| Locus | Gene model | Sequence | Description |
| AT1G11930 | AT1G11930.1 | CGCAGCGT | alanine racemase family protein; FUNCTIONS IN: pyridoxal phosphate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Predicted pyridoxal phosphate-dependent enzyme, YBL036C type (InterPro:IPR011078), Alanine racemase, N-terminal (InterPro:IPR001608); BEST Arabidopsis thaliana protein match is: pyridoxal phosphate binding (TAIR:AT4G26860.1); Has 4934 Blast hits to 4934 proteins in 1278 species: Archae - 14; Bacteria - 2203; Metazoa - 109; Fungi - 88; Plants - 34; Viruses - 0; Other Eukaryotes - 2486 (source: NCBI BLink). |
| AT1G11930.2 | CGCAGCGT | alanine racemase family protein; FUNCTIONS IN: pyridoxal phosphate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Predicted pyridoxal phosphate-dependent enzyme, YBL036C type (InterPro:IPR011078), Alanine racemase, N-terminal (InterPro:IPR001608); BEST Arabidopsis thaliana protein match is: pyridoxal phosphate binding (TAIR:AT4G26860.1); Has 4934 Blast hits to 4934 proteins in 1278 species: Archae - 14; Bacteria - 2203; Metazoa - 109; Fungi - 88; Plants - 34; Viruses - 0; Other Eukaryotes - 2486 (source: NCBI BLink). |
| AT1G14210 | AT1G14210.1 | CGCAGCGT | ribonuclease T2 family protein; FUNCTIONS IN: ribonuclease T2 activity, endoribonuclease activity, RNA binding; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease T2 (InterPro:IPR001568), Ribonuclease T2, active site (InterPro:IPR018188); BEST Arabidopsis thaliana protein match is: ribonuclease T2 family protein (TAIR:AT1G14220.1); Has 1815 Blast hits to 1814 proteins in 306 species: Archae - 0; Bacteria - 139; Metazoa - 145; Fungi - 174; Plants - 1274; Viruses - 6; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT1G14590 | AT1G14590.1 | CGCAGCGTTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G14590.1 | CGCAGCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G14590.1 | CGCAGCGTTTTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT1G15040 | AT1G15040.1 | ACGCTGCG | glutamine amidotransferase-related; FUNCTIONS IN: hydrolase activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Peptidase C26 (InterPro:IPR011697), Glutamine amidotransferase type 1 (InterPro:IPR017926); BEST Arabidopsis thaliana protein match is: hydrolase (TAIR:AT5G38200.1); Has 2200 Blast hits to 2199 proteins in 608 species: Archae - 19; Bacteria - 1490; Metazoa - 2; Fungi - 6; Plants - 26; Viruses - 0; Other Eukaryotes - 657 (source: NCBI BLink). |
| AT1G15040.2 | ACGCTGCG | glutamine amidotransferase-related; FUNCTIONS IN: hydrolase activity; INVOLVED IN: glutamine metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Peptidase C26 (InterPro:IPR011697), Glutamine amidotransferase type 1 (InterPro:IPR017926); BEST Arabidopsis thaliana protein match is: hydrolase (TAIR:AT5G38200.1); Has 2200 Blast hits to 2199 proteins in 608 species: Archae - 19; Bacteria - 1490; Metazoa - 2; Fungi - 6; Plants - 26; Viruses - 0; Other Eukaryotes - 657 (source: NCBI BLink). |
| AT1G17470 | AT1G17470.1 | CGCAGCGTTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G17470.1 | CGCAGCGTTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G17470.2 | CGCAGCGTTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G17470.2 | CGCAGCGTTT | Encodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues. |
| AT1G21500 | AT1G21500.1 | CGCAGCGTTT | unknown protein; LOCATED IN: 1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G29700 | AT1G29700.1 | CGCAGCGTTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 321 Blast hits to 321 proteins in 85 species: Archae - 0; Bacteria - 142; Metazoa - 0; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G53850 | AT1G53850.1 | AAACGCTGCG | Encodes alpha5 subunit of 20s proteosome involved in protein degradation. |
| AT1G53850.2 | AAACGCTGCG | Encodes alpha5 subunit of 20s proteosome involved in protein degradation. |
| AT1G62600 | AT1G62600.1 | TAAAACGCAGCGTTT | flavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62620.1); Has 8846 Blast hits to 8478 proteins in 928 species: Archae - 35; Bacteria - 3635; Metazoa - 1030; Fungi - 886; Plants - 455; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink). |
| AT1G79790 | AT1G79790.1 | AAACGCTGCG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). |
| AT1G79790.2 | AAACGCTGCG | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). |
| AT2G21640 | AT2G21640.1 | TAAAACGCTGCG | Encodes a protein of unknown function that is a marker for oxidative stress response. |
| AT2G25950 | AT2G25950.1 | AAACGCTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1000 (InterPro:IPR010400); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04780.1); Has 429 Blast hits to 429 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 205; Fungi - 104; Plants - 50; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT2G25950.1 | CAAAACGCTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1000 (InterPro:IPR010400); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04780.1); Has 429 Blast hits to 429 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 205; Fungi - 104; Plants - 50; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT2G45770 | AT2G45770.1 | ACGCTGCG | chloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids. |
| AT2G45980 | AT2G45980.1 | CGCAGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00355.3); Has 57 Blast hits to 54 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G02540 | AT3G02540.1 | ACGCTGCG | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink). |
| AT3G02540.2 | ACGCTGCG | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink). |
| AT3G04120 | AT3G04120.1 | ACGCTGCG | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS. |
| AT3G04830 | AT3G04830.1 | TAAAACGCAGCGTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G04830.2 | TAAAACGCAGCGTTT | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT3G04950 | AT3G04950.1 | AAACGCTGCG | unknown protein; Has 344 Blast hits to 344 proteins in 131 species: Archae - 0; Bacteria - 268; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT3G06310 | AT3G06310.1 | TCAAAACGCAGCGTTT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06310.2 | TCAAAACGCAGCGTTT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06320 | AT3G06320.1 | AAACGCTGCGTTTTGA | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT3G10070 | AT3G10070.1 | AAACGCTGCGTTTTA | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. |
| AT3G11830 | AT3G11830.1 | TAAAACGCTGCGTTTTA | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, eta subunit (InterPro:IPR012720), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: ATTCP-1; ATP binding / protein binding / unfolded protein binding (TAIR:AT3G20050.1); Has 14866 Blast hits to 14802 proteins in 2423 species: Archae - 394; Bacteria - 5781; Metazoa - 1895; Fungi - 1006; Plants - 468; Viruses - 0; Other Eukaryotes - 5322 (source: NCBI BLink). |
| AT3G14110 | AT3G14110.1 | AAACGCTGCG | Encodes a novel coiled-coil, TPR domain containing protein that is localized to the chloroplast membrane and is involved in chlorophyll biosynthesis. Mutants accumulate protochlorophyllide, an intermediate in the chlorophyll biosynthesis pathway, in dark and release singlet oxygen in plastids in a controlled and non-invasive manner upon a dark/light shift. |
| AT3G14110.2 | AAACGCTGCG | Encodes a novel coiled-coil, TPR domain containing protein that is localized to the chloroplast membrane and is involved in chlorophyll biosynthesis. Mutants accumulate protochlorophyllide, an intermediate in the chlorophyll biosynthesis pathway, in dark and release singlet oxygen in plastids in a controlled and non-invasive manner upon a dark/light shift. |
| AT3G14120 | AT3G14120.1 | CGCAGCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: nuclear pore; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear pore protein 84/107 (InterPro:IPR007252); Has 207 Blast hits to 206 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 57; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G14120.2 | CGCAGCGTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: nuclear pore; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear pore protein 84/107 (InterPro:IPR007252); Has 207 Blast hits to 206 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 57; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G17330 | AT3G17330.1 | AAACGCTGCG | evolutionarily conserved C-terminal region 6 (ECT6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT7 (evolutionarily conserved C-terminal region 7) (TAIR:AT1G48110.2); Has 715 Blast hits to 696 proteins in 119 species: Archae - 0; Bacteria - 2; Metazoa - 345; Fungi - 82; Plants - 210; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT3G26560 | AT3G26560.1 | TAAAACGCAGCGTTTTA | ATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink). |
| AT3G48830 | AT3G48830.1 | TAAAACGCTGCG | polynucleotide adenylyltransferase family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: polynucleotide adenylyltransferase activity, RNA binding, nucleotide binding, nucleic acid binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Polynucleotide adenylyltransferase region (InterPro:IPR002646), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 8005 Blast hits to 7486 proteins in 1487 species: Archae - 2; Bacteria - 3572; Metazoa - 1145; Fungi - 573; Plants - 347; Viruses - 8; Other Eukaryotes - 2358 (source: NCBI BLink). |
| AT3G54190 | AT3G54190.1 | ACCCCTTAAACGCTGCGTTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G61070 | AT3G61070.1 | AAACGCTGCGTTTTA | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G61070.2 | AAACGCTGCGTTTTA | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT4G02570 | AT4G02570.1 | TAAAACGCAGCGT | Encodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. |
| AT4G02570.2 | TAAAACGCAGCGT | Encodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. |
| AT4G02570.3 | TAAAACGCAGCGT | Encodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. |
| AT4G09580 | AT4G09580.1 | CGCAGCGTTT | INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71940.1); Has 2023 Blast hits to 2023 proteins in 496 species: Archae - 2; Bacteria - 1014; Metazoa - 198; Fungi - 27; Plants - 131; Viruses - 0; Other Eukaryotes - 651 (source: NCBI BLink). |
| AT4G12830 | AT4G12830.1 | TAAAACGCAGCGTTTTA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G52510.2); Has 8452 Blast hits to 8450 proteins in 913 species: Archae - 58; Bacteria - 5118; Metazoa - 591; Fungi - 124; Plants - 417; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). |
| AT4G14315 | AT4G14315.1 | CGCAGCGTTTTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14315.1 | TAAAACGCTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G14600 | AT4G14600.1 | TAAAACGCAGCGTTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G16210 | AT4G16210.1 | CGCAGCGT | ENOYL-COA HYDRATASE/ISOMERASE A (ECHIA); FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: ECHID (ENOYL-COA HYDRATASE/ISOMERASE D); catalytic/ naphthoate synthase (TAIR:AT1G60550.1); Has 25757 Blast hits to 25754 proteins in 1304 species: Archae - 201; Bacteria - 14217; Metazoa - 1423; Fungi - 585; Plants - 340; Viruses - 0; Other Eukaryotes - 8991 (source: NCBI BLink). |
| AT4G21100 | AT4G21100.1 | CGCAGCGT | One of two closely related genes similar to a damaged DNA binding protein originally described in mammals. May form a complex with DET1 to regulate photomorphogenesis. Loss of function mutations are lethal. The DDB1b protein binds with a number of DWD-containing proteins and may form part of a CUL4-based E3 ubiquitin ligase. |
| AT4G30935 | AT4G30935.1 | CAAAACGCAGCGTTT | member of WRKY Transcription Factor; Group I |
| AT4G36390 | AT4G36390.1 | AAACGCTGCGTTTTA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), tRNA-i(6)A37 modification enzyme MiaB (InterPro:IPR006463), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT1G72090.1); Has 10307 Blast hits to 10292 proteins in 1299 species: Archae - 219; Bacteria - 4582; Metazoa - 258; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 5193 (source: NCBI BLink). |
| AT4G36400 | AT4G36400.1 | TAAAACGCAGCGTTT | FAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink). |
| AT4G36400.2 | TAAAACGCAGCGTTT | FAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink). |
| AT5G03290 | AT5G03290.1 | CGCAGCGTTTTGA | isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). |
| AT5G04040 | AT5G04040.1 | CGCAGCGTTT | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
| AT5G05450 | AT5G05450.1 | TCAAAACGCTGCGTTTTG | DEAD/DEAH box helicase, putative (RH18); FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G71370.1); Has 26025 Blast hits to 25450 proteins in 1685 species: Archae - 410; Bacteria - 10515; Metazoa - 4736; Fungi - 3110; Plants - 1301; Viruses - 7; Other Eukaryotes - 5946 (source: NCBI BLink). |
| AT5G10710 | AT5G10710.1 | AAACGCTGCG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10710.2 | AAACGCTGCG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G18380 | AT5G18380.1 | TAAAACGCTGCG | 40S ribosomal protein S16 (RPS16C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, chloroplast; EXPRESSED IN: fruit, guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16A) (TAIR:AT2G09990.1); Has 4941 Blast hits to 4941 proteins in 1533 species: Archae - 152; Bacteria - 2655; Metazoa - 264; Fungi - 126; Plants - 110; Viruses - 0; Other Eukaryotes - 1634 (source: NCBI BLink). |
| AT5G18380.2 | TAAAACGCTGCG | 40S ribosomal protein S16 (RPS16C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, chloroplast; EXPRESSED IN: fruit, guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16A) (TAIR:AT2G09990.1); Has 4941 Blast hits to 4941 proteins in 1533 species: Archae - 152; Bacteria - 2655; Metazoa - 264; Fungi - 126; Plants - 110; Viruses - 0; Other Eukaryotes - 1634 (source: NCBI BLink). |
| AT5G18390 | AT5G18390.1 | CGCAGCGTTTTA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G65820.1); Has 14680 Blast hits to 4971 proteins in 159 species: Archae - 2; Bacteria - 2; Metazoa - 244; Fungi - 162; Plants - 13880; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink). |
| AT5G27120 | AT5G27120.1 | CGCAGCGTTTTGA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein |
| AT5G38600 | AT5G38600.1 | ACGCTGCG | proline-rich spliceosome-associated (PSP) family protein / zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: PSP, proline-rich (InterPro:IPR006568), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: proline-rich spliceosome-associated (PSP) family protein / zinc knuckle (CCHC-type) family protein (TAIR:AT1G67210.2); Has 6719 Blast hits to 3168 proteins in 192 species: Archae - 2; Bacteria - 119; Metazoa - 3566; Fungi - 1133; Plants - 541; Viruses - 3; Other Eukaryotes - 1355 (source: NCBI BLink). |
| AT5G52960 | AT5G52960.1 | CAAAACGCTGCGTTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT5G55210 | AT5G55210.1 | TAAAACGCTGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55210.1 | TCAAAACGCAGCGTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G55220 | AT5G55220.1 | AAACGCTGCGTTTTGA | trigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). |
| AT5G55220.1 | CGCAGCGTTTTA | trigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink). |
| AT5G56140 | AT5G56140.1 | CGCAGCGTTT | KH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 4346 Blast hits to 2291 proteins in 261 species: Archae - 6; Bacteria - 444; Metazoa - 2561; Fungi - 214; Plants - 674; Viruses - 13; Other Eukaryotes - 434 (source: NCBI BLink). |