; Plants - 45; Viruses - 9; Other Eukaryotes - 46 (source: NCBI BLink).

AT1G09210 AT1G09210.1 TACACGTGTCA calreticulin 2 (CRT2); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: response to oxidative stress, response to salt stress; LOCATED IN: mitochondrion, endoplasmic reticulum, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Calreticulin (InterPro:IPR009169), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding (TAIR:AT1G56340.2); Has 6897 Blast hits to 3331 proteins in 371 species: Archae - 6; Bacteria - 265; Metazoa - 3811; Fungi - 490; Plants - 317; Viruses - 187; Other Eukaryotes - 1821 (source: NCBI BLink).

AT1G10090 AT1G10090.1 TTCCACGTGTCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).

AT1G10360 AT1G10360.1 ACCACGTGTCG Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).

AT1G10370 AT1G10370.1 TACACGTGTCA EARLY-RESPONSIVE TO DEHYDRATION 9 (ERD9); FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: response to water deprivation, toxin catabolic process; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATGSTU18 (GLUTATHIONE S-TRANSFERASE TAU 18); glutathione transferase (TAIR:AT1G10360.1); Has 3306 Blast hits to 3303 proteins in 662 species: Archae - 0; Bacteria - 1571; Metazoa - 184; Fungi - 70; Plants - 1070; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink).

AT1G10590 AT1G10590.1 ATGACACGTGTT DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

AT1G10590.2 ATGACACGTGTT DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

AT1G10590.3 ATGACACGTGTT DNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

AT1G10600 AT1G10600.1 AACACGTGTCAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).

AT1G10600.2 AACACGTGTCAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).

AT1G10600.3 AACACGTGTCAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).

AT1G11180 AT1G11180.1 TACACGTGTCGT secretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: SC3 (SECRETORY CARRIER 3); transmembrane transporter (TAIR:AT1G61250.1); Has 511 Blast hits to 511 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 333; Fungi - 12; Plants - 121; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).

AT1G11210 AT1G11210.1 GGACACGTGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF761, plant (InterPro:IPR008480); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11220.1); Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT1G11840 AT1G11840.1 CCGCCACGTGTCAT Encodes a glyoxalase I homolog ATGLX1.

AT1G11840.2 CCGCCACGTGTCAT Encodes a glyoxalase I homolog ATGLX1.

AT1G11840.3 CCGCCACGTGTCAT Encodes a glyoxalase I homolog ATGLX1.

AT1G11840.4 CCGCCACGTGTCAT Encodes a glyoxalase I homolog ATGLX1.

AT1G11840.5 CCGCCACGTGTCAT Encodes a glyoxalase I homolog ATGLX1.

AT1G12370 AT1G12370.1 TGACACGTGTT encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele

AT1G12370.2 TGACACGTGTT encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele

AT1G12570 AT1G12570.1 GTGACACGTGTCC glucose-methanol-choline (GMC) oxidoreductase family protein; FUNCTIONS IN: aldehyde-lyase activity, oxidoreductase activity, acting on CH-OH group of donors, FAD binding; INVOLVED IN: cellular alcohol metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Glucose-methanol-choline oxidoreductase, N-terminal (InterPro:IPR000172), Glucose-methanol-choline oxidoreductase (InterPro:IPR012132), Glucose-methanol-choline oxidoreductase, C-terminal (InterPro:IPR007867); BEST Arabidopsis thaliana protein match is: glucose-methanol-choline (GMC) oxidoreductase family protein (TAIR:AT5G51950.1); Has 8149 Blast hits to 8036 proteins in 676 species: Archae - 2; Bacteria - 2324; Metazoa - 714; Fungi - 1044; Plants - 126; Viruses - 12; Other Eukaryotes - 3927 (source: NCBI BLink).

AT1G12800 AT1G12800.1 ACCACGTGTCT S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink).

AT1G12810 AT1G12810.1 GTGACACGTGA proline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.

AT1G12810.2 GTGACACGTGA proline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.

AT1G12990 AT1G12990.1 ACCACGTGTCAC glycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G67880.1); Has 972 Blast hits to 971 proteins in 58 species: Archae - 0; Bacteria - 24; Metazoa - 46; Fungi - 23; Plants - 68; Viruses - 4; Other Eukaryotes - 807 (source: NCBI BLink).

AT1G13740 AT1G13740.1 AGACACGTGTCGT Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent.

AT1G13740.1 GCCACGTGTCGTT Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent.

AT1G15180 AT1G15180.1 GTGACACGTGGAC MATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G15170.1); Has 4248 Blast hits to 4206 proteins in 991 species: Archae - 55; Bacteria - 2461; Metazoa - 126; Fungi - 208; Plants - 689; Viruses - 0; Other Eukaryotes - 709 (source: NCBI BLink).

AT1G15180.2 GTGACACGTGGAC MATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G15170.1); Has 4248 Blast hits to 4206 proteins in 991 species: Archae - 55; Bacteria - 2461; Metazoa - 126; Fungi - 208; Plants - 689; Viruses - 0; Other Eukaryotes - 709 (source: NCBI BLink).

AT1G15740 AT1G15740.1 TACACGTGTCAT leucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT4G23840.1); Has 25965 Blast hits to 13594 proteins in 578 species: Archae - 6; Bacteria - 5108; Metazoa - 10615; Fungi - 448; Plants - 7228; Viruses - 79; Other Eukaryotes - 2481 (source: NCBI BLink).

AT1G15820 AT1G15820.1 TTCCACGTGTCAT Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II.

AT1G16540 AT1G16540.1 TGACACGTGACACG Encodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer.

AT1G16540.1 TGACACGTGGCAC Encodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer.

AT1G16560 AT1G16560.1 AGACACGTGGT Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT1G16560.2 AGACACGTGGT Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT1G16560.3 AGACACGTGGT Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT1G16560.4 AGACACGTGGT Per1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT1G16570 AT1G16570.1 AGACACGTGAC glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).

AT1G16570.2 AGACACGTGAC glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).

AT1G16590 AT1G16590.1 GTCACGTGTCT putative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).

AT1G16740 AT1G16740.1 AACACGTGTCC ribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).

AT1G16740.1 GTGACACGTGGT ribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).

AT1G16850 AT1G16850.1 AGACACGTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, leaf apex, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; Has 9 Blast hits to 9 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G18070 AT1G18070.1 TGACACGTGA EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).

AT1G18070.2 TGACACGTGA EF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).

AT1G18460 AT1G18460.1 CCCACGTGTCA lipase family protein; FUNCTIONS IN: lipase activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AB-hydrolase associated lipase region (InterPro:IPR006693); BEST Arabidopsis thaliana protein match is: lipase family protein (TAIR:AT1G73920.1); Has 1378 Blast hits to 1358 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 1048; Fungi - 175; Plants - 88; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).

AT1G19000 AT1G19000.1 AACACGTGTCAT myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).

AT1G19000.2 AACACGTGTCAT myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).

AT1G19140 AT1G19140.1 ACGTGACACGTGTAC FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).

AT1G19140.2 ACGTGACACGTGTAC FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).

AT1G19150 AT1G19150.1 GTACACGTGTCACGT PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA,

AT1G19350 AT1G19350.1 CGACACGTGGCT Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes

AT1G19350.4 CGACACGTGGCT Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes

AT1G19350.5 CGACACGTGGCT Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes

AT1G19350.6 CGACACGTGGCT Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes

AT1G19650 AT1G19650.1 CCGCCACGTGTCT SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink).

AT1G19650.2 CCGCCACGTGTCT SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink).

AT1G19860 AT1G19860.1 AGACACGTGTA zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT3G51180.1); Has 137 Blast hits to 123 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 6; Plants - 102; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT1G21410 AT1G21410.1 TACACGTGTCAT AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes.

AT1G21440 AT1G21440.1 ATGACACGTGGAT mutase family protein; FUNCTIONS IN: isocitrate lyase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 6447 Blast hits to 6447 proteins in 860 species: Archae - 75; Bacteria - 2907; Metazoa - 29; Fungi - 322; Plants - 109; Viruses - 0; Other Eukaryotes - 3005 (source: NCBI BLink).

AT1G21790 AT1G21790.1 CGACACGTGTCC FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT1G22710 AT1G22710.1 AGACACGTGTCAC Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage.

AT1G22850 AT1G22850.1 AGACACGTGGCG INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03260.1); Has 3098 Blast hits to 3098 proteins in 664 species: Archae - 6; Bacteria - 1614; Metazoa - 182; Fungi - 59; Plants - 145; Viruses - 0; Other Eukaryotes - 1092 (source: NCBI BLink).

AT1G23190 AT1G23190.1 TACACGTGTCT phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative; FUNCTIONS IN: intramolecular transferase activity, phosphotransferases, magnesium ion binding, phosphoglucomutase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, plasma membrane, chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-D-phosphohexomutase, C-terminal (InterPro:IPR005843), Alpha-D-phosphohexomutase, conserved site (InterPro:IPR016066), Alpha-D-phosphohexomutase, alpha/beta/alpha I, II and III (InterPro:IPR016055), Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (InterPro:IPR005846), Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (InterPro:IPR005845), Alpha-D-phosphohexomutase, N-terminal (InterPro:IPR005841), Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (InterPro:IPR005844); BEST Arabidopsis thaliana protein match is: phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative (TAIR:AT1G70730.3); Has 4473 Blast hits to 4462 proteins in 1171 species: Archae - 68; Bacteria - 2876; Metazoa - 457; Fungi - 136; Plants - 117; Viruses - 0; Other Eukaryotes - 819 (source: NCBI BLink).

AT1G23310 AT1G23310.1 AAAACGACGGACACGTGGAT Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.

AT1G23310.2 AAAACGACGGACACGTGGAT Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.

AT1G25275 AT1G25275.1 ATGACACGTGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G25275.2 ATGACACGTGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G25275.3 ATGACACGTGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G26670 AT1G26670.1 TGACACGTGTCA member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles.

AT1G26761 AT1G26761.1 AGACACGTGTT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 197 Blast hits to 129 proteins in 53 species: Archae - 0; Bacteria - 148; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).

AT1G27300 AT1G27300.1 TGTCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 36 Blast hits to 36 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT1G27461 AT1G27461.1 TCACACGTGTCC unknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT1G27600 AT1G27600.1 TCGCCACGTGTCC glycosyl transferase family 43 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); BEST Arabidopsis thaliana protein match is: IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups / xylosyltransferase (TAIR:AT2G37090.1); Has 547 Blast hits to 546 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 381; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).

AT1G27600.2 TCGCCACGTGTCC glycosyl transferase family 43 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); BEST Arabidopsis thaliana protein match is: IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups / xylosyltransferase (TAIR:AT2G37090.1); Has 547 Blast hits to 546 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 381; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).

AT1G27930 AT1G27930.1 GGACACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF579, plant (InterPro:IPR006514); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67330.1); Has 160 Blast hits to 160 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).

AT1G27990 AT1G27990.1 TGACACGTGTAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52420.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G28395 AT1G28395.1 TGACACGTGTCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G28395.2 TGACACGTGTCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G28395.3 TGACACGTGTCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G28395.4 TGACACGTGTCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G28540 AT1G28540.1 CACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G31420 AT1G31420.1 TGACACGTGTG Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.

AT1G32060 AT1G32060.1 CCCACGTGTCA PHOSPHORIBULOKINASE (PRK); FUNCTIONS IN: protein binding, phosphoribulokinase activity, ATP binding; INVOLVED IN: response to cold, defense response to bacterium, peptidyl-cysteine S-nitrosylation, biosynthetic process; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Phosphoribulokinase (InterPro:IPR006082); BEST Arabidopsis thaliana protein match is: uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative (TAIR:AT3G27440.1); Has 3778 Blast hits to 3778 proteins in 1337 species: Archae - 19; Bacteria - 2109; Metazoa - 288; Fungi - 89; Plants - 839; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink).

AT1G32550 AT1G32550.1 TCGCCACGTGTCT ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).

AT1G32550.2 TCGCCACGTGTCT ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).

AT1G32560 AT1G32560.1 AGACACGTGGCGA late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT2G35300.1); Has 190 Blast hits to 190 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT1G32900 AT1G32900.1 ACGCCACGTGTCAC starch synthase, putative; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, glucan biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycogen/starch synthases, ADP-glucose type (InterPro:IPR011835), Starch synthase catalytic region (InterPro:IPR013534), Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: AtSS2 (starch synthase 2); transferase, transferring glycosyl groups (TAIR:AT3G01180.1); Has 9548 Blast hits to 9532 proteins in 2484 species: Archae - 212; Bacteria - 3723; Metazoa - 12; Fungi - 137; Plants - 4346; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink).

AT1G33360 AT1G33360.1 TACACGTGTCC Encodes ClpX3, a subunit of the Clp protease complex.

AT1G34630 AT1G34630.1 CGACACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51150.1); Has 221 Blast hits to 214 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).

AT1G34630.2 CGACACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51150.1); Has 221 Blast hits to 214 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).

AT1G42990 AT1G42990.1 AACACGTGTCAT AtbZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. GFP fusions containing the first 260 amino acids (AtbZIP60deltaC) are nuclear-localized. AtbZIP60 is upregulated by the addition of tunicamycin (ER stress response inductor), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress the protein is proteolyzed and the soluble part is translocalized into the nucleus. AtbZIP60deltaC can activate the promoters of the ER chaperones BiP1, BiP2 and BiP3 and CNX1 and CNX2 via binding to the ER stress response element (ERSE) and the plant unfolded protein response element(P-UPRE). It can also activate its own transcription.

AT1G43160 AT1G43160.1 CCCACGTGTCAC encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily.

AT1G43670 AT1G43670.1 CTGCCACGTGTCAT fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: carbohydrate metabolic process, fructose metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT3G54050.1); Has 2339 Blast hits to 2334 proteins in 798 species: Archae - 22; Bacteria - 1225; Metazoa - 341; Fungi - 107; Plants - 205; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink).

AT1G44446 AT1G44446.1 TACACGTGTCAT Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.

AT1G44446.2 TACACGTGTCAT Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.

AT1G44446.3 TACACGTGTCAT Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.

AT1G48830 AT1G48830.1 TACACGTGTCAT 40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).

AT1G48830.2 TACACGTGTCAT 40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).

AT1G50430 AT1G50430.1 CACGTGACACGTGGG Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype.

AT1G50430.2 CACGTGACACGTGGG Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype.

AT1G50440 AT1G50440.1 CCCACGTGTCACGTG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).

AT1G50440.2 CCCACGTGTCACGTG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).

AT1G50440.3 CCCACGTGTCACGTG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).

AT1G51140 AT1G51140.1 TACACGTGTCA basic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42280.1); Has 1045 Blast hits to 1045 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 3; Plants - 1030; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).

AT1G51400 AT1G51400.1 AGACACGTGGCAA photosystem II 5 kD protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to UV-B, response to wounding, response to ozone; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSBTN (photosystem II subunit T) (TAIR:AT3G21055.1); Has 59 Blast hits to 59 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G52690 AT1G52690.1 ACCACGTGTCT late embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink).

AT1G52690.2 ACCACGTGTCT late embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink).

AT1G54100 AT1G54100.1 GGACACGTGACA Aldehyde dehydrogenase

AT1G54100.2 GGACACGTGACA Aldehyde dehydrogenase

AT1G55480 AT1G55480.1 ATGACACGTGGCGA binding / protein binding; FUNCTIONS IN: protein binding, binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), PDZ/DHR/GLGF (InterPro:IPR001478), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: LPA1 (LOW PSII ACCUMULATION1); binding (TAIR:AT1G02910.1); Has 203 Blast hits to 203 proteins in 54 species: Archae - 0; Bacteria - 65; Metazoa - 7; Fungi - 2; Plants - 97; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).

AT1G55820 AT1G55820.1 GTCCACGTGTCT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: GIP1 (GBF-INTERACTING PROTEIN 1); unfolded protein binding (TAIR:AT3G13222.1); Has 1009 Blast hits to 462 proteins in 111 species: Archae - 0; Bacteria - 42; Metazoa - 245; Fungi - 90; Plants - 135; Viruses - 12; Other Eukaryotes - 485 (source: NCBI BLink).

AT1G57540 AT1G57540.1 AGACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G57540.2 AGACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G57540.3 AGACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G60600 AT1G60600.1 AGACACGTGA Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.

AT1G60600.2 AGACACGTGA Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.

AT1G65040 AT1G65040.2 TACACGTGTCGTT protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).

AT1G65040.2 TACACGTGTCT protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).

AT1G65040.3 TACACGTGTCGTT protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).

AT1G65040.3 TACACGTGTCT protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).

AT1G66730 AT1G66730.1 TACACGTGTCA ATP dependent DNA ligase family protein; FUNCTIONS IN: DNA binding, DNA ligase (ATP) activity, ATP binding; INVOLVED IN: DNA repair, DNA replication, DNA recombination; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), DNA ligase, N-terminal (InterPro:IPR012308), ATP dependent DNA ligase, central (InterPro:IPR012310), ATP-dependent DNA ligase, conserved site (InterPro:IPR016059), DNA repair metallo-beta-lactamase (InterPro:IPR011084), ATP dependent DNA ligase, C-terminal (InterPro:IPR012309), ATP-dependent DNA ligase (InterPro:IPR000977); BEST Arabidopsis thaliana protein match is: ATLIG1 (ARABIDOPSIS THALIANA DNA LIGASE 1); ATP binding / DNA binding / DNA ligase (ATP) (TAIR:AT1G08130.1); Has 3133 Blast hits to 3071 proteins in 628 species: Archae - 227; Bacteria - 996; Metazoa - 564; Fungi - 431; Plants - 130; Viruses - 148; Other Eukaryotes - 637 (source: NCBI BLink).

AT1G67300 AT1G67300.1 GTGACACGTGCG hexose transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SGB1 (SUPPRESSOR OF G PROTEIN BETA1); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G79820.2); Has 25681 Blast hits to 25295 proteins in 1402 species: Archae - 357; Bacteria - 13235; Metazoa - 4312; Fungi - 4716; Plants - 1519; Viruses - 2; Other Eukaryotes - 1540 (source: NCBI BLink).

AT1G67300.2 GTGACACGTGCG hexose transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SGB1 (SUPPRESSOR OF G PROTEIN BETA1); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G79820.2); Has 25681 Blast hits to 25295 proteins in 1402 species: Archae - 357; Bacteria - 13235; Metazoa - 4312; Fungi - 4716; Plants - 1519; Viruses - 2; Other Eukaryotes - 1540 (source: NCBI BLink).

AT1G67785 AT1G67785.1 CGACACGTGGCAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G69010 AT1G69010.1 CCCACGTGTCAT BES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT1G69460 AT1G69460.1 TACACGTGTCA emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1075 Blast hits to 1073 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 308; Plants - 128; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink).

AT1G70480 AT1G70480.1 AAAACGACACGTGGCAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).

AT1G70480.2 AAAACGACACGTGGCAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).

AT1G70760 AT1G70760.1 ATGACACGTGGAA a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity.

AT1G72040 AT1G72040.1 CGCACGTGTCAT deoxynucleoside kinase family; FUNCTIONS IN: phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Deoxynucleoside kinase (InterPro:IPR002624); Has 1720 Blast hits to 1716 proteins in 345 species: Archae - 0; Bacteria - 621; Metazoa - 410; Fungi - 0; Plants - 41; Viruses - 60; Other Eukaryotes - 588 (source: NCBI BLink).

AT1G73060 AT1G73060.1 AGCCACGTGTCAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48790.1); Has 45 Blast hits to 45 proteins in 18 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT1G74780 AT1G74780.1 TCCACGTGTCAT nodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink).

AT1G74840 AT1G74840.1 AACACGTGTCAT myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 9 processes; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G19000.2); Has 742 Blast hits to 741 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 677; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).

AT1G74930 AT1G74930.1 CCGCCACGTGTCC encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.

AT1G75760 AT1G75760.1 ATCCACGTGTCAC ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT1G19970.1); Has 627 Blast hits to 627 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 115; Plants - 120; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).

AT1G76440 AT1G76440.1 TGACACGTGTCT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20870.1); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G76440.2 TGACACGTGTCT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20870.1); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G76440.3 TGACACGTGTCT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20870.1); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G77090 AT1G77090.1 TGACACGTGTGA thylakoid lumenal 29.8 kDa protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast stroma, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 20 kDa protein (TAIR:AT3G56650.1); Has 139 Blast hits to 139 proteins in 25 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).

AT1G77370 AT1G77370.1 TTGCCACGTGTCAT glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G20500.1); Has 4324 Blast hits to 4321 proteins in 856 species: Archae - 10; Bacteria - 1999; Metazoa - 364; Fungi - 233; Plants - 336; Viruses - 107; Other Eukaryotes - 1275 (source: NCBI BLink).

AT1G77450 AT1G77450.1 CTGCCACGTGTCC Arabidopsis NAC domain containing protein 32 (anac032); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ATAF1; transcription activator/ transcription factor (TAIR:AT1G01720.1); Has 1620 Blast hits to 1617 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1620; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT1G78510 AT1G78510.1 ATGACACGTGGT Encodes a protein with solanesyl diphosphate synthase activity.

AT1G78510.2 ATGACACGTGGT Encodes a protein with solanesyl diphosphate synthase activity.

AT1G78600 AT1G78600.1 TCACGTGTCT LIGHT-REGULATED ZINC FINGER PROTEIN 1 (LZF1); FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: chlorophyll biosynthetic process, chloroplast organization, anthocyanin biosynthetic process, regulation of photomorphogenesis, regulation of transcription; LOCATED IN: nuclear speck; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: STO (SALT TOLERANCE); DNA binding / protein binding / transcription factor/ zinc ion binding (TAIR:AT1G06040.2); Has 1252 Blast hits to 916 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 1143; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink).

AT1G79040 AT1G79040.1 AGCCACGTGTCAT Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ.

AT1G79350 AT1G79350.1 GTCACGTGATGACACGTGA embryo defective 1135 (EMB1135); FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: embryonic development ending in seed dormancy, regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, LSD1-type (InterPro:IPR005735), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: ATXR6; DNA binding / protein binding (TAIR:AT5G24330.1); Has 3516 Blast hits to 3129 proteins in 248 species: Archae - 2; Bacteria - 434; Metazoa - 2253; Fungi - 273; Plants - 285; Viruses - 34; Other Eukaryotes - 235 (source: NCBI BLink).

AT1G80110 AT1G80110.1 AGACACGTGTG ARABIDOPSIS THALIANA PHLOEM PROTEIN 2-B11 (ATPP2-B11); FUNCTIONS IN: carbohydrate binding; LOCATED IN: nucleus; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-B12 (Phloem protein 2-B12); carbohydrate binding (TAIR:AT5G24560.1); Has 276 Blast hits to 269 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 276; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G01320 AT2G01320.1 CACACGTGTCT ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).

AT2G01320.2 CACACGTGTCT ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).

AT2G01320.3 CACACGTGTCT ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).

AT2G01320.4 CACACGTGTCT ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).

AT2G01420 AT2G01420.1 TTGCCACGTGTCC Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452).

AT2G01420.2 TTGCCACGTGTCC Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452).

AT2G01720 AT2G01720.1 TACACGTGTCT ribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 87; Plants - 31; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).

AT2G02160 AT2G02160.1 CCCACGTGTCA zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 10894 Blast hits to 6834 proteins in 394 species: Archae - 15; Bacteria - 298; Metazoa - 5860; Fungi - 845; Plants - 435; Viruses - 183; Other Eukaryotes - 3258 (source: NCBI BLink).

AT2G03120 AT2G03120.1 AGACACGTGA homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant.

AT2G03820 AT2G03820.1 ATGACACGTGGAT nonsense-mediated mRNA decay NMD3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: nuclear-transcribed mRNA catabolic process, nonsense-mediated decay; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NMD3 (InterPro:IPR007064); Has 355 Blast hits to 345 proteins in 156 species: Archae - 8; Bacteria - 0; Metazoa - 129; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).

AT2G04100 AT2G04100.1 AACACGTGTCA MATE efflux family protein; FUNCTIONS IN: drug transporter activity, antiporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G04090.1); Has 5827 Blast hits to 5747 proteins in 1091 species: Archae - 83; Bacteria - 3728; Metazoa - 122; Fungi - 212; Plants - 684; Viruses - 0; Other Eukaryotes - 998 (source: NCBI BLink).

AT2G04350 AT2G04350.1 ATCCACGTGTCC long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).

AT2G04350.1 CCCACGTGTCC long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).

AT2G04350.2 ATCCACGTGTCC long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).

AT2G04350.2 CCCACGTGTCC long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).

AT2G06040 AT2G06040.1 TGACACGTGA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G21900.1); Has 3642 Blast hits to 1885 proteins in 175 species: Archae - 0; Bacteria - 109; Metazoa - 2066; Fungi - 492; Plants - 697; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).

AT2G16600 AT2G16600.1 TCCACGTGTCA Encodes cytosolic cyclophilin ROC3.

AT2G16600.2 TCCACGTGTCA Encodes cytosolic cyclophilin ROC3.

AT2G17560 AT2G17560.1 GTACACGTGTCA Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.

AT2G17560.2 GTACACGTGTCA Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.

AT2G17560.3 GTACACGTGTCA Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.

AT2G18050 AT2G18050.1 TAAACGACACGTGTAC encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA.

AT2G18050.2 TAAACGACACGTGTAC encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA.

AT2G18193 AT2G18193.1 GTCACGTGTCAC AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT2G18190.1); Has 15970 Blast hits to 14789 proteins in 1627 species: Archae - 790; Bacteria - 4301; Metazoa - 3207; Fungi - 2071; Plants - 1436; Viruses - 30; Other Eukaryotes - 4135 (source: NCBI BLink).

AT2G20260 AT2G20260.1 TCACACGTGTCAT Encodes subunit E of photosystem I.

AT2G20890 AT2G20890.1 GGACACGTGTCAC Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane–delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex.

AT2G21130 AT2G21130.1 AACACGTGTCG peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: ROC1 (ROTAMASE CYP 1); peptidyl-prolyl cis-trans isomerase (TAIR:AT4G38740.1); Has 11585 Blast hits to 11564 proteins in 1521 species: Archae - 82; Bacteria - 3695; Metazoa - 2395; Fungi - 955; Plants - 731; Viruses - 4; Other Eukaryotes - 3723 (source: NCBI BLink).

AT2G21130.1 CGACACGTGTCT peptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: ROC1 (ROTAMASE CYP 1); peptidyl-prolyl cis-trans isomerase (TAIR:AT4G38740.1); Has 11585 Blast hits to 11564 proteins in 1521 species: Archae - 82; Bacteria - 3695; Metazoa - 2395; Fungi - 955; Plants - 731; Viruses - 4; Other Eukaryotes - 3723 (source: NCBI BLink).

AT2G22010 AT2G22010.1 ACGCCACGTGTCA Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein.

AT2G22010.1 CGACACGTGTCG Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein.

AT2G22240 AT2G22240.1 ACGCCACGTGTCT ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.

AT2G22240.1 CCGCCACGTGTCC ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.

AT2G22240.2 ACGCCACGTGTCT ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.

AT2G22240.2 CCGCCACGTGTCC ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.

AT2G23440 AT2G23440.1 CACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G24360 AT2G24360.1 AAGCCACGTGTCT serine/threonine/tyrosine kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G31170.3); Has 96787 Blast hits to 95023 proteins in 3525 species: Archae - 68; Bacteria - 8423; Metazoa - 42926; Fungi - 8081; Plants - 19355; Viruses - 602; Other Eukaryotes - 17332 (source: NCBI BLink).

AT2G24420 AT2G24420.1 CGACACGTGTCA DNA repair ATPase-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT4G31340.1); Has 40459 Blast hits to 22195 proteins in 1227 species: Archae - 603; Bacteria - 4138; Metazoa - 19968; Fungi - 2677; Plants - 1225; Viruses - 186; Other Eukaryotes - 11662 (source: NCBI BLink).

AT2G24420.2 CGACACGTGTCA DNA repair ATPase-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT4G31340.1); Has 40459 Blast hits to 22195 proteins in 1227 species: Archae - 603; Bacteria - 4138; Metazoa - 19968; Fungi - 2677; Plants - 1225; Viruses - 186; Other Eukaryotes - 11662 (source: NCBI BLink).

AT2G25110 AT2G25110.1 ATGACACGTGTT STROMAL CELL-DERIVED FACTOR 2-LIKE PROTEIN PRECURSOR (SDF2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MIR (InterPro:IPR003608), MIR motif (InterPro:IPR016093); Has 774 Blast hits to 744 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 337; Fungi - 338; Plants - 41; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).

AT2G25890 AT2G25890.1 ACCACGTGTCA glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: leaf whorl, petal, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO1 (OLEOSIN 1) (TAIR:AT4G25140.1); Has 402 Blast hits to 402 proteins in 48 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 398; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G25900 AT2G25900.1 TACACGTGTCAT putative Cys3His zinc finger protein (ATCTH) mRNA, complete

AT2G28890 AT2G28890.1 CACGTGTCGT Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves.

AT2G30200 AT2G30200.1 GGACACGTGTCC [acyl-carrier-protein] S-malonyltransferase/ binding / catalytic/ transferase; FUNCTIONS IN: binding, transferase activity, [acyl-carrier-protein] S-malonyltransferase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Malonyl CoA-acyl carrier protein transacylase (InterPro:IPR004410), Acyl transferase region (InterPro:IPR001227), Acyl transferase (InterPro:IPR014043), Malonyl-CoA ACP transacylase, ACP-binding (InterPro:IPR016036); Has 10358 Blast hits to 9483 proteins in 1551 species: Archae - 0; Bacteria - 6429; Metazoa - 193; Fungi - 844; Plants - 33; Viruses - 0; Other Eukaryotes - 2859 (source: NCBI BLink).

AT2G30200.2 GGACACGTGTCC [acyl-carrier-protein] S-malonyltransferase/ binding / catalytic/ transferase; FUNCTIONS IN: binding, transferase activity, [acyl-carrier-protein] S-malonyltransferase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Malonyl CoA-acyl carrier protein transacylase (InterPro:IPR004410), Acyl transferase region (InterPro:IPR001227), Acyl transferase (InterPro:IPR014043), Malonyl-CoA ACP transacylase, ACP-binding (InterPro:IPR016036); Has 10358 Blast hits to 9483 proteins in 1551 species: Archae - 0; Bacteria - 6429; Metazoa - 193; Fungi - 844; Plants - 33; Viruses - 0; Other Eukaryotes - 2859 (source: NCBI BLink).

AT2G30390 AT2G30390.1 GGACACGTGTG Encodes one of two ferrochelatase genes in Arabidopsis. Ferrochelatase is the terminal enzyme of heme biosynthesis. FC-II is speculated to operate in photosynthetic cytochromes

AT2G30570 AT2G30570.1 ATGACACGTGGA Encodes a protein similar to photosystem II reaction center subunit W.

AT2G32415 AT2G32415.1 AACACGTGTCA 3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae - 0; Bacteria - 1374; Metazoa - 367; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 953 (source: NCBI BLink).

AT2G32415.1 AGACACGTGTT 3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae - 0; Bacteria - 1374; Metazoa - 367; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 953 (source: NCBI BLink).

AT2G33380 AT2G33380.1 TGACACGTGTCC Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers.

AT2G33380.2 TGACACGTGTCC Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers.

AT2G33700 AT2G33700.1 TGACACGTGTCG protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51470.1); Has 4375 Blast hits to 4330 proteins in 315 species: Archae - 3; Bacteria - 175; Metazoa - 1377; Fungi - 480; Plants - 1317; Viruses - 7; Other Eukaryotes - 1016 (source: NCBI BLink).

AT2G34650 AT2G34650.1 TCACACGTGTCAT Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID.

AT2G35260 AT2G35260.1 TCCACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17840.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G35620 AT2G35620.1 CGACACGTGTA Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.

AT2G35680 AT2G35680.1 AACACGTGTCA dual specificity protein phosphatase family protein; FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: dual specificity protein phosphatase family protein (TAIR:AT5G56610.1); Has 1622 Blast hits to 1620 proteins in 220 species: Archae - 34; Bacteria - 127; Metazoa - 962; Fungi - 94; Plants - 121; Viruses - 22; Other Eukaryotes - 262 (source: NCBI BLink).

AT2G37250 AT2G37250.1 TACACGTGTCA encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth

AT2G37880 AT2G37880.1 TTCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21050.1); Has 134 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 134; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT2G38650 AT2G38650.1 AGACACGTGTT GALACTURONOSYLTRANSFERASE 7 (GAUT7); FUNCTIONS IN: polygalacturonate 4-alpha-galacturonosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: GAUT4 (Galacturonosyltransferase 4); polygalacturonate 4-alpha-galacturonosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT5G47780.1); Has 882 Blast hits to 876 proteins in 179 species: Archae - 0; Bacteria - 255; Metazoa - 131; Fungi - 43; Plants - 430; Viruses - 2; Other Eukaryotes - 21 (source: NCBI BLink).

AT2G38740 AT2G38740.1 GTGACACGTGGCGA haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), Haloacid dehydrogenase/epoxide hydrolase (InterPro:IPR005833), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT1G56500.1); Has 10291 Blast hits to 10291 proteins in 1397 species: Archae - 137; Bacteria - 7267; Metazoa - 142; Fungi - 274; Plants - 203; Viruses - 3; Other Eukaryotes - 2265 (source: NCBI BLink).

AT2G38810 AT2G38810.1 CACGTGTCGT Encodes HTA8, a histone H2A protein.

AT2G38810.2 CACGTGTCGT Encodes HTA8, a histone H2A protein.

AT2G38810.3 CACGTGTCGT Encodes HTA8, a histone H2A protein.

AT2G38820 AT2G38820.1 ACGACACGTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT2G38820.2 ACGACACGTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT2G39170 AT2G39170.1 AGACACGTGCG unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT2G39270 AT2G39270.1 ATGACACGTGTT adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; CONTAINS InterPro DOMAIN/s: Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 8604 Blast hits to 8484 proteins in 1852 species: Archae - 61; Bacteria - 4479; Metazoa - 995; Fungi - 287; Plants - 246; Viruses - 0; Other Eukaryotes - 2536 (source: NCBI BLink).

AT2G39805 AT2G39805.1 TCACGTGTCC integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).

AT2G39805.2 TCACGTGTCC integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).

AT2G40120 AT2G40120.1 GTACACGTGTCA protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G17750.1); Has 65627 Blast hits to 64489 proteins in 2041 species: Archae - 50; Bacteria - 5400; Metazoa - 28985; Fungi - 7798; Plants - 8456; Viruses - 355; Other Eukaryotes - 14583 (source: NCBI BLink).

AT2G40300 AT2G40300.1 GTACACGTGTCT Encodes FERRITIN 4, AtFER4. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool.

AT2G40810 AT2G40810.1 AGACACGTGA AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).

AT2G40810.2 AGACACGTGA AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).

AT2G40880 AT2G40880.1 AGACACGTGTCAT Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmitic, cold stress).

AT2G41280 AT2G41280.1 GGACACGTGTA Encodes a hydrophilic protein similar to Late Embryogenesis Activated (LEA) proteins expressed during embryogenesis, which are thought to be involved in the acquisition of dessication tolerance.

AT2G42270 AT2G42270.1 CGCACGTGTCA U5 small nuclear ribonucleoprotein helicase, putative; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: emb1507 (embryo defective 1507); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / nucleoside-triphosphatase/ nucleotide binding (TAIR:AT1G20960.1); Has 13381 Blast hits to 8246 proteins in 1082 species: Archae - 1064; Bacteria - 4051; Metazoa - 2407; Fungi - 1500; Plants - 518; Viruses - 50; Other Eukaryotes - 3791 (source: NCBI BLink).

AT2G42750 AT2G42750.1 TGACACGTGCCACG DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1); Has 11990 Blast hits to 11989 proteins in 1806 species: Archae - 113; Bacteria - 4757; Metazoa - 2272; Fungi - 965; Plants - 810; Viruses - 15; Other Eukaryotes - 3058 (source: NCBI BLink).

AT2G43240 AT2G43240.1 ACCACGTGTCA nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).

AT2G43240.2 ACCACGTGTCA nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).

AT2G44610 AT2G44610.1 ATGACACGTG Encodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant.

AT2G45300 AT2G45300.1 AACACGTGTCAT encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis

AT2G46020 AT2G46020.1 TCACACGTGTCT Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.

AT2G46020.2 TCACACGTGTCT Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.

AT2G46170 AT2G46170.1 GGACACGTGTCGT reticulon family protein (RTNLB5); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB6) (TAIR:AT3G61560.1); Has 951 Blast hits to 951 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 6; Plants - 274; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).

AT2G46170.2 GGACACGTGTCGT reticulon family protein (RTNLB5); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB6) (TAIR:AT3G61560.1); Has 951 Blast hits to 951 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 6; Plants - 274; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).

AT2G46500 AT2G46500.1 AGACACGTGTCC phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein (TAIR:AT5G24240.1); Has 9099 Blast hits to 3359 proteins in 560 species: Archae - 0; Bacteria - 10; Metazoa - 3779; Fungi - 1061; Plants - 2175; Viruses - 263; Other Eukaryotes - 1811 (source: NCBI BLink).

AT2G46500.2 AGACACGTGTCC phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein (TAIR:AT5G24240.1); Has 9099 Blast hits to 3359 proteins in 560 species: Archae - 0; Bacteria - 10; Metazoa - 3779; Fungi - 1061; Plants - 2175; Viruses - 263; Other Eukaryotes - 1811 (source: NCBI BLink).

AT2G46790 AT2G46790.1 ATGACACGTGTT Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.

AT2G46790.1 CCCACGTGTCAT Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.

AT2G46790.2 ATGACACGTGTT Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.

AT2G46790.2 CCCACGTGTCAT Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.

AT2G47350 AT2G47350.1 CACACGTGTCT PAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT1G56460.1); Has 2885 Blast hits to 2186 proteins in 266 species: Archae - 7; Bacteria - 140; Metazoa - 1186; Fungi - 340; Plants - 134; Viruses - 23; Other Eukaryotes - 1055 (source: NCBI BLink).

AT2G47350.2 CACACGTGTCT PAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT1G56460.1); Has 2885 Blast hits to 2186 proteins in 266 species: Archae - 7; Bacteria - 140; Metazoa - 1186; Fungi - 340; Plants - 134; Viruses - 23; Other Eukaryotes - 1055 (source: NCBI BLink).

AT2G47460 AT2G47460.1 CACACGTGTCAT "MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. " The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots.

AT2G47780 AT2G47780.1 CGACACGTGTT rubber elongation factor (REF) protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) family protein (TAIR:AT3G05500.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G01060 AT3G01060.1 TTAAACCGGTCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).

AT3G01060.2 TTAAACCGGTCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).

AT3G01060.3 TTAAACCGGTCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 469 Blast hits to 469 proteins in 133 species: Archae - 0; Bacteria - 209; Metazoa - 0; Fungi - 45; Plants - 30; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).

AT3G02230 AT3G02230.1 ACCACGTGTCA reversibly glycosylated polypeptide possibly involved in plant cell wall synthesis

AT3G02480 AT3G02480.1 CACGTGTCC ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38760.1); Has 144 Blast hits to 124 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G02480.1 CGACACGTGGA ABA-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38760.1); Has 144 Blast hits to 124 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 8; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G02800 AT3G02800.1 AAAACGACACGTGTCA phosphatase/ phosphoprotein phosphatase/ protein tyrosine phosphatase; FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, phosphoprotein phosphatase activity; INVOLVED IN: dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Protein-tyrosine phosphatase, SIW14-like (InterPro:IPR004861); BEST Arabidopsis thaliana protein match is: tyrosine specific protein phosphatase family protein (TAIR:AT5G16480.1); Has 485 Blast hits to 476 proteins in 107 species: Archae - 0; Bacteria - 42; Metazoa - 5; Fungi - 252; Plants - 83; Viruses - 0; Other Eukaryotes - 103 (source: NCBI BLink).

AT3G03150 AT3G03150.1 AGACACGTGGAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G03160 AT3G03160.1 ATCCACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G03250 AT3G03250.1 GTGACACGTGTA Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding.

AT3G03310 AT3G03310.1 GTGACACGTGA lecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: lecithin:cholesterol acyltransferase family protein / LACT family protein (TAIR:AT4G19860.1); Has 367 Blast hits to 361 proteins in 102 species: Archae - 2; Bacteria - 30; Metazoa - 160; Fungi - 6; Plants - 75; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).

AT3G03320 AT3G03320.1 TCACGTGTCAC FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ProFAR isomerase-like (InterPro:IPR010759), ASCH domain (InterPro:IPR007374); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G43465.1); Has 65 Blast hits to 65 proteins in 18 species: Archae - 31; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).

AT3G04240 AT3G04240.1 AGACACGTGTT Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene.

AT3G04240.1 TACACGTGTCA Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene.

AT3G04620 AT3G04620.1 AACACGTGTCACGT nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G29250.1); Has 89 Blast hits to 89 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).

AT3G05210 AT3G05210.1 AGACACGTGTT encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10.

AT3G05710 AT3G05710.1 AGACACGTGGCGT member of SYP4 Gene Family

AT3G05710.2 AGACACGTGGCGT member of SYP4 Gene Family

AT3G05858 AT3G05858.1 GTCCACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26620.1); Has 26 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G06780 AT3G06780.1 AGACACGTGGCTT glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 4026 Blast hits to 2251 proteins in 290 species: Archae - 2; Bacteria - 737; Metazoa - 1865; Fungi - 196; Plants - 741; Viruses - 43; Other Eukaryotes - 442 (source: NCBI BLink).

AT3G06868 AT3G06868.1 GGACACGTGGAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49100.1); Has 1032 Blast hits to 474 proteins in 98 species: Archae - 0; Bacteria - 49; Metazoa - 464; Fungi - 149; Plants - 38; Viruses - 14; Other Eukaryotes - 318 (source: NCBI BLink).

AT3G08530 AT3G08530.1 TCACGTGTCGT clathrin heavy chain, putative; FUNCTIONS IN: protein binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast, membrane; EXPRESSED IN: guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Clathrin, heavy chain (InterPro:IPR016341), Clathrin, heavy chain, linker and propeller (InterPro:IPR016025), Tetratricopeptide-like helical (InterPro:IPR011990), Clathrin, heavy chain, propeller, N-terminal (InterPro:IPR001473), Clathrin, heavy chain, linker, core motif (InterPro:IPR015348), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); BEST Arabidopsis thaliana protein match is: clathrin heavy chain, putative (TAIR:AT3G11130.1); Has 1212 Blast hits to 1102 proteins in 356 species: Archae - 0; Bacteria - 29; Metazoa - 727; Fungi - 112; Plants - 61; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink).

AT3G08630 AT3G08630.1 ATGACACGTGGG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: alphavirus core protein family (TAIR:AT3G08640.1); Has 3471 Blast hits to 1913 proteins in 226 species: Archae - 0; Bacteria - 450; Metazoa - 1700; Fungi - 130; Plants - 787; Viruses - 19; Other Eukaryotes - 385 (source: NCBI BLink).

AT3G08720 AT3G08720.1 AACACGTGTCC Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins.

AT3G08720.2 AACACGTGTCC Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins.

AT3G08840 AT3G08840.1 TGACACGTG D-alanine--D-alanine ligase family; FUNCTIONS IN: D-alanine-D-alanine ligase activity, catalytic activity, ATP binding; INVOLVED IN: peptidoglycan biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PreATP-grasp-like fold (InterPro:IPR016185), ATP-grasp fold (InterPro:IPR011761), D-alanine--D-alanine ligase/VANA/B/C, conserved site (InterPro:IPR000291), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), D-alanine--D-alanine ligase, N-terminal (InterPro:IPR011127), Pre-ATP-grasp fold (InterPro:IPR013817); Has 9767 Blast hits to 5292 proteins in 1363 species: Archae - 6; Bacteria - 6725; Metazoa - 4; Fungi - 8; Plants - 38; Viruses - 0; Other Eukaryotes - 2986 (source: NCBI BLink).

AT3G08840.2 TGACACGTG D-alanine--D-alanine ligase family; FUNCTIONS IN: D-alanine-D-alanine ligase activity, catalytic activity, ATP binding; INVOLVED IN: peptidoglycan biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PreATP-grasp-like fold (InterPro:IPR016185), ATP-grasp fold (InterPro:IPR011761), D-alanine--D-alanine ligase/VANA/B/C, conserved site (InterPro:IPR000291), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), D-alanine--D-alanine ligase, N-terminal (InterPro:IPR011127), Pre-ATP-grasp fold (InterPro:IPR013817); Has 9767 Blast hits to 5292 proteins in 1363 species: Archae - 6; Bacteria - 6725; Metazoa - 4; Fungi - 8; Plants - 38; Viruses - 0; Other Eukaryotes - 2986 (source: NCBI BLink).

AT3G08840.3 TGACACGTG D-alanine--D-alanine ligase family; FUNCTIONS IN: D-alanine-D-alanine ligase activity, catalytic activity, ATP binding; INVOLVED IN: peptidoglycan biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PreATP-grasp-like fold (InterPro:IPR016185), ATP-grasp fold (InterPro:IPR011761), D-alanine--D-alanine ligase/VANA/B/C, conserved site (InterPro:IPR000291), ATP-grasp fold, subdomain 2 (InterPro:IPR013816), D-alanine--D-alanine ligase, N-terminal (InterPro:IPR011127), Pre-ATP-grasp fold (InterPro:IPR013817); Has 9767 Blast hits to 5292 proteins in 1363 species: Archae - 6; Bacteria - 6725; Metazoa - 4; Fungi - 8; Plants - 38; Viruses - 0; Other Eukaryotes - 2986 (source: NCBI BLink).

AT3G09640 AT3G09640.1 ATGACACGTGGT Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.

AT3G09640.2 ATGACACGTGGT Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.

AT3G10250 AT3G10250.1 TACACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04090.2); Has 135 Blast hits to 135 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).

AT3G10250.2 TACACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04090.2); Has 135 Blast hits to 135 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).

AT3G10330 AT3G10330.1 AGACACGTGGAC transcription initiation factor IIB-2 / general transcription factor TFIIB-2 (TFIIB2); FUNCTIONS IN: protein binding, RNA polymerase II transcription factor activity, transcription regulator activity, zinc ion binding, translation initiation factor activity; INVOLVED IN: translational initiation, regulation of transcription, DNA-dependent, transcription initiation, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Zinc finger, TFIIB-type (InterPro:IPR013137), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: TFIIB (TRANSCRIPTION FACTOR II B); RNA polymerase II transcription factor/ protein binding / transcription regulator/ translation initiation factor/ zinc ion binding (TAIR:AT2G41630.1); Has 1521 Blast hits to 1508 proteins in 255 species: Archae - 348; Bacteria - 0; Metazoa - 268; Fungi - 189; Plants - 107; Viruses - 10; Other Eukaryotes - 599 (source: NCBI BLink).

AT3G10340 AT3G10340.1 AGACACGTGGT Phenylalanine ammonia-lyase 4 (PAL4); FUNCTIONS IN: ammonia-lyase activity, ammonia ligase activity, catalytic activity; INVOLVED IN: L-phenylalanine catabolic process, biosynthetic process; LOCATED IN: cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phenylalanine/histidine ammonia-lyase (InterPro:IPR001106), L-Aspartase-like (InterPro:IPR008948), Phenylalanine ammonia-lyase (InterPro:IPR005922); BEST Arabidopsis thaliana protein match is: pal1 (Phe ammonia lyase 1); phenylalanine ammonia-lyase (TAIR:AT2G37040.1); Has 3125 Blast hits to 3120 proteins in 832 species: Archae - 21; Bacteria - 1672; Metazoa - 68; Fungi - 91; Plants - 781; Viruses - 0; Other Eukaryotes - 492 (source: NCBI BLink).

AT3G10500 AT3G10500.1 TTCCACGTGTCA Arabidopsis NAC domain containing protein 53 (anac053); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC2; transcription factor (TAIR:AT5G04410.1); Has 1637 Blast hits to 1630 proteins in 61 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 3; Plants - 1621; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).

AT3G10985 AT3G10985.1 AACACGTGTCA A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis.

AT3G11020 AT3G11020.1 AACACGTGTCGT encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A.

AT3G11050 AT3G11050.1 TTCCACGTGTCC ferritin 2 (ATFER2); FUNCTIONS IN: oxidoreductase activity, ferric iron binding, binding, transition metal ion binding; INVOLVED IN: response to oxidative stress, cellular iron ion homeostasis, response to abscisic acid stimulus, iron ion transport; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal (InterPro:IPR001519), Ferritin-related (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040), Ferritin, conserved site (InterPro:IPR014034), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Ferritin and Dps (InterPro:IPR008331); BEST Arabidopsis thaliana protein match is: ATFER4 (ferritin 4); binding / ferric iron binding / oxidoreductase/ transition metal ion binding (TAIR:AT2G40300.1); Has 2388 Blast hits to 2383 proteins in 603 species: Archae - 119; Bacteria - 761; Metazoa - 1101; Fungi - 6; Plants - 217; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).

AT3G11330 AT3G11330.1 TACACGTGTCA leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT5G05850.1); Has 56721 Blast hits to 22652 proteins in 869 species: Archae - 19; Bacteria - 4682; Metazoa - 27023; Fungi - 1823; Plants - 19445; Viruses - 12; Other Eukaryotes - 3717 (source: NCBI BLink).

AT3G11770 AT3G11770.1 AGACACGTGTCAT nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT5G06450.1); Has 77 Blast hits to 77 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).

AT3G12010 AT3G12010.1 CACACGTGTCG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: Colon cancer-associated Mic1-like (InterPro:IPR009755); Has 126 Blast hits to 120 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).

AT3G12012 AT3G12012.1 CACACGTGTCG Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF20 represents a conserved upstream opening reading frame relative to major ORF AT3G12010.1

AT3G12300 AT3G12300.1 AGACACGTGGCAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).

AT3G13980 AT3G13980.1 AGACACGTGGCAAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G54200.1); Has 1723 Blast hits to 368 proteins in 83 species: Archae - 0; Bacteria - 6; Metazoa - 456; Fungi - 56; Plants - 60; Viruses - 6; Other Eukaryotes - 1139 (source: NCBI BLink).

AT3G14150 AT3G14150.1 TGACACGTGGT (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink).

AT3G14150.2 TGACACGTGGT (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink).

AT3G14160 AT3G14160.1 ACCACGTGTCA oxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G14140.1); Has 756 Blast hits to 755 proteins in 353 species: Archae - 0; Bacteria - 523; Metazoa - 76; Fungi - 30; Plants - 41; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).

AT3G14180 AT3G14180.1 TTCCACGTGTCC transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).

AT3G14590 AT3G14590.1 TCACACGTGTCTGACACGT NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).

AT3G14590.2 TCACACGTGTCTGACACGT NTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).

AT3G15280 AT3G15280.1 CACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G15280.1 GTCCACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G15290 AT3G15290.1 CGACACGTG 3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink).

AT3G15290.1 CGACACGTGGAC 3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink).

AT3G15420 AT3G15420.1 TGACACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G15430 AT3G15430.1 TTCCACGTGTCA regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).

AT3G15430.2 TTCCACGTGTCA regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).

AT3G15500 AT3G15500.1 ATCCACGTGTCAT Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3.

AT3G15540 AT3G15540.1 TCCACGTGTCG IAA induced protein 19

AT3G15640 AT3G15640.1 TGACACGTGTG cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).

AT3G15640.2 TGACACGTGTG cytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).

AT3G15790 AT3G15790.1 AGACACGTGGT Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.

AT3G16140 AT3G16140.1 TTGCCACGTGTCA Encodes subunit H of photosystem I reaction center subunit VI.

AT3G16910 AT3G16910.1 ACGCCACGTGTCG Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle.

AT3G17040 AT3G17040.1 ACCACGTGTCAC It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis.

AT3G17520 AT3G17520.1 AACACGTGTCA late embryogenesis abundant domain-containing protein / LEA domain-containing protein; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endomembrane system; EXPRESSED IN: cultured cell, seed, leaf; EXPRESSED DURING: dry seed stage, LP.04 four leaves visible; Has 34185 Blast hits to 18660 proteins in 1584 species: Archae - 165; Bacteria - 7752; Metazoa - 10377; Fungi - 3168; Plants - 2120; Viruses - 260; Other Eukaryotes - 10343 (source: NCBI BLink).

AT3G18350 AT3G18350.1 AGACACGTGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF639 (InterPro:IPR006927); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48840.1); Has 84 Blast hits to 81 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G18950 AT3G18950.1 TAAAACGCCACGTGTCAT transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G49450.1); Has 22480 Blast hits to 12151 proteins in 451 species: Archae - 14; Bacteria - 3107; Metazoa - 9780; Fungi - 4621; Plants - 1980; Viruses - 0; Other Eukaryotes - 2978 (source: NCBI BLink).

AT3G19540 AT3G19540.1 ATCCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49840.1); Has 153 Blast hits to 150 proteins in 31 species: Archae - 0; Bacteria - 3; Metazoa - 14; Fungi - 12; Plants - 117; Viruses - 5; Other Eukaryotes - 2 (source: NCBI BLink).

AT3G19590 AT3G19590.1 TACACGTGTCAC WD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink).

AT3G19790 AT3G19790.1 TCACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT3G19790.2 TCACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 27 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 9; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT3G20500 AT3G20500.1 AGACACGTGTCGT PURPLE ACID PHOSPHATASE 18 (PAP18); FUNCTIONS IN: protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP22 (PURPLE ACID PHOSPHATASE 22); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT3G52820.1); Has 1308 Blast hits to 1297 proteins in 293 species: Archae - 2; Bacteria - 397; Metazoa - 190; Fungi - 60; Plants - 434; Viruses - 0; Other Eukaryotes - 225 (source: NCBI BLink).

AT3G20550 AT3G20550.1 ATGACACGTGTCA Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL.

AT3G21055 AT3G21055.1 ATGACACGTGGC Encodes photosystem II 5 kD protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which also has a plastid-encoded paralog (PsbTc).

AT3G21060 AT3G21060.1 GCCACGTGTCAT transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 4301 Blast hits to 3013 proteins in 248 species: Archae - 10; Bacteria - 960; Metazoa - 1315; Fungi - 1005; Plants - 275; Viruses - 0; Other Eukaryotes - 736 (source: NCBI BLink).

AT3G21865 AT3G21865.1 AGACACGTGTCC Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes.

AT3G21870 AT3G21870.1 GTGACACGTGTCA cyclin p2;1 (CYCP2;1); FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Negative regulatory factor PREG (InterPro:IPR012389), Cyclin-like (InterPro:IPR011028), Cyclin, N-terminal (InterPro:IPR006671), Cyclin-related 2 (InterPro:IPR013922), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: CYCP4;1 (cyclin p4;1); cyclin-dependent protein kinase (TAIR:AT2G44740.1); Has 933 Blast hits to 925 proteins in 163 species: Archae - 0; Bacteria - 16; Metazoa - 187; Fungi - 381; Plants - 128; Viruses - 0; Other Eukaryotes - 221 (source: NCBI BLink).

AT3G21890 AT3G21890.1 ATCCACGTGTCC zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to UV-B, regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G15248.1); Has 963 Blast hits to 745 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 953; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).

AT3G22370 AT3G22370.1 TACACGTGTCAT Encodes an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited.

AT3G22680 AT3G22680.1 TGACACGTGTAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1950 (InterPro:IPR015270); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G23050 AT3G23050.1 CAAGCCCACGTGTCAT Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.

AT3G23050.2 CAAGCCCACGTGTCAT Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.

AT3G23920 AT3G23920.1 TACACGTGTCAC Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.

AT3G24440 AT3G24440.1 ATGACACGTGTACCCTAGA Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM.

AT3G24929 AT3G24929.1 CCCACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown.

AT3G25110 AT3G25110.1 AGACACGTG Encodes a FatA acyl-ACP thioesterase

AT3G27020 AT3G27020.1 TACACGTGTCAC Arabidopsis thaliana metal-nicotianamine transporter YSL6

AT3G28220 AT3G28220.1 AGACACGTGA meprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: vacuole, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: ZW9 (TAIR:AT1G58270.1); Has 753 Blast hits to 633 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 281; Fungi - 0; Plants - 424; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).

AT3G29075 AT3G29075.1 TAAAAGCCACGTGTCAC glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11440.1); Has 101257 Blast hits to 35557 proteins in 1171 species: Archae - 141; Bacteria - 8540; Metazoa - 34827; Fungi - 8697; Plants - 4163; Viruses - 767; Other Eukaryotes - 44122 (source: NCBI BLink).

AT3G29575 AT3G29575.1 TTCCACGTGTCGTT ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G29575.3 TTCCACGTGTCGTT ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G29575.4 TTCCACGTGTCGTT ABI FIVE BINDING PROTEIN 3 (AFP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: TMAC2 (TWO OR MORE ABRES-CONTAINING GENE 2) (TAIR:AT3G02140.1); Has 97 Blast hits to 94 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G30300 AT3G30300.1 TCACACGTGTCT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: EDA30 (embryo sac development arrest 30) (TAIR:AT3G03810.1); Has 512 Blast hits to 417 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 512; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G44100 AT3G44100.1 AGACACGTG MD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT3G11780.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 77; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).

AT3G45600 AT3G45600.1 TGACACGTGTCA Member of TETRASPANIN family

AT3G45730 AT3G45730.1 TCACACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G45740 AT3G45740.1 TCACACGTGTCT hydrolase family protein / HAD-superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIA, CECR5 (InterPro:IPR006353), HAD-superfamily hydrolase, subfamily IIA (InterPro:IPR006357); Has 367 Blast hits to 355 proteins in 105 species: Archae - 5; Bacteria - 2; Metazoa - 102; Fungi - 197; Plants - 14; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).

AT3G46520 AT3G46520.1 GGACACGTGTCT Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development.

AT3G47470 AT3G47470.1 TGACACGTGTA Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins.

AT3G48530 AT3G48530.1 TTCCACGTGTCA SNF1-RELATED PROTEIN KINASE REGULATORY SUBUNIT GAMMA 1 (KING1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G69800.2); Has 1838 Blast hits to 1829 proteins in 530 species: Archae - 94; Bacteria - 923; Metazoa - 290; Fungi - 92; Plants - 72; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink).

AT3G48690 AT3G48690.1 TCACGTGTCT Encodes a protein with carboxylesterase whose activity was tested using both pNA and 2,4-D-methyl.

AT3G49530 AT3G49530.1 TTCCACGTGTCAT Arabidopsis NAC domain containing protein 62 (anac062); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: TIP (TCV-INTERACTING PROTEIN); transcription coactivator/ transcription factor (TAIR:AT5G24590.2); Has 1568 Blast hits to 1566 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1568; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G50820 AT3G50820.1 AGACACGTGGCT Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII.

AT3G51510 AT3G51510.1 ACCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT3G52060 AT3G52060.1 TCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22070.1); Has 327 Blast hits to 327 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).

AT3G52060.2 TCACGTGTCC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22070.1); Has 327 Blast hits to 327 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).

AT3G52220 AT3G52220.1 ACGACACGTGTCACACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae - 10; Bacteria - 152; Metazoa - 4787; Fungi - 1223; Plants - 656; Viruses - 23; Other Eukaryotes - 2756 (source: NCBI BLink).

AT3G52230 AT3G52230.1 AGACACGTGTGACACGTGTCGT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G53000 AT3G53000.1 CCGCCACGTGTCAT Phloem protein 2-A15 (AtPP2-A15); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 289 Blast hits to 286 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G53180 AT3G53180.1 CACGTGGACACGTG catalytic/ glutamate-ammonia ligase; FUNCTIONS IN: glutamate-ammonia ligase activity, catalytic activity; INVOLVED IN: nitrogen compound metabolic process, N-terminal protein myristoylation, nitrogen fixation, metabolic process, glutamine biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine synthetase, catalytic region (InterPro:IPR008146), Glutamine synthetase, beta-Grasp (InterPro:IPR008147), Glutamine synthetase/guanido kinase, catalytic region (InterPro:IPR014746), Amidohydrolase 2 (InterPro:IPR006992); Has 10584 Blast hits to 10580 proteins in 1411 species: Archae - 190; Bacteria - 5115; Metazoa - 86; Fungi - 146; Plants - 34; Viruses - 0; Other Eukaryotes - 5013 (source: NCBI BLink).

AT3G53180.1 GGACACGTGGA catalytic/ glutamate-ammonia ligase; FUNCTIONS IN: glutamate-ammonia ligase activity, catalytic activity; INVOLVED IN: nitrogen compound metabolic process, N-terminal protein myristoylation, nitrogen fixation, metabolic process, glutamine biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine synthetase, catalytic region (InterPro:IPR008146), Glutamine synthetase, beta-Grasp (InterPro:IPR008147), Glutamine synthetase/guanido kinase, catalytic region (InterPro:IPR014746), Amidohydrolase 2 (InterPro:IPR006992); Has 10584 Blast hits to 10580 proteins in 1411 species: Archae - 190; Bacteria - 5115; Metazoa - 86; Fungi - 146; Plants - 34; Viruses - 0; Other Eukaryotes - 5013 (source: NCBI BLink).

AT3G53470 AT3G53470.1 AGCCACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G53470.2 AGCCACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G53668 AT3G53668.1 AGACACGTGTA Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF51 represents a conserved upstream opening reading frame relative to major ORF AT3G53670.1

AT3G53670 AT3G53670.1 AGACACGTGTA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37480.1); Has 146 Blast hits to 143 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 11; Plants - 128; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT3G54050 AT3G54050.1 AAGCCACGTGTCAT fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: response to cold, fructose metabolic process; LOCATED IN: apoplast, stromule, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT1G43670.1); Has 2353 Blast hits to 2350 proteins in 800 species: Archae - 24; Bacteria - 1225; Metazoa - 332; Fungi - 108; Plants - 224; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink).

AT3G54890 AT3G54890.1 AGACACGTGGCCCAATGAAAAAGCCACG Encodes a component of the light harvesting complex associated with photosystem I.

AT3G54890.2 AGACACGTGGCCCAATGAAAAAGCCACG Encodes a component of the light harvesting complex associated with photosystem I.

AT3G54890.3 AGACACGTGGCCCAATGAAAAAGCCACG Encodes a component of the light harvesting complex associated with photosystem I.

AT3G54890.4 AGACACGTGGCCCAATGAAAAAGCCACG Encodes a component of the light harvesting complex associated with photosystem I.

AT3G54960 AT3G54960.1 GGACACGTGTCAC Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.

AT3G54960.2 GGACACGTGTCAC Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.

AT3G55800 AT3G55800.1 CTGCCACGTGTCAC Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type.

AT3G56370 AT3G56370.1 TAAAAGCCACGTGTCA leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G01890.1); Has 151611 Blast hits to 99679 proteins in 3264 species: Archae - 101; Bacteria - 11605; Metazoa - 63918; Fungi - 7104; Plants - 48989; Viruses - 405; Other Eukaryotes - 19489 (source: NCBI BLink).

AT3G56370.1 TACACGTGTCA leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G01890.1); Has 151611 Blast hits to 99679 proteins in 3264 species: Archae - 101; Bacteria - 11605; Metazoa - 63918; Fungi - 7104; Plants - 48989; Viruses - 405; Other Eukaryotes - 19489 (source: NCBI BLink).

AT3G56580 AT3G56580.1 AGACACGTGGCACGTGGG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink).

AT3G56580.2 AGACACGTGGCACGTGGG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink).

AT3G56580.3 AGACACGTGGCACGTGGG zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink).

AT3G56910 AT3G56910.1 AGCCACGTGTCA PLASTID-SPECIFIC 50S RIBOSOMAL PROTEIN 5 (PSRP5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT3G56940 AT3G56940.1 TCGCCACGTGTCT Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site.

AT3G57520 AT3G57520.1 ATGACACGTGGCAA Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G57520.2 ATGACACGTGGCAA Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G57520.3 ATGACACGTGGCAA Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).

AT3G59060 AT3G59060.1 TCGCCACGTGTCG Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B.

AT3G59060.2 TCGCCACGTGTCG Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B.

AT3G59060.3 TCGCCACGTGTCG Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B.

AT3G59060.4 TCGCCACGTGTCG Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B.

AT3G59500 AT3G59500.1 CCCACGTGTCA integral membrane HRF1 family protein; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT1G30890.2); Has 337 Blast hits to 337 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 90; Plants - 38; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).

AT3G59770 AT3G59770.1 TCACACGTGTCGT Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses.

AT3G61750 AT3G61750.1 TCACGTGTCG auxin-responsive protein -related; FUNCTIONS IN: dopamine beta-monooxygenase activity; INVOLVED IN: histidine catabolic process; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593), DOMON (InterPro:IPR013050); BEST Arabidopsis thaliana protein match is: membrane protein, putative (TAIR:AT3G07570.1); Has 392 Blast hits to 392 proteins in 79 species: Archae - 2; Bacteria - 0; Metazoa - 98; Fungi - 70; Plants - 213; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).

AT3G61860 AT3G61860.1 TCCACGTGTCA encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined.

AT3G61870 AT3G61870.1 TGACACGTGGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).

AT3G61870.2 TGACACGTGGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 137 Blast hits to 137 proteins in 53 species: Archae - 0; Bacteria - 85; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).

AT3G62110 AT3G62110.1 ACGCCACGTGTCACGTG glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT4G33440.1); Has 2594 Blast hits to 2590 proteins in 344 species: Archae - 2; Bacteria - 575; Metazoa - 8; Fungi - 1060; Plants - 840; Viruses - 2; Other Eukaryotes - 107 (source: NCBI BLink).

AT3G62140 AT3G62140.1 ACCACGTGTCAT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; Has 331 Blast hits to 328 proteins in 104 species: Archae - 0; Bacteria - 6; Metazoa - 181; Fungi - 52; Plants - 23; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).

AT3G62260 AT3G62260.1 ATGACACGTGTCAT protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink).

AT3G62260.1 GCCACGTGTCA protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink).

AT3G62260.2 ATGACACGTGTCAT protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink).

AT3G62260.2 GCCACGTGTCA protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink).

AT3G62980 AT3G62980.1 AGACACGTGTCAT Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation.

AT3G63150 AT3G63150.1 TCACGTGTCGGGTCAACCCGGTT Encodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response.

AT3G63170 AT3G63170.1 TACACGTGTCA chalcone isomerase; FUNCTIONS IN: chalcone isomerase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chalcone isomerase, subgroup (InterPro:IPR003466), Chalcone isomerase (InterPro:IPR016087); BEST Arabidopsis thaliana protein match is: chalcone isomerase (TAIR:AT2G26310.1); Has 67 Blast hits to 67 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT3G63480 AT3G63480.1 GTGACACGTGTCT kinesin heavy chain, putative; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: PAKRP1 (PHRAGMOPLAST-ASSOCIATED KINESIN-RELATED PROTEIN 1); microtubule motor/ plus-end-directed microtubule motor (TAIR:AT4G14150.1); Has 7627 Blast hits to 7290 proteins in 235 species: Archae - 0; Bacteria - 0; Metazoa - 3886; Fungi - 888; Plants - 878; Viruses - 0; Other Eukaryotes - 1975 (source: NCBI BLink).

AT3G63480.2 GTGACACGTGTCT kinesin heavy chain, putative; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: PAKRP1 (PHRAGMOPLAST-ASSOCIATED KINESIN-RELATED PROTEIN 1); microtubule motor/ plus-end-directed microtubule motor (TAIR:AT4G14150.1); Has 7627 Blast hits to 7290 proteins in 235 species: Archae - 0; Bacteria - 0; Metazoa - 3886; Fungi - 888; Plants - 878; Viruses - 0; Other Eukaryotes - 1975 (source: NCBI BLink).

AT3G63490 AT3G63490.1 AGACACGTGTCAC ribosomal protein L1 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, bacterial-type (InterPro:IPR005878), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: ribosomal protein L1 family protein (TAIR:AT2G42710.1); Has 6420 Blast hits to 6414 proteins in 1604 species: Archae - 183; Bacteria - 2916; Metazoa - 108; Fungi - 179; Plants - 61; Viruses - 0; Other Eukaryotes - 2973 (source: NCBI BLink).

AT3G63490.2 AGACACGTGTCAC ribosomal protein L1 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, bacterial-type (InterPro:IPR005878), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: ribosomal protein L1 family protein (TAIR:AT2G42710.1); Has 6420 Blast hits to 6414 proteins in 1604 species: Archae - 183; Bacteria - 2916; Metazoa - 108; Fungi - 179; Plants - 61; Viruses - 0; Other Eukaryotes - 2973 (source: NCBI BLink).

AT4G00030 AT4G00030.1 AGACACGTGAC plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 126 Blast hits to 126 proteins in 26 species: Archae - 0; Bacteria - 11; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT4G00370 AT4G00370.1 GTGCCACGTGTCAC Encodes an inorganic phosphate transporter (PHT4;4).

AT4G00700 AT4G00700.1 GGACACGTGTCA C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT4G11610.1); Has 3245 Blast hits to 2276 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 1991; Fungi - 105; Plants - 877; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).

AT4G00970 AT4G00970.1 TGACACGTGGCAT protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G21410.1); Has 85932 Blast hits to 84886 proteins in 3199 species: Archae - 45; Bacteria - 7229; Metazoa - 37779; Fungi - 6763; Plants - 18977; Viruses - 382; Other Eukaryotes - 14757 (source: NCBI BLink).

AT4G01050 AT4G01050.1 TTCCACGTGTCA hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain.

AT4G01120 AT4G01120.1 ATGACACGTGTAC bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light

AT4G01940 AT4G01940.1 CGACACGTGTCT Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast.

AT4G02120 AT4G02120.1 AGACACGTGGG CTP synthase, putative / UTP--ammonia ligase, putative; FUNCTIONS IN: CTP synthase activity, catalytic activity; INVOLVED IN: pyrimidine ribonucleotide metabolic process, pyrimidine nucleotide biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutamine amidotransferase class-I, C-terminal (InterPro:IPR000991), CTP synthase (InterPro:IPR004468), CTP synthase, N-terminal (InterPro:IPR017456), Glutamine amidotransferase type 1 (InterPro:IPR017926); BEST Arabidopsis thaliana protein match is: emb2742 (embryo defective 2742); CTP synthase/ catalytic (TAIR:AT3G12670.1); Has 8033 Blast hits to 8005 proteins in 1727 species: Archae - 146; Bacteria - 2980; Metazoa - 224; Fungi - 172; Plants - 86; Viruses - 0; Other Eukaryotes - 4425 (source: NCBI BLink).

AT4G02370 AT4G02370.1 ACCACGTGTCC unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02816.1); Has 336 Blast hits to 333 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 335; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT4G02500 AT4G02500.1 TCGCCACGTGTCA Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides.

AT4G03200 AT4G03200.2 TACACGTGTCAC catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF255 (InterPro:IPR004879), Thioredoxin fold (InterPro:IPR012335), Six-hairpin glycosidase-like (InterPro:IPR008928), Thioredoxin-like fold (InterPro:IPR012336); Has 2027 Blast hits to 2020 proteins in 379 species: Archae - 84; Bacteria - 613; Metazoa - 108; Fungi - 47; Plants - 17; Viruses - 0; Other Eukaryotes - 1158 (source: NCBI BLink).

AT4G04020 AT4G04020.1 ATCCACGTGTCA Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection.

AT4G04810 AT4G04810.1 TGACACGTG methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5854 Blast hits to 5853 proteins in 1229 species: Archae - 51; Bacteria - 2684; Metazoa - 217; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2708 (source: NCBI BLink).

AT4G05070 AT4G05070.1 CCGCCACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G05180 AT4G05180.1 ACCACGTGTCA Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.

AT4G05320 AT4G05320.1 TACACGTGTCAT One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.

AT4G05320.2 TACACGTGTCAT One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.

AT4G05320.3 TACACGTGTCAT One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.

AT4G05320.4 TACACGTGTCAT One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.

AT4G05320.5 TACACGTGTCAT One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.

AT4G05320.6 TACACGTGTCAT One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.

AT4G09500 AT4G09500.1 TGACACGTGTT glycosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: glycosyltransferase family protein (TAIR:AT2G22930.1); Has 2943 Blast hits to 2917 proteins in 180 species: Archae - 0; Bacteria - 11; Metazoa - 372; Fungi - 6; Plants - 2541; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

AT4G09500.2 TGACACGTGTT glycosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: glycosyltransferase family protein (TAIR:AT2G22930.1); Has 2943 Blast hits to 2917 proteins in 180 species: Archae - 0; Bacteria - 11; Metazoa - 372; Fungi - 6; Plants - 2541; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

AT4G09650 AT4G09650.1 TCCACGTGTCG Encodes the chloroplast ATPase delta-subunit.

AT4G11570 AT4G11570.1 GGACACGTGGAT haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).

AT4G11570.2 GGACACGTGGAT haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).

AT4G11600 AT4G11600.1 ATCCACGTGTCT Encodes glutathione peroxidase.

AT4G12130 AT4G12130.1 TACACGTGTCG aminomethyltransferase; FUNCTIONS IN: aminomethyltransferase activity; INVOLVED IN: glycine catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate-binding, YgfZ (InterPro:IPR017703), Glycine cleavage T-protein, N-terminal (InterPro:IPR006222), Glycine cleavage T-protein, C-terminal barrel (InterPro:IPR013977); Has 2891 Blast hits to 2889 proteins in 726 species: Archae - 6; Bacteria - 1150; Metazoa - 88; Fungi - 107; Plants - 23; Viruses - 0; Other Eukaryotes - 1517 (source: NCBI BLink).

AT4G13250 AT4G13250.1 ATGACACGTGTCA short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT5G04900.1); Has 51597 Blast hits to 51519 proteins in 2076 species: Archae - 367; Bacteria - 30349; Metazoa - 4261; Fungi - 2633; Plants - 1242; Viruses - 3; Other Eukaryotes - 12742 (source: NCBI BLink).

AT4G13940 AT4G13940.1 AGCCACGTGTCC Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.

AT4G13940.2 AGCCACGTGTCC Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.

AT4G13940.3 AGCCACGTGTCC Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.

AT4G13940.4 AGCCACGTGTCC Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.

AT4G14900 AT4G14900.1 TACACGTGTCAT hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 1960 Blast hits to 1334 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 248; Fungi - 80; Plants - 1600; Viruses - 2; Other Eukaryotes - 22 (source: NCBI BLink).

AT4G15110 AT4G15110.1 ATGACACGTGTCAC member of CYP97B

AT4G15120 AT4G15120.1 ATCCACGTGTCC VQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, flower, root, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: VQ motif-containing protein (TAIR:AT3G22160.1); Has 167 Blast hits to 165 proteins in 26 species: Archae - 2; Bacteria - 0; Metazoa - 18; Fungi - 12; Plants - 102; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).

AT4G16370 AT4G16370.1 CGACACGTGGAT Encodes an oligopeptide transporter involved in metal homeostasis.

AT4G16380 AT4G16380.1 AACACGTGTCAAAACG metal ion binding; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT1G51090.1); Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G16380.2 AACACGTGTCAAAACG metal ion binding; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT1G51090.1); Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G16490 AT4G16490.1 CCCACGTGTCT binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G01400.1); Has 213 Blast hits to 211 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 206; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).

AT4G16660 AT4G16660.1 AACACGTGTCA heat shock protein 70, putative / HSP70, putative; FUNCTIONS IN: ATP binding; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: heat shock protein, putative (TAIR:AT1G11660.1); Has 18930 Blast hits to 18189 proteins in 2776 species: Archae - 119; Bacteria - 6307; Metazoa - 3629; Fungi - 1186; Plants - 638; Viruses - 97; Other Eukaryotes - 6954 (source: NCBI BLink).

AT4G17330 AT4G17330.1 CGACACGTGTCAC gene of unknown function expressed in seedlings, flower buds and stems

AT4G17730 AT4G17730.1 ATCCACGTGTCC member of SYP2 Gene Family

AT4G17730.2 ATCCACGTGTCC member of SYP2 Gene Family

AT4G18140 AT4G18140.1 CACGTGTCA phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G18140.2 CACGTGTCA phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G18520 AT4G18520.1 AGACACGTGTT INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G39530.1); Has 16698 Blast hits to 4567 proteins in 114 species: Archae - 0; Bacteria - 4; Metazoa - 97; Fungi - 32; Plants - 16266; Viruses - 0; Other Eukaryotes - 299 (source: NCBI BLink).

AT4G19010 AT4G19010.1 TGTCACGTGTCACACGTGA 4-coumarate--CoA ligase family protein / 4-coumaroyl-CoA synthase family protein; FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: OPCL1 (OPC-8:0 COA LIGASE1); 4-coumarate-CoA ligase (TAIR:AT1G20510.1); Has 54010 Blast hits to 49832 proteins in 2259 species: Archae - 568; Bacteria - 29489; Metazoa - 2956; Fungi - 3088; Plants - 1314; Viruses - 1; Other Eukaryotes - 16594 (source: NCBI BLink).

AT4G19020 AT4G19020.1 TCACGTGTGACACGTGACA chromomethylase 2 (CMT2); FUNCTIONS IN: chromatin binding, DNA binding; INVOLVED IN: chromatin assembly or disassembly, DNA methylation; LOCATED IN: chromatin, nucleus; CONTAINS InterPro DOMAIN/s: C-5 cytosine-specific DNA methylase (InterPro:IPR001525), Bromo adjacent region (InterPro:IPR001025), Chromo domain-like (InterPro:IPR016197), Chromo domain (InterPro:IPR000953); BEST Arabidopsis thaliana protein match is: CMT3 (chromomethylase 3); DNA (cytosine-5-)-methyltransferase (TAIR:AT1G69770.1); Has 3518 Blast hits to 3037 proteins in 617 species: Archae - 106; Bacteria - 1441; Metazoa - 665; Fungi - 229; Plants - 237; Viruses - 21; Other Eukaryotes - 819 (source: NCBI BLink).

AT4G19230 AT4G19230.1 TGACACGTG Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy.

AT4G19230.2 TGACACGTG Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy.

AT4G19560 AT4G19560.1 AACACGTGTCC CYCT1;2; FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: CYCT1;4; cyclin-dependent protein kinase (TAIR:AT4G19600.1); Has 1856 Blast hits to 1855 proteins in 191 species: Archae - 1; Bacteria - 2; Metazoa - 1187; Fungi - 285; Plants - 205; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).

AT4G19710 AT4G19710.1 AGACACGTGGCAG Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.

AT4G19710.2 AGACACGTGGCAG Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.

AT4G21020 AT4G21020.1 CACACGTGTCA late embryogenesis abundant domain-containing protein / LEA domain-containing protein; INVOLVED IN: embryonic development ending in seed dormancy; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT5G44310.2); Has 20047 Blast hits to 9539 proteins in 1087 species: Archae - 69; Bacteria - 4524; Metazoa - 4955; Fungi - 1474; Plants - 1716; Viruses - 139; Other Eukaryotes - 7170 (source: NCBI BLink).

AT4G21280 AT4G21280.1 ATGACACGTGGT Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.

AT4G21280.2 ATGACACGTGGT Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.

AT4G22220 AT4G22220.1 CTAAACCGTCCACGTGTCC Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein.

AT4G22320 AT4G22320.1 CACACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55210.1); Has 9841 Blast hits to 5053 proteins in 396 species: Archae - 29; Bacteria - 556; Metazoa - 3805; Fungi - 755; Plants - 226; Viruses - 158; Other Eukaryotes - 4312 (source: NCBI BLink).

AT4G24000 AT4G24000.1 TCACACGTGTCT encodes a protein similar to cellulose synthase

AT4G24480 AT4G24480.1 ATCCACGTGTCAC serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CTR1 (CONSTITUTIVE TRIPLE RESPONSE 1); kinase/ protein binding / protein serine/threonine kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT5G03730.2); Has 84626 Blast hits to 83310 proteins in 3213 species: Archae - 47; Bacteria - 6763; Metazoa - 38110; Fungi - 6771; Plants - 18285; Viruses - 390; Other Eukaryotes - 14260 (source: NCBI BLink).

AT4G25140 AT4G25140.1 TGACACGTGAC Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds.

AT4G25570 AT4G25570.1 TGAGGCCCACGTGTCT Encodes cytochrome b561.

AT4G25580 AT4G25580.1 TACGTGGCATGACACGTGGT stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink).

AT4G25672 AT4G25672.1 CGACACGTGTCC Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF12 represents a conserved upstream opening reading frame relative to major ORF AT4G25670.1

AT4G26455 AT4G26455.1 CGACACGTGTT WPP-DOMAIN INTERACTING PROTEIN 1 (WIP1); FUNCTIONS IN: protein heterodimerization activity, protein homodimerization activity; LOCATED IN: nuclear envelope, cell plate; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: WIP2 (WPP-domain Interacting Protein 2); protein heterodimerization/ protein homodimerization (TAIR:AT5G56210.1).

AT4G26760 AT4G26760.1 GTGACACGTGTT MAP65-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anaphase; LOCATED IN: cortical microtubule, preprophase band, phragmoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MAP65/ASE1 (InterPro:IPR007145); BEST Arabidopsis thaliana protein match is: ATMAP65-1 (MICROTUBULE-ASSOCIATED PROTEINS 65-1); microtubule binding (TAIR:AT5G55230.1); Has 7158 Blast hits to 5289 proteins in 462 species: Archae - 120; Bacteria - 495; Metazoa - 4190; Fungi - 430; Plants - 357; Viruses - 13; Other Eukaryotes - 1553 (source: NCBI BLink).

AT4G26910 AT4G26910.1 TGACACGTGTA 2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink).

AT4G26910.2 TGACACGTGTA 2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink).

AT4G27530 AT4G27530.1 GGACACGTGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G53895.1); Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G27840 AT4G27840.1 TTCCACGTGTCAT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G28440 AT4G28440.1 TGACACGTGACA DNA-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT2G33845.1); Has 124 Blast hits to 124 proteins in 29 species: Archae - 14; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).

AT4G30850 AT4G30850.1 AGACACGTGTA heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors

AT4G30850.2 AGACACGTGTA heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors

AT4G30890 AT4G30890.1 AGACACGTGA Encodes a ubiquitin-specific protease.

AT4G30890.2 AGACACGTGA Encodes a ubiquitin-specific protease.

AT4G30900 AT4G30900.1 TCACGTGTCT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); Has 408 Blast hits to 408 proteins in 132 species: Archae - 4; Bacteria - 213; Metazoa - 1; Fungi - 69; Plants - 10; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).

AT4G30900.2 TCACGTGTCT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); Has 408 Blast hits to 408 proteins in 132 species: Archae - 4; Bacteria - 213; Metazoa - 1; Fungi - 69; Plants - 10; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).

AT4G30960 AT4G30960.1 AGACACGTGTCGT Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance.

AT4G31115 AT4G31115.1 ATGACACGTGGAA unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04440.1); Has 127 Blast hits to 127 proteins in 28 species: Archae - 0; Bacteria - 38; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).

AT4G31115.2 ATGACACGTGGAA unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04440.1); Has 127 Blast hits to 127 proteins in 28 species: Archae - 0; Bacteria - 38; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).

AT4G31750 AT4G31750.1 AGCCACGTGTCG Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320).

AT4G33080 AT4G33080.1 CGACACGTGTCC protein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase, C-terminal (InterPro:IPR017892), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G19400.1); Has 78886 Blast hits to 77157 proteins in 1855 species: Archae - 56; Bacteria - 7391; Metazoa - 32768; Fungi - 7799; Plants - 14685; Viruses - 369; Other Eukaryotes - 15818 (source: NCBI BLink).

AT4G33080.2 CGACACGTGTCC protein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase, C-terminal (InterPro:IPR017892), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G19400.1); Has 78886 Blast hits to 77157 proteins in 1855 species: Archae - 56; Bacteria - 7391; Metazoa - 32768; Fungi - 7799; Plants - 14685; Viruses - 369; Other Eukaryotes - 15818 (source: NCBI BLink).

AT4G33530 AT4G33530.1 GGACACGTGTA potassium transporter

AT4G33530.1 GGACACGTGTA potassium transporter

AT4G33540 AT4G33540.1 TACACGTGTCC metallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: response to arsenic, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 1070 Blast hits to 1070 proteins in 241 species: Archae - 64; Bacteria - 439; Metazoa - 27; Fungi - 6; Plants - 47; Viruses - 0; Other Eukaryotes - 487 (source: NCBI BLink).

AT4G34190 AT4G34190.1 AACACGTGTCC Encodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding.

AT4G34490 AT4G34490.1 GCCACGTGTCAT CYCLASE ASSOCIATED PROTEIN

AT4G34870 AT4G34870.1 TACACGTGTCAT belongs to cyclophilin family

AT4G34880 AT4G34880.1 TACACGTGTCAT amidase family protein; FUNCTIONS IN: amidase activity, carbon-nitrogen ligase activity, with glutamine as amido-N-donor; INVOLVED IN: acrylonitrile catabolic process, aldoxime metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Amidase signature enzyme (InterPro:IPR000120); BEST Arabidopsis thaliana protein match is: amidase family protein (TAIR:AT5G07360.2); Has 10946 Blast hits to 10880 proteins in 1379 species: Archae - 132; Bacteria - 5130; Metazoa - 366; Fungi - 337; Plants - 155; Viruses - 0; Other Eukaryotes - 4826 (source: NCBI BLink).

AT4G36050 AT4G36050.1 TCACGTGTCA endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Exodeoxyribonuclease III xth (InterPro:IPR004808); Has 6598 Blast hits to 5097 proteins in 1267 species: Archae - 49; Bacteria - 2666; Metazoa - 895; Fungi - 431; Plants - 67; Viruses - 2; Other Eukaryotes - 2488 (source: NCBI BLink).

AT4G36050.2 TCACGTGTCA endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: nuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Exodeoxyribonuclease III xth (InterPro:IPR004808); Has 6598 Blast hits to 5097 proteins in 1267 species: Archae - 49; Bacteria - 2666; Metazoa - 895; Fungi - 431; Plants - 67; Viruses - 2; Other Eukaryotes - 2488 (source: NCBI BLink).

AT4G36700 AT4G36700.1 AACACGTGTCC cupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: cupin family protein (TAIR:AT2G18540.1); Has 24566 Blast hits to 7767 proteins in 626 species: Archae - 33; Bacteria - 1512; Metazoa - 12314; Fungi - 1899; Plants - 799; Viruses - 447; Other Eukaryotes - 7562 (source: NCBI BLink).

AT4G36730 AT4G36730.1 CGCACGTGTCA member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box

AT4G36730.2 CGCACGTGTCA member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box

AT4G36780 AT4G36780.1 GGACACGTGGAA transcription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BES1 (BRI1-EMS-SUPPRESSOR 1); protein binding / transcription factor/ transcription regulator (TAIR:AT1G19350.6); Has 110 Blast hits to 110 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G36890 AT4G36890.1 AAAACGACACGTGTAC The IRX14 gene encodes a putative family 43 glycosyl transferase that contributes to xylan biosynthesis. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation.

AT4G36980 AT4G36980.1 GGACACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17658 Blast hits to 10230 proteins in 432 species: Archae - 0; Bacteria - 201; Metazoa - 12139; Fungi - 1445; Plants - 942; Viruses - 234; Other Eukaryotes - 2697 (source: NCBI BLink).

AT4G36980.2 GGACACGTGGAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17658 Blast hits to 10230 proteins in 432 species: Archae - 0; Bacteria - 201; Metazoa - 12139; Fungi - 1445; Plants - 942; Viruses - 234; Other Eukaryotes - 2697 (source: NCBI BLink).

AT4G37220 AT4G37220.1 AAGCCACGTGTCA stress-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to fructose stimulus, response to sucrose stimulus, response to glucose stimulus, response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, root, leaf; CONTAINS InterPro DOMAIN/s: Cold acclimation WCOR413 (InterPro:IPR008892); BEST Arabidopsis thaliana protein match is: COR413-PM2 (COLD-REGULATED 413-PLASMA MEMBRANE 2) (TAIR:AT3G50830.1); Has 97 Blast hits to 96 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT4G38740 AT4G38740.1 GGACACGTGTG Encodes cytosolic cyclophilin ROC1.

AT4G39990 AT4G39990.1 TTCCACGTGTCAT GTP-binding protein ATGB3

AT5G01520 AT5G01520.1 CCGCCACGTGTCGT zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G47160.1); Has 1238 Blast hits to 1237 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 593; Fungi - 65; Plants - 210; Viruses - 109; Other Eukaryotes - 261 (source: NCBI BLink).

AT5G01520.2 CCGCCACGTGTCGT zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT3G47160.1); Has 1238 Blast hits to 1237 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 593; Fungi - 65; Plants - 210; Viruses - 109; Other Eukaryotes - 261 (source: NCBI BLink).

AT5G01850 AT5G01850.1 TGACACGTGTCGTTTA protein kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Tyrosine-protein kinase, ATN1-like (InterPro:IPR015784); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT5G50180.1); Has 95530 Blast hits to 94330 proteins in 3583 species: Archae - 82; Bacteria - 8364; Metazoa - 42500; Fungi - 8087; Plants - 19045; Viruses - 483; Other Eukaryotes - 16969 (source: NCBI BLink).

AT5G02380 AT5G02380.1 TGACACGTGGAC cysteine-rich protein with copper-binding activity

AT5G02810 AT5G02810.1 TACACGTGTCA PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels.

AT5G03070 AT5G03070.1 GTGACACGTGTA Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.

AT5G03080 AT5G03080.1 TACACGTGTCAC phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); Has 539 Blast hits to 533 proteins in 226 species: Archae - 7; Bacteria - 211; Metazoa - 103; Fungi - 102; Plants - 38; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).

AT5G03140 AT5G03140.1 TTCCACGTGTCA lectin protein kinase family protein; FUNCTIONS IN: carbohydrate binding, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase-related (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: lectin protein kinase family protein (TAIR:AT3G53380.1); Has 86443 Blast hits to 85431 proteins in 3024 species: Archae - 50; Bacteria - 7703; Metazoa - 37587; Fungi - 6804; Plants - 19480; Viruses - 384; Other Eukaryotes - 14435 (source: NCBI BLink).

AT5G03290 AT5G03290.1 TGACACGTGTCC isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink).

AT5G03495 AT5G03495.1 GGACACGTGGA nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT5G03480.1); Has 94 Blast hits to 60 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).

AT5G04120 AT5G04120.1 ATGACACGTGGT phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase (InterPro:IPR001345); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT3G50520.1); Has 8851 Blast hits to 8694 proteins in 1334 species: Archae - 50; Bacteria - 5552; Metazoa - 723; Fungi - 290; Plants - 143; Viruses - 0; Other Eukaryotes - 2093 (source: NCBI BLink).

AT5G04590 AT5G04590.1 CGCACGTGTCAT A.thaliana gene encoding sulfite reductase.

AT5G04885 AT5G04885.1 TGACACGTGTCC glycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 7 plant structures; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT5G20950.2); Has 5829 Blast hits to 5471 proteins in 844 species: Archae - 20; Bacteria - 2907; Metazoa - 6; Fungi - 873; Plants - 279; Viruses - 0; Other Eukaryotes - 1744 (source: NCBI BLink).

AT5G04920 AT5G04920.1 TGACACGTGTG vacuolar protein sorting 36 family protein / VPS36 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EAP30 (InterPro:IPR007286); Has 235 Blast hits to 233 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 113; Fungi - 67; Plants - 24; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).

AT5G05220 AT5G05220.1 AGACACGTGGCAC unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: stamen; EXPRESSED DURING: 4 anthesis; Has 17 Blast hits to 10 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G05480 AT5G05480.1 TGACACGTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14920.1); Has 138 Blast hits to 128 proteins in 53 species: Archae - 12; Bacteria - 7; Metazoa - 0; Fungi - 66; Plants - 50; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT5G05660 AT5G05660.1 TCACGTGTCT Encodes a homolog of the mammalian zinc finger transcription factor NF-X1.

AT5G07320 AT5G07320.1 CGCACGTGTCGT mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), Mitochondrial substrate carrier (InterPro:IPR001993), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), Mitochondrial carrier protein (InterPro:IPR002067), EF-HAND 2 (InterPro:IPR018249), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT5G61810.1); Has 25974 Blast hits to 15681 proteins in 989 species: Archae - 0; Bacteria - 9; Metazoa - 12328; Fungi - 6441; Plants - 4249; Viruses - 5; Other Eukaryotes - 2942 (source: NCBI BLink).

AT5G08040 AT5G08040.1 AACACGTGTCGTT MITOCHONDRIAL IMPORT RECEPTOR SUBUNIT TOM5 HOMOLOG (TOM5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G08050 AT5G08050.1 AACGACACGTGTT FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500), Uncharacterised conserved protein UCP022207 (InterPro:IPR016801); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT5G08430 AT5G08430.1 GGACACGTGGAA SWIB complex BAF60b domain-containing protein / plus-3 domain-containing protein / GYF domain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: histone modification, transcription initiation; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121), Plus-3 domain, subgroup (InterPro:IPR018144), Plus-3 (InterPro:IPR004343), GYF (InterPro:IPR003169); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G23480.1); Has 234 Blast hits to 221 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 15; Plants - 101; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).

AT5G08680 AT5G08680.1 TCACACGTGTCG Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level.

AT5G09995 AT5G09995.1 GTGACACGTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT5G09995.2 GTGACACGTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT5G09995.3 GTGACACGTG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).

AT5G10190 AT5G10190.1 GTCCACGTGTCAT transporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: UNE2 (unfertilized embryo sac 2); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G78130.1); Has 8728 Blast hits to 8693 proteins in 1166 species: Archae - 209; Bacteria - 6596; Metazoa - 315; Fungi - 290; Plants - 194; Viruses - 2; Other Eukaryotes - 1122 (source: NCBI BLink).

AT5G10740 AT5G10740.1 ACGTGACACGTGTCA protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae - 9; Bacteria - 1045; Metazoa - 1489; Fungi - 552; Plants - 1360; Viruses - 11; Other Eukaryotes - 1165 (source: NCBI BLink).

AT5G10745 AT5G10745.1 TGACACGTGTCACGT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G10950 AT5G10950.1 GTCACGTGTCGTT cylicin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31880.1); Has 53385 Blast hits to 29505 proteins in 1133 species: Archae - 108; Bacteria - 5328; Metazoa - 20730; Fungi - 6690; Plants - 2205; Viruses - 416; Other Eukaryotes - 17908 (source: NCBI BLink).

AT5G11090 AT5G11090.1 TGACACGTGGCAG serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G25280.2); Has 1617 Blast hits to 241 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 631; Fungi - 53; Plants - 88; Viruses - 0; Other Eukaryotes - 841 (source: NCBI BLink).

AT5G13630 AT5G13630.1 GTCCACGTGTCC Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction.

AT5G13630.2 GTCCACGTGTCC Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction.

AT5G13820 AT5G13820.1 TCCACGTGTCAT Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding domain in C-terminus that prefers the sequence TTTAGGG.

AT5G14370 AT5G14370.1 AGACACGTGTCA LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: CIL (TAIR:AT4G25990.1); Has 1815 Blast hits to 1506 proteins in 139 species: Archae - 0; Bacteria - 8; Metazoa - 291; Fungi - 53; Plants - 1145; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).

AT5G15160 AT5G15160.1 TCACGTGTCAT bHLH family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: vacuole; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092); BEST Arabidopsis thaliana protein match is: PRE1 (PACLOBUTRAZOL RESISTANCE1); DNA binding / transcription factor (TAIR:AT5G39860.1); Has 72 Blast hits to 72 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G15170 AT5G15170.1 GGACACGTGTCA tyrosyl-DNA phosphodiesterase-related; FUNCTIONS IN: phosphoric diester hydrolase activity; INVOLVED IN: DNA repair; LOCATED IN: nucleus; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tyrosyl-DNA phosphodiesterase (InterPro:IPR010347), SMAD/FHA domain (InterPro:IPR008984); Has 311 Blast hits to 309 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).

AT5G15450 AT5G15450.1 AACACGTGTCA Encodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype.

AT5G15650 AT5G15650.1 TGACACGTGTA Reversibly Glycosylated Polypeptide-2

AT5G15850 AT5G15850.1 TCGCCACGTGTCC Homologous to the flowering-time gene CONSTANS.

AT5G15910 AT5G15910.1 ATGACACGTGGAT dehydrogenase-related; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 4174 Blast hits to 4174 proteins in 940 species: Archae - 63; Bacteria - 2510; Metazoa - 105; Fungi - 172; Plants - 313; Viruses - 2; Other Eukaryotes - 1009 (source: NCBI BLink).

AT5G15948 AT5G15948.1 ATCCACGTGTCAC Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF10 represents a conserved upstream opening reading frame relative to major ORF AT5G15950.1

AT5G15950 AT5G15950.1 ATCCACGTGTCAC adenosylmethionine decarboxylase family protein; FUNCTIONS IN: adenosylmethionine decarboxylase activity; INVOLVED IN: spermidine biosynthetic process, spermine biosynthetic process, polyamine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); BEST Arabidopsis thaliana protein match is: SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase (TAIR:AT3G02470.4); Has 830 Blast hits to 816 proteins in 205 species: Archae - 0; Bacteria - 50; Metazoa - 174; Fungi - 104; Plants - 446; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).

AT5G15950.2 ATCCACGTGTCAC adenosylmethionine decarboxylase family protein; FUNCTIONS IN: adenosylmethionine decarboxylase activity; INVOLVED IN: spermidine biosynthetic process, spermine biosynthetic process, polyamine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); BEST Arabidopsis thaliana protein match is: SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase (TAIR:AT3G02470.4); Has 830 Blast hits to 816 proteins in 205 species: Archae - 0; Bacteria - 50; Metazoa - 174; Fungi - 104; Plants - 446; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).

AT5G15960 AT5G15960.1 AAAACGACACGTGA cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level.

AT5G15970 AT5G15970.1 AAAACGACACGTGA Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance.

AT5G16050 AT5G16050.1 CACGTGTCGT Encodes GF14 upsilon chain, a 14-3-3 gene family member.

AT5G16060 AT5G16060.1 ACGACACGTG FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 47 Blast hits to 47 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 17; Plants - 21; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).

AT5G16200 AT5G16200.1 TACACGTGTCA 50S ribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G66890.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G16210 AT5G16210.1 GTACACGTGTCT HEAT repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), LisH dimerisation motif (InterPro:IPR006594), Armadillo-type fold (InterPro:IPR016024); Has 5435 Blast hits to 4228 proteins in 406 species: Archae - 36; Bacteria - 578; Metazoa - 2571; Fungi - 341; Plants - 173; Viruses - 14; Other Eukaryotes - 1722 (source: NCBI BLink).

AT5G16390 AT5G16390.1 ATGACACGTGGCGA Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex.

AT5G16390.2 ATGACACGTGGCGA Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex.

AT5G16710 AT5G16710.1 TCGCCACGTGTCA The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.

AT5G16990 AT5G16990.1 GTCCACGTGTCAC molecular function has not been defined, was shown involved in oxidative stress tolerance.

AT5G18670 AT5G18670.1 AACGACACGTGTA putative beta-amylase BMY3 (BMY3)

AT5G20070 AT5G20070.1 TGACACGTGTGA ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 19 (ATNUDX19); FUNCTIONS IN: hydrolase activity, metal ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc ribbon, NADH pyrophosphatase (InterPro:IPR015376), NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 3177 Blast hits to 3177 proteins in 828 species: Archae - 24; Bacteria - 2086; Metazoa - 110; Fungi - 80; Plants - 32; Viruses - 2; Other Eukaryotes - 843 (source: NCBI BLink).

AT5G20360 AT5G20360.1 CGACACGTGTCA octicosapeptide/Phox/Bem1p (PB1) domain-containing protein / tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT2G25290.2); Has 4210 Blast hits to 3464 proteins in 255 species: Archae - 13; Bacteria - 127; Metazoa - 2399; Fungi - 517; Plants - 482; Viruses - 2; Other Eukaryotes - 670 (source: NCBI BLink).

AT5G21920 AT5G21920.1 ATGCCACGTGTCAT YGGT family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); BEST Arabidopsis thaliana protein match is: YGGT family protein (TAIR:AT4G27990.1); Has 1060 Blast hits to 1060 proteins in 353 species: Archae - 0; Bacteria - 642; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink).

AT5G21930 AT5G21930.1 ATGACACGTGGCAT P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport

AT5G21930.2 ATGACACGTGGCAT P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport

AT5G22000 AT5G22000.1 AACACGTGTCT encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses.

AT5G22000.2 AACACGTGTCT encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses.

AT5G22000.3 AACACGTGTCT encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses.

AT5G22470 AT5G22470.1 CGACACGTGGCT NAD+ ADP-ribosyltransferase; FUNCTIONS IN: NAD+ ADP-ribosyltransferase activity; INVOLVED IN: protein amino acid ADP-ribosylation; LOCATED IN: intracellular, nucleus; CONTAINS InterPro DOMAIN/s: WGR (InterPro:IPR008893), Poly(ADP-ribose) polymerase, regulatory region (InterPro:IPR004102), PADR1 (InterPro:IPR012982), Poly(ADP-ribose) polymerase, catalytic region (InterPro:IPR012317), BRCT (InterPro:IPR001357); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 515 Blast hits to 506 proteins in 104 species: Archae - 0; Bacteria - 9; Metazoa - 313; Fungi - 39; Plants - 59; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink).

AT5G23120 AT5G23120.1 AAAACGACACGTGTAC encodes a stability and/or assembly factor of photosystem II

AT5G23680 AT5G23680.1 AACACGTGTCC sterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Sterile alpha motif-type (InterPro:IPR013761), Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT3G48800.1); Has 448 Blast hits to 446 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 334; Fungi - 4; Plants - 49; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink).

AT5G24610 AT5G24610.1 TGACACGTGA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49550.1); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G24850 AT5G24850.1 GTGACACGTGTCG Binds flavin adenine dinucleotide and DNA. It does not have photolyase activity, and it is likely to act as photoreceptor. Closely related to Synechocystis cryptochrome.

AT5G24970 AT5G24970.1 TTGCCACGTGTCAT ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink).

AT5G24980 AT5G24980.1 ATGACACGTGGCAA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G25100 AT5G25100.1 AGACACGTGGCGG endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G10840.1); Has 1029 Blast hits to 1012 proteins in 169 species: Archae - 0; Bacteria - 14; Metazoa - 445; Fungi - 142; Plants - 236; Viruses - 0; Other Eukaryotes - 192 (source: NCBI BLink).

AT5G25240 AT5G25240.1 ACGCCACGTGTCC FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT5G14890.1); Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G37260 AT5G37260.1 TCCACGTGTCAT Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis.

AT5G38480 AT5G38480.1 CACACGTGTCA general regulatory factor, a 14-3-3 gene

AT5G38480.2 CACACGTGTCA general regulatory factor, a 14-3-3 gene

AT5G42990 AT5G42990.1 TAAACGACACGTGTGA ubiquitin-conjugating enzyme 18 (UBC18); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2-1; ubiquitin-protein ligase (TAIR:AT1G45050.1); Has 6584 Blast hits to 6583 proteins in 298 species: Archae - 0; Bacteria - 0; Metazoa - 3149; Fungi - 1325; Plants - 1019; Viruses - 16; Other Eukaryotes - 1075 (source: NCBI BLink).

AT5G43100 AT5G43100.1 AGACACGTGGCAC aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT3G50050.1); Has 3332 Blast hits to 3311 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 1443; Fungi - 428; Plants - 1141; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink).

AT5G43830 AT5G43830.1 ACGACACGTGTCA unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22850.1); Has 497 Blast hits to 497 proteins in 168 species: Archae - 0; Bacteria - 238; Metazoa - 12; Fungi - 0; Plants - 192; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).

AT5G47420 AT5G47420.1 TCCACGTGTCA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF124 (InterPro:IPR002838), Tryptophan RNA-binding attenuator protein-like (InterPro:IPR016031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17420.1); Has 568 Blast hits to 568 proteins in 252 species: Archae - 56; Bacteria - 410; Metazoa - 0; Fungi - 8; Plants - 37; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).

AT5G47530 AT5G47530.1 GGACACGTGTGA auxin-responsive protein, putative; INVOLVED IN: multicellular organismal development; LOCATED IN: membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, C globular stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17280.1); Has 390 Blast hits to 390 proteins in 77 species: Archae - 0; Bacteria - 8; Metazoa - 85; Fungi - 33; Plants - 251; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).

AT5G47640 AT5G47640.1 TCACGTGTCA NUCLEAR FACTOR Y, SUBUNIT B2 (NF-YB2); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB3 (NUCLEAR FACTOR Y, SUBUNIT B3); transcription factor (TAIR:AT4G14540.1); Has 995 Blast hits to 995 proteins in 188 species: Archae - 0; Bacteria - 0; Metazoa - 385; Fungi - 225; Plants - 295; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).

AT5G49440 AT5G49440.1 TGTCACGTGTCG unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, inflorescence meristem, root; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G52510 AT5G52510.1 AGACACGTGTCGT scarecrow-like transcription factor 8 (SCL8); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: SCL1 (SCARECROW-LIKE 1); transcription factor (TAIR:AT1G21450.1); Has 1239 Blast hits to 1228 proteins in 191 species: Archae - 0; Bacteria - 4; Metazoa - 13; Fungi - 19; Plants - 1170; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).

AT5G53290 AT5G53290.1 TCGCCACGTGTCAC encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.

AT5G53570 AT5G53570.1 AACACGTGTCAT RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1).

AT5G53570.2 AACACGTGTCAT RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1).

AT5G54930 AT5G54930.1 AGACACGTGGT AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif-containing protein (TAIR:AT5G52890.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G54930.2 AGACACGTGGT AT hook motif-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: AT hook motif-containing protein (TAIR:AT5G52890.1); Has 26 Blast hits to 26 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G54940 AT5G54940.1 ATCCACGTGTCT eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink).

AT5G54940.2 ATCCACGTGTCT eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink).

AT5G54960 AT5G54960.1 GGACACGTGTCA pyruvate decarboxylase-2

AT5G55070 AT5G55070.1 AGACACGTGTA 2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: response to oxidative stress, metabolic process; LOCATED IN: cytosolic ribosome, mitochondrion; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT4G26910.2); Has 20861 Blast hits to 17461 proteins in 1458 species: Archae - 93; Bacteria - 9038; Metazoa - 1182; Fungi - 580; Plants - 756; Viruses - 230; Other Eukaryotes - 8982 (source: NCBI BLink).

AT5G55670 AT5G55670.1 AACACGTGTCAT RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G13190.1); Has 39714 Blast hits to 21553 proteins in 936 species: Archae - 21; Bacteria - 7210; Metazoa - 18978; Fungi - 3959; Plants - 3841; Viruses - 192; Other Eukaryotes - 5513 (source: NCBI BLink).

AT5G56100 AT5G56100.1 ATCCACGTGTCA glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G56100.1 ATCCACGTGTCGT glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

AT5G56210 AT5G56210.1 TCGCCACGTGTCC WPP-domain Interacting Protein 2 (WIP2); FUNCTIONS IN: protein heterodimerization activity, protein homodimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope, cell plate; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 2090 Blast hits to 1631 proteins in 257 species: Archae - 16; Bacteria - 128; Metazoa - 915; Fungi - 176; Plants - 118; Viruses - 11; Other Eukaryotes - 726 (source: NCBI BLink).

AT5G57660 AT5G57660.1 TACACGTGTCAT zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT5G24930.1); Has 1656 Blast hits to 1357 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1583; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).

AT5G57900 AT5G57900.1 TGACACGTGTCT F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner

AT5G58650 AT5G58650.1 TGACACGTGTCGT Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK).

AT5G59570 AT5G59570.1 CACACGTGTCAC myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PCL1 (PHYTOCLOCK 1); DNA binding / transcription factor (TAIR:AT3G46640.2); Has 892 Blast hits to 892 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 875; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).

AT5G59840 AT5G59840.1 ACCACGTGTCT Ras-related GTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB8; GTP binding (TAIR:AT3G53610.3); Has 23810 Blast hits to 23756 proteins in 654 species: Archae - 17; Bacteria - 124; Metazoa - 13243; Fungi - 2913; Plants - 2226; Viruses - 19; Other Eukaryotes - 5268 (source: NCBI BLink).

AT5G59960 AT5G59960.1 GTACACGTGTCT unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).

AT5G60220 AT5G60220.1 AACACGTGTCATAATGGG Member of TETRASPANIN family

AT5G60360 AT5G60360.1 ACCACGTGTCC Encodes a senescence-associated thiol protease.

AT5G60360.2 ACCACGTGTCC Encodes a senescence-associated thiol protease.

AT5G60360.3 ACCACGTGTCC Encodes a senescence-associated thiol protease.

AT5G60940 AT5G60940.1 CGCACGTGTCAT transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink).

AT5G60940.2 CGCACGTGTCAT transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink).

AT5G62090 AT5G62090.1 AGACACGTGTCA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: SLK1 (SEUSS-LIKE 1); transcription regulator (TAIR:AT4G25520.1); Has 38202 Blast hits to 15459 proteins in 742 species: Archae - 6; Bacteria - 1392; Metazoa - 14682; Fungi - 3752; Plants - 2341; Viruses - 407; Other Eukaryotes - 15622 (source: NCBI BLink).

AT5G62090.2 AGACACGTGTCA FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: SLK1 (SEUSS-LIKE 1); transcription regulator (TAIR:AT4G25520.1); Has 38202 Blast hits to 15459 proteins in 742 species: Archae - 6; Bacteria - 1392; Metazoa - 14682; Fungi - 3752; Plants - 2341; Viruses - 407; Other Eukaryotes - 15622 (source: NCBI BLink).

AT5G63380 AT5G63380.1 AGACACGTGTA Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At5g63380 preferentially activates fatty acids with increased chain length (C9:0 to C8:0) and thus shares characteristics with long-chain fatty acyl-CoA synthases. Also able to catalyze the conversion of OPDA to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis.

AT5G64050 AT5G64050.1 GTCCACGTGTCT Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.

AT5G64930 AT5G64930.1 GGACACGTGGCAT Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR).

AT5G64940 AT5G64940.1 ATGCCACGTGTCC Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins.

AT5G64940.2 ATGCCACGTGTCC Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins.

AT5G65940 AT5G65940.1 CCCACGTGTCAT hydrolyzes beta-hydroxyisobutyryl-CoA

AT5G65940.2 CCCACGTGTCAT hydrolyzes beta-hydroxyisobutyryl-CoA

AT5G65940.3 CCCACGTGTCAT hydrolyzes beta-hydroxyisobutyryl-CoA

AT5G66570 AT5G66570.1 CGACACGTGGCAA Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type.

AT5G67250 AT5G67250.1 ATGACACGTGTT Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes.