| Locus | Gene model | Sequence | Description |
| AT1G01350 | AT1G01350.1 | TGAGCCCATTTA | nucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type/C3HC4-type RING finger) family protein (TAIR:AT5G06420.2); Has 684 Blast hits to 680 proteins in 163 species: Archae - 0; Bacteria - 2; Metazoa - 306; Fungi - 148; Plants - 91; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). |
| AT1G01500 | AT1G01500.1 | TAAGCCCATTTAACGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G01990 | AT1G01990.1 | ATAATGGGCTTTAAAAGGCCTAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G01990.1 | TGAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02060 | AT1G02060.1 | AGCCCATTTA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G37230.1); Has 18912 Blast hits to 5842 proteins in 180 species: Archae - 4; Bacteria - 22; Metazoa - 373; Fungi - 390; Plants - 17444; Viruses - 0; Other Eukaryotes - 679 (source: NCBI BLink). |
| AT1G02080 | AT1G02080.1 | ATAATGGGCTTAT | transcriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink). |
| AT1G02140 | AT1G02140.1 | TAAGCCCATTA | MAGO NASHI (MAGO); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube guidance, sex determination; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mago nashi protein (InterPro:IPR004023); Has 348 Blast hits to 348 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 64; Plants - 47; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). |
| AT1G02145 | AT1G02145.1 | TAATGGGCTTA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.2 | TAATGGGCTTA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.3 | TAATGGGCTTA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02145.4 | TAATGGGCTTA | transferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT1G02330 | AT1G02330.1 | ATAATGGGCTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink). |
| AT1G02330.1 | ATAATGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink). |
| AT1G02475 | AT1G02475.1 | CAATGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01883.1); Has 350 Blast hits to 350 proteins in 105 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT1G02750 | AT1G02750.1 | CAAGCCCATTTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02750.1 | CAAGCCCATTTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02750.1 | TTGACTTTAAGCCCATTTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G02780 | AT1G02780.1 | AAAAGCCCATTT | embryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink). |
| AT1G03140 | AT1G03140.1 | ATAAAGCCCATTTA | splicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). |
| AT1G03150 | AT1G03150.1 | TAAATGGGCTTTAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT1G03200 | AT1G03200.1 | GAAGCCCATTGGGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03240.1); Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G03680 | AT1G03680.1 | TTAATGGGCTTTAA | encodes a chloroplast thioredoxin similar to prokaryotic thioredoxins. |
| AT1G03687 | AT1G03687.1 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G03687.2 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT1G03860 | AT1G03860.1 | ATAATGGGCTTAG | prohibitin 2 |
| AT1G03860.2 | ATAATGGGCTTAG | prohibitin 2 |
| AT1G03860.3 | ATAATGGGCTTAG | prohibitin 2 |
| AT1G04010 | AT1G04010.1 | CAAAGGCCCAATTAAAAGCCCATTT | phosphatidate-sterol O-acyltransferase/ phosphatidylcholine-sterol O-acyltransferase/ phosphatidylethanolamine-sterol O-acyltransferase; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity, phosphatidylethanolamine-sterol O-acyltransferase activity, phosphatidate-sterol O-acyltransferase activity; INVOLVED IN: sterol esterification, lipid metabolic process; LOCATED IN: microsome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: ATPDAT; phosphatidylcholine-sterol O-acyltransferase (TAIR:AT5G13640.1); Has 448 Blast hits to 445 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 76; Plants - 80; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). |
| AT1G04020 | AT1G04020.1 | AAATGGGCTTTTAATTGGGCCTTTG | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G04020.2 | AAATGGGCTTTTAATTGGGCCTTTG | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
| AT1G04510 | AT1G04510.1 | CTAATGGGCTTC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). |
| AT1G04510.2 | CTAATGGGCTTC | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). |
| AT1G04590 | AT1G04590.1 | CTTAATGGGCTA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.1 | TTAATGGGCTAA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.2 | CTTAATGGGCTA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04590.2 | TTAATGGGCTAA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G04630 | AT1G04630.1 | AAATGGGCTTAG | maternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G04630.1 | CTAATGGGCTTAG | maternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G04630.1 | TAGCCCATTT | maternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G04635 | AT1G04635.1 | AAATGGGCTA | EMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G04635.1 | CTAAGCCCATTAG | EMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G04635.1 | CTAAGCCCATTT | EMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G05350 | AT1G05350.1 | CTAATGGGCTATT | thiF family protein; FUNCTIONS IN: binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor, catalytic activity, cofactor binding; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), UBA/THIF-type NAD/FAD binding fold (InterPro:IPR000594), Molybdenum cofactor biosynthesis, MoeB (InterPro:IPR009036), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: SAE2 (SUMO-ACTIVATING ENZYME 2); SUMO activating enzyme (TAIR:AT2G21470.2); Has 7901 Blast hits to 7756 proteins in 1322 species: Archae - 133; Bacteria - 4223; Metazoa - 801; Fungi - 447; Plants - 189; Viruses - 0; Other Eukaryotes - 2108 (source: NCBI BLink). |
| AT1G05580 | AT1G05580.1 | ATAAGCCCATTT | member of Putative Na+/H+ antiporter family |
| AT1G05580.2 | ATAAGCCCATTT | member of Putative Na+/H+ antiporter family |
| AT1G07210 | AT1G07210.1 | TCAGCCCATTAT | 30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink). |
| AT1G07210.1 | TGAGCCCATTAT | 30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink). |
| AT1G07400 | AT1G07400.1 | AGCCCATTATAGCCCATAAAACGC | 17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink). |
| AT1G07510 | AT1G07510.1 | GAAGCCCATTAAG | encodes an FtsH protease that is localized to the mitochondrion |
| AT1G07650 | AT1G07650.1 | GAATGGGCTGA | leucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, typical subtype (InterPro:IPR003591); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / protein kinase family protein (TAIR:AT1G53430.1); Has 130529 Blast hits to 99787 proteins in 3434 species: Archae - 76; Bacteria - 9490; Metazoa - 46107; Fungi - 7763; Plants - 48132; Viruses - 454; Other Eukaryotes - 18507 (source: NCBI BLink). |
| AT1G07745 | AT1G07745.1 | AAATGGGCTAA | Is a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination. |
| AT1G07745.2 | AAATGGGCTAA | Is a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination. |
| AT1G07950 | AT1G07950.1 | TAAGCCCATTA | surfeit locus protein 5 family protein / SURF5 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Surfeit locus 5 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: surfeit locus protein 5 family protein / SURF5 family protein (TAIR:AT1G16430.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 139; Fungi - 8; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G07960 | AT1G07960.1 | TAATGGGCTTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G07960.2 | TAATGGGCTTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G07960.3 | TAATGGGCTTA | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G08280 | AT1G08280.1 | TTAATGGGCTTA | glycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, integral to Golgi membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Sialyltransferase (InterPro:IPR012163), Glycosyl transferase, family 29 (InterPro:IPR001675); Has 1982 Blast hits to 1970 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 1819; Fungi - 0; Plants - 92; Viruses - 14; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT1G08700 | AT1G08700.1 | TTATTGGGCCTAATGGGCT | Encodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation. |
| AT1G08710 | AT1G08710.1 | AGCCCATTAGGCCCAATAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G08710.2 | AGCCCATTAGGCCCAATAA | F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G09200 | AT1G09200.1 | TAATGGGCTTG | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10220 Blast hits to 10217 proteins in 5279 species: Archae - 0; Bacteria - 0; Metazoa - 7338; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 576 (source: NCBI BLink). |
| AT1G09490 | AT1G09490.1 | AGCCCATTT | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565 |
| AT1G09490.2 | AGCCCATTT | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565 |
| AT1G09660 | AT1G09660.1 | TAAGCCCATTAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G09660.2 | TAAGCCCATTAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT1G09815 | AT1G09815.1 | GAAGCCCATTA | POLYMERASE DELTA 4 (POLD4); FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 137 Blast hits to 137 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 58; Plants - 33; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT1G10030 | AT1G10030.1 | GAAGCCCAATTGAAAAGCCCATTT | Arabidopsis homolog of yeast ergosterol28 (ERG28); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Erg28-like (InterPro:IPR005352); Has 155 Blast hits to 155 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 64; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT1G10170 | AT1G10170.1 | TATAGGCCCATTGTTAGCCCATTAG | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
| AT1G10910 | AT1G10910.1 | TAAAAGCCCATTT | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink). |
| AT1G11710 | AT1G11710.1 | TAATGGGCTCA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G01110.1); Has 19625 Blast hits to 5674 proteins in 176 species: Archae - 2; Bacteria - 23; Metazoa - 403; Fungi - 262; Plants - 18143; Viruses - 0; Other Eukaryotes - 792 (source: NCBI BLink). |
| AT1G12830 | AT1G12830.1 | TAAATGGGCTAATACTGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink). |
| AT1G12840 | AT1G12840.1 | TTGGCCCAGTATTAGCCCATTTA | Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. |
| AT1G12920 | AT1G12920.1 | ATAAAGCCCATTAG | Encodes a eukaryotic release factor one homolog. |
| AT1G13030 | AT1G13030.1 | ATATGGGCTTAAATGGGCTTTAAATAAGGCCCAAT | sphere organelles protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; Has 13894 Blast hits to 8686 proteins in 584 species: Archae - 12; Bacteria - 813; Metazoa - 5398; Fungi - 1230; Plants - 486; Viruses - 98; Other Eukaryotes - 5857 (source: NCBI BLink). |
| AT1G13270 | AT1G13270.1 | CAAGCCCAATGGGCTTTAA | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C. |
| AT1G13270.2 | CAAGCCCAATGGGCTTTAA | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C. |
| AT1G13330 | AT1G13330.1 | TAAATGGGCTTAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tat binding protein 1-interacting (InterPro:IPR010776); Has 2425 Blast hits to 2142 proteins in 283 species: Archae - 50; Bacteria - 240; Metazoa - 929; Fungi - 179; Plants - 47; Viruses - 23; Other Eukaryotes - 957 (source: NCBI BLink). |
| AT1G13690 | AT1G13690.1 | AAAAAGCCCATTTA | AtE1 - stimulates the ATPase activity of DnaK/DnaJ |
| AT1G14270 | AT1G14270.1 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.2 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.3 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14270.4 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). |
| AT1G14320 | AT1G14320.1 | TTAAAGCCCATTAG | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. |
| AT1G14320.2 | TTAAAGCCCATTAG | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. |
| AT1G15120 | AT1G15120.1 | GAATGGGCTTTTA | ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT2G01090.1). |
| AT1G15120.1 | TTAATGGGCTTTTA | ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT2G01090.1). |
| AT1G15215 | AT1G15215.1 | TAAGCCCATTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15215.2 | TAAGCCCATTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15215.3 | TAAGCCCATTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G15250 | AT1G15250.1 | CCAGGCCCATGAAGCCCATTAAGAAGCCCATAT | 60S ribosomal protein L37 (RPL37A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT1G15270 | AT1G15270.1 | AGCCCATTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT1G15280 | AT1G15280.1 | TAAATGGGCT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). |
| AT1G15280.2 | TAAATGGGCT | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). |
| AT1G16900 | AT1G16900.1 | ATAAGCCCATTAT | curculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein |
| AT1G16900.1 | ATAATGGGCTTA | curculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein |
| AT1G17070 | AT1G17070.1 | TAAATGGGCTA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink). |
| AT1G17210 | AT1G17210.1 | TAAAGCCCATTTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). |
| AT1G17220 | AT1G17220.1 | TAAATGGGCTTTA | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. |
| AT1G18080 | AT1G18080.1 | ATAAGCCCATTAA | Encodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene. |
| AT1G19710 | AT1G19710.1 | AATAGGCCTTTTAAAGCCCATTAT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink). |
| AT1G20340 | AT1G20340.1 | CAAAGCCCATTAAGGCCCATTT | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. |
| AT1G20350 | AT1G20350.1 | AAATGGGCCTTAATGGGCTTTG | mitochondrial inner membrane translocase |
| AT1G20760 | AT1G20760.1 | AGTGGGCTTATAAAAGCCCATTTA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink). |
| AT1G21790 | AT1G21790.1 | AAATGGGCT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT1G26460 | AT1G26460.1 | TTAATGGGCTGGGCTTTAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 4278 Blast hits to 2050 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 59; Plants - 4056; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink). |
| AT1G26640 | AT1G26640.1 | CTTAATGGGCTTC | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
| AT1G26650 | AT1G26650.1 | GAAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G27435 | AT1G27435.1 | TAAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G28060 | AT1G28060.1 | AAATGGGCTTCAGCCCATAA | small nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink). |
| AT1G28060.1 | TAAAAGCCCATTAG | small nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink). |
| AT1G28090 | AT1G28090.1 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G28090.2 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G28090.3 | CTAATGGGCTTTAAAGGCC | polynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). |
| AT1G29250 | AT1G29250.1 | TAGCCCATTT | nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT1G29260 | AT1G29260.1 | AAATGGGCTA | Encodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function. |
| AT1G29965 | AT1G29965.1 | AAAAGGCCCAATGGGCTTTA | 60S ribosomal protein L18A (RPL18aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: RPL18AA (60S RIBOSOMAL PROTEIN L18A-1); structural constituent of ribosome (TAIR:AT1G29970.2); Has 545 Blast hits to 543 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 93; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G29970 | AT1G29970.1 | CAAGCCCATTT | 60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G29970.2 | CAAGCCCATTT | 60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G29970.3 | CAAGCCCATTT | 60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT1G30070 | AT1G30070.1 | TAAATGGGCTTG | SGS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), SGS (InterPro:IPR007699), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G30060.1); Has 228 Blast hits to 227 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 14; Plants - 46; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). |
| AT1G30450 | AT1G30450.1 | CCCAATTAAAAAGCCCATTT | member of Cation-chloride co-transporter family |
| AT1G30450.2 | CCCAATTAAAAAGCCCATTT | member of Cation-chloride co-transporter family |
| AT1G30450.3 | CCCAATTAAAAAGCCCATTT | member of Cation-chloride co-transporter family |
| AT1G30520 | AT1G30520.1 | TAAAGCCCATTT | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT1G30630 | AT1G30630.1 | AAAAGCCCATTGGGCCTAAA | coatomer protein epsilon subunit family protein / COPE family protein; FUNCTIONS IN: protein transporter activity, protein binding, structural molecule activity, binding; INVOLVED IN: retrograde vesicle-mediated transport, Golgi to ER; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Coatomer, epsilon subunit (InterPro:IPR006822); BEST Arabidopsis thaliana protein match is: coatomer protein epsilon subunit family protein / COPE family protein (TAIR:AT2G34840.1); Has 326 Blast hits to 326 proteins in 131 species: Archae - 2; Bacteria - 5; Metazoa - 149; Fungi - 59; Plants - 65; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G30680 | AT1G30680.1 | GAAGCCCATTTA | toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink). |
| AT1G30825 | AT1G30825.1 | AAATGGGCTCA | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT1G30845 | AT1G30845.1 | CAATGGGCTTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 71 Blast hits to 71 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 19; Plants - 11; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT1G31220 | AT1G31220.1 | TCAGCCCATTAAG | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide |
| AT1G31360 | AT1G31360.1 | AAAAGCCCATTTA | Encodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro. |
| AT1G31360.2 | AAAAGCCCATTTA | Encodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro. |
| AT1G31660 | AT1G31660.1 | AGTTGGGCCTAATGGGCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bystin (InterPro:IPR007955); Has 370 Blast hits to 362 proteins in 156 species: Archae - 0; Bacteria - 7; Metazoa - 139; Fungi - 93; Plants - 32; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). |
| AT1G32500 | AT1G32500.1 | GAAGCCCATTTAGCCCAAAC | Encodes a member of a heterogenous group of non-intrinsic ATP-binding cassette (ABC) proteins. Members of this group bear no close resemblance to each other nor to representatives of specific ABC protein subfamilies from other organisms. This grouping is arbitrary and will likely change upon acquisition of further data. |
| AT1G32530 | AT1G32530.1 | TAATGGGCTCAAAGCCCATAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). |
| AT1G32990 | AT1G32990.1 | TAAATGGGCTTG | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11 |
| AT1G33030 | AT1G33030.1 | TAAAAGCCCATTGGGCCTCA | O-methyltransferase family 2 protein; FUNCTIONS IN: O-methyltransferase activity; INVOLVED IN: lignin biosynthetic process; LOCATED IN: cytosol; EXPRESSED IN: stem, stamen, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: ATOMT1 (O-METHYLTRANSFERASE 1); caffeate O-methyltransferase/ myricetin 3'-O-methyltransferase/ quercetin 3-O-methyltransferase (TAIR:AT5G54160.1); Has 2066 Blast hits to 2064 proteins in 423 species: Archae - 0; Bacteria - 584; Metazoa - 76; Fungi - 395; Plants - 923; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink). |
| AT1G33040 | AT1G33040.1 | TGAGGCCCAATGGGCTTTTA | NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5 (NACA5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT4G10480.2); Has 1370 Blast hits to 1229 proteins in 204 species: Archae - 10; Bacteria - 22; Metazoa - 702; Fungi - 200; Plants - 116; Viruses - 18; Other Eukaryotes - 302 (source: NCBI BLink). |
| AT1G33250 | AT1G33250.1 | CTAAGCCCATTC | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT1G33490 | AT1G33490.1 | TAAAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT1G33500 | AT1G33500.1 | ATAATGGGCTTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink). |
| AT1G33980 | AT1G33980.1 | TAAGCCCAATAACAAGCCCATTT | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) |
| AT1G33980.2 | TAAGCCCAATAACAAGCCCATTT | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) |
| AT1G34030 | AT1G34030.1 | GAATGGGCTTA | 40S ribosomal protein S18 (RPS18B); FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: RPS18C (S18 RIBOSOMAL PROTEIN); RNA binding / nucleic acid binding / structural constituent of ribosome (TAIR:AT4G09800.1); Has 5326 Blast hits to 5326 proteins in 1715 species: Archae - 163; Bacteria - 2773; Metazoa - 291; Fungi - 107; Plants - 309; Viruses - 0; Other Eukaryotes - 1683 (source: NCBI BLink). |
| AT1G34130 | AT1G34130.1 | ATAATGGGCTCAATAAAGCCCAAAC | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. |
| AT1G34130.1 | TTAATGGGCTTTG | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. |
| AT1G34220 | AT1G34220.1 | TGAGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink). |
| AT1G34220.2 | TGAGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink). |
| AT1G44750 | AT1G44750.1 | TAAATGGGCTTA | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G47250 | AT1G47250.1 | AGCCCATTAAG | Encodes 20S proteasome subunit PAF2 (PAF2). |
| AT1G47250.1 | ATAAGCCCATTT | Encodes 20S proteasome subunit PAF2 (PAF2). |
| AT1G48320 | AT1G48320.1 | TAGCCCATTAG | thioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT5G48950.1); Has 1639 Blast hits to 1639 proteins in 507 species: Archae - 0; Bacteria - 1172; Metazoa - 3; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). |
| AT1G48430 | AT1G48430.1 | CTTAATGGGCT | dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink). |
| AT1G48440 | AT1G48440.1 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G48450 | AT1G48450.1 | CTTAATGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G48450.2 | CTTAATGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G48460 | AT1G48460.1 | CAAAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G51150 | AT1G51150.1 | TAATTGGGCCTAAGCCCATTG | Encodes a putative DegP protease. |
| AT1G51360 | AT1G51360.1 | ATAATGGGCTTG | Involved in defense against fungal pathogens and located in cytosol. |
| AT1G51380 | AT1G51380.1 | ATAATGGGCTTC | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 28354 Blast hits to 27866 proteins in 1723 species: Archae - 374; Bacteria - 11782; Metazoa - 5169; Fungi - 3198; Plants - 1370; Viruses - 24; Other Eukaryotes - 6437 (source: NCBI BLink). |
| AT1G51380.1 | GAAGCCCATTG | eukaryotic translation initiation factor 4A, putative / eIF-4A, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 28354 Blast hits to 27866 proteins in 1723 species: Archae - 374; Bacteria - 11782; Metazoa - 5169; Fungi - 3198; Plants - 1370; Viruses - 24; Other Eukaryotes - 6437 (source: NCBI BLink). |
| AT1G52240 | AT1G52240.1 | CTTAATGGGCTTAT | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G52240.2 | CTTAATGGGCTTAT | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G52670 | AT1G52670.1 | ATAATGGGCTTTG | biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin carboxyl carrier protein of acetyl-CoA carboxylase-related (TAIR:AT3G15690.2); Has 1945 Blast hits to 1945 proteins in 695 species: Archae - 0; Bacteria - 1300; Metazoa - 2; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 568 (source: NCBI BLink). |
| AT1G53670 | AT1G53670.1 | TTAATGGGCTTG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G53670.2 | TTAATGGGCTTG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). |
| AT1G53750 | AT1G53750.1 | AAAAAGCCCATTTTACACGTGGG | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, |
| AT1G53850 | AT1G53850.1 | GTTAGGCCCATGAAAGCCCATTAT | Encodes alpha5 subunit of 20s proteosome involved in protein degradation. |
| AT1G53850.2 | GTTAGGCCCATGAAAGCCCATTAT | Encodes alpha5 subunit of 20s proteosome involved in protein degradation. |
| AT1G54050 | AT1G54050.1 | CTAATGGGCTAAGGCC | 17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink). |
| AT1G54320 | AT1G54320.1 | TAAAGCCCATTATAAAGCCCAC | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF284, transmembrane eukaryotic (InterPro:IPR005045); BEST Arabidopsis thaliana protein match is: ALIS1 (ALA-INTERACTING SUBUNIT 1); phospholipid transporter (TAIR:AT3G12740.1); Has 648 Blast hits to 646 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 139; Plants - 105; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink). |
| AT1G54490 | AT1G54490.1 | CCGGCCCAATAAAGCCCATTTA | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. |
| AT1G56190 | AT1G56190.1 | TAAAGCCCATTTA | phosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). |
| AT1G56190.2 | TAAAGCCCATTTA | phosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). |
| AT1G57770 | AT1G57770.1 | TTAATGGGCTTG | amine oxidase family; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD dependent oxidoreductase (InterPro:IPR006076); BEST Arabidopsis thaliana protein match is: CRTISO (CAROTENOID ISOMERASE); carotenoid isomerase (TAIR:AT1G06820.1); Has 4784 Blast hits to 4705 proteins in 573 species: Archae - 90; Bacteria - 1781; Metazoa - 346; Fungi - 53; Plants - 173; Viruses - 0; Other Eukaryotes - 2341 (source: NCBI BLink). |
| AT1G60900 | AT1G60900.1 | ATAAGCCCATTAAG | U2 snRNP auxiliary factor large subunit, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: ATU2AF65A; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G36690.1); Has 85440 Blast hits to 35122 proteins in 1401 species: Archae - 56; Bacteria - 10121; Metazoa - 44645; Fungi - 7960; Plants - 5595; Viruses - 646; Other Eukaryotes - 16417 (source: NCBI BLink). |
| AT1G60900.1 | CAAGCCCATTTA | U2 snRNP auxiliary factor large subunit, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: ATU2AF65A; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G36690.1); Has 85440 Blast hits to 35122 proteins in 1401 species: Archae - 56; Bacteria - 10121; Metazoa - 44645; Fungi - 7960; Plants - 5595; Viruses - 646; Other Eukaryotes - 16417 (source: NCBI BLink). |
| AT1G63460 | AT1G63460.1 | GTGGCCCAATAGAAGCCCATTAAG | glutathione peroxidase, putative; FUNCTIONS IN: glutathione peroxidase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Glutathione peroxidase (InterPro:IPR000889); BEST Arabidopsis thaliana protein match is: ATGPX6 (GLUTATHIONE PEROXIDASE 6); glutathione peroxidase (TAIR:AT4G11600.1); Has 5286 Blast hits to 5285 proteins in 1007 species: Archae - 0; Bacteria - 1863; Metazoa - 687; Fungi - 136; Plants - 239; Viruses - 8; Other Eukaryotes - 2353 (source: NCBI BLink). |
| AT1G63970 | AT1G63970.1 | TAAATGGGCTTTA | Encodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF |
| AT1G63970.2 | TAAATGGGCTTTA | Encodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF |
| AT1G63980 | AT1G63980.1 | TAAAGCCCATTTA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink). |
| AT1G63980.2 | TAAAGCCCATTTA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink). |
| AT1G64650 | AT1G64650.1 | TAAGCCCATTT | LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G64650.2 | TAAGCCCATTT | LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). |
| AT1G64880 | AT1G64880.1 | GAAGCCCATTT | ribosomal protein S5 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, Golgi apparatus, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: ribosomal protein S5 family protein (TAIR:AT2G33800.1); Has 10105 Blast hits to 8747 proteins in 1649 species: Archae - 225; Bacteria - 3046; Metazoa - 1648; Fungi - 368; Plants - 134; Viruses - 59; Other Eukaryotes - 4625 (source: NCBI BLink). |
| AT1G65000 | AT1G65000.1 | CCCAATAAGCCCATTAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, pollen tube, stamen; EXPRESSED DURING: 4 anthesis; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38060.1); Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G65960 | AT1G65960.1 | TAGCCCATTAT | glutamate decarboxylase (GAD2) |
| AT1G67250 | AT1G67250.1 | TGAGCCCATTAT | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT5G38650.1); Has 170 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 2; Plants - 63; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). |
| AT1G67430 | AT1G67430.1 | AAAGCCCATTAA | 60S ribosomal protein L17 (RPL17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17A) (TAIR:AT1G27400.1); Has 1644 Blast hits to 1644 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink). |
| AT1G67680 | AT1G67680.1 | AAAGGCCCATATAAAAAGCCCATTAA | 7S RNA binding; FUNCTIONS IN: 7S RNA binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP72 subunit, RNA-binding (InterPro:IPR013699); BEST Arabidopsis thaliana protein match is: 7S RNA binding (TAIR:AT1G67650.1); Has 525 Blast hits to 512 proteins in 165 species: Archae - 12; Bacteria - 42; Metazoa - 217; Fungi - 108; Plants - 25; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). |
| AT1G68830 | AT1G68830.1 | GAAGCCCATTTA | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation |
| AT1G69680 | AT1G69680.1 | AAATGGGCTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Ran-interacting Mog1 protein (InterPro:IPR007681), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 202 Blast hits to 202 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 83; Plants - 25; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT1G71090 | AT1G71090.1 | TTAATGGGCTTATAATTGGGCTTC | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G01990.1); Has 433 Blast hits to 370 proteins in 101 species: Archae - 9; Bacteria - 33; Metazoa - 0; Fungi - 220; Plants - 97; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink). |
| AT1G71530 | AT1G71530.1 | GAAGCCCATTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G33770.1); Has 90308 Blast hits to 89264 proteins in 3118 species: Archae - 44; Bacteria - 7740; Metazoa - 39791; Fungi - 8259; Plants - 17488; Viruses - 392; Other Eukaryotes - 16594 (source: NCBI BLink). |
| AT1G71530.2 | GAAGCCCATTT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G33770.1); Has 90308 Blast hits to 89264 proteins in 3118 species: Archae - 44; Bacteria - 7740; Metazoa - 39791; Fungi - 8259; Plants - 17488; Viruses - 392; Other Eukaryotes - 16594 (source: NCBI BLink). |
| AT1G72320 | AT1G72320.1 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.2 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.3 | TTAAAGCCCATTAT | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G73570 | AT1G73570.1 | AGCCCATTT | suppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G18260.1); Has 10975 Blast hits to 4576 proteins in 759 species: Archae - 0; Bacteria - 7044; Metazoa - 503; Fungi - 430; Plants - 71; Viruses - 21; Other Eukaryotes - 2906 (source: NCBI BLink). |
| AT1G74270 | AT1G74270.1 | GAAGCCCATTT | 60S ribosomal protein L35a (RPL35aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aA) (TAIR:AT1G07070.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). |
| AT1G74280 | AT1G74280.1 | AAATGGGCTTC | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT1G74290.1); Has 506 Blast hits to 505 proteins in 118 species: Archae - 4; Bacteria - 217; Metazoa - 4; Fungi - 28; Plants - 184; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT1G74780 | AT1G74780.1 | AGCCCATTAAG | nodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink). |
| AT1G74970 | AT1G74970.1 | TTAATGGGCTCTAATGGGCCGAT | ribosomal protein S9, nuclear encoded component of the chloroplast ribosome |
| AT1G75560 | AT1G75560.1 | TAAATGGGCTATTGGGCTTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G75560.2 | TAAATGGGCTATTGGGCTTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT1G75660 | AT1G75660.1 | TAAATGGGCTTC | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products. |
| AT1G77690 | AT1G77690.1 | CAAGCCCATTAA | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia. |
| AT1G79550 | AT1G79550.1 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK). |
| AT1G79550.2 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK). |
| AT1G79560 | AT1G79560.1 | CTTAATGGGCTA | encodes an FtsH protease that is localized to the chloroplast |
| AT1G79950 | AT1G79950.1 | CAATGGGCTTG | helicase-related; FUNCTIONS IN: in 6 functions; INVOLVED IN: regulation of transcription, DNA-dependent, nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DEAD2 (InterPro:IPR010614), Helicase, superfamily 1 and 2, ATP-binding, DinG/Rad3-type (InterPro:IPR014013), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA helicase (DNA repair), Rad3 type (InterPro:IPR013020), Helicase-like, DEXD box c2 type (InterPro:IPR006554), Helicase, ATP-dependent, c2 type (InterPro:IPR006555), Paired amphipathic helix (InterPro:IPR003822); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent DNA helicase/ ATP-dependent helicase/ DNA binding / hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding (TAIR:AT1G20720.1); Has 2029 Blast hits to 1683 proteins in 468 species: Archae - 131; Bacteria - 467; Metazoa - 599; Fungi - 288; Plants - 90; Viruses - 2; Other Eukaryotes - 452 (source: NCBI BLink). |
| AT1G80080 | AT1G80080.1 | AAATGGGCTCAGCCCAAAT | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. |
| AT1G80210 | AT1G80210.1 | AAAAGCCCATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: mov34 family protein (TAIR:AT3G06820.2); Has 785 Blast hits to 706 proteins in 167 species: Archae - 0; Bacteria - 3; Metazoa - 423; Fungi - 147; Plants - 120; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). |
| AT1G80210.2 | AAAAGCCCATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: mov34 family protein (TAIR:AT3G06820.2); Has 785 Blast hits to 706 proteins in 167 species: Archae - 0; Bacteria - 3; Metazoa - 423; Fungi - 147; Plants - 120; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink). |
| AT1G80270 | AT1G80270.1 | AAAAGCCCATTTA | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 5563 Blast hits to 2653 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 76; Plants - 5213; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). |
| AT1G80270.2 | AAAAGCCCATTTA | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 5563 Blast hits to 2653 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 76; Plants - 5213; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). |
| AT1G80270.3 | AAAAGCCCATTTA | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 5563 Blast hits to 2653 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 76; Plants - 5213; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). |
| AT1G80770 | AT1G80770.1 | AAAAAGCCCATTAA | pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink). |
| AT2G01270 | AT2G01270.1 | ATAAAGCCCATTAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT2G01350 | AT2G01350.1 | GAATGGGCTTC | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.2 | GAATGGGCTTC | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.3 | GAATGGGCTTC | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01350.4 | GAATGGGCTTC | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01400 | AT2G01400.1 | TAAGCCCATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G01470 | AT2G01470.1 | TTAGCCCATTAA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT2G01540 | AT2G01540.1 | AGCCCATTG | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT1G70790.2); Has 2557 Blast hits to 2151 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 1514; Fungi - 391; Plants - 442; Viruses - 0; Other Eukaryotes - 210 (source: NCBI BLink). |
| AT2G02050 | AT2G02050.1 | AAATGGGCTTTTGGCCCATAT | NADH-ubiquinone oxidoreductase B18 subunit, putative; FUNCTIONS IN: NADH dehydrogenase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NADH-ubiquinone oxidoreductase B18 subunit (InterPro:IPR008698); Has 184 Blast hits to 184 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 49; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT2G02500 | AT2G02500.1 | TTATGGGCCTTATTAAAAGCCCATTAG | Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity). |
| AT2G02510 | AT2G02510.1 | CTAATGGGCTTTTAATAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G02790 | AT2G02790.1 | CCAATAAGCCCACTAATAAAGCCCATTAT | IQ-domain 29 (IQD29); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD28 (IQ67 DOMAIN PROTEIN 28); calmodulin binding (TAIR:AT1G14380.2); Has 7393 Blast hits to 5438 proteins in 475 species: Archae - 15; Bacteria - 609; Metazoa - 3092; Fungi - 719; Plants - 642; Viruses - 17; Other Eukaryotes - 2299 (source: NCBI BLink). |
| AT2G03140 | AT2G03140.1 | CTAATGGGCTA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G50790.1); Has 23018 Blast hits to 13463 proteins in 1126 species: Archae - 80; Bacteria - 6803; Metazoa - 6863; Fungi - 2179; Plants - 631; Viruses - 123; Other Eukaryotes - 6339 (source: NCBI BLink). |
| AT2G03140.1 | TGAGCCCATTTA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G50790.1); Has 23018 Blast hits to 13463 proteins in 1126 species: Archae - 80; Bacteria - 6803; Metazoa - 6863; Fungi - 2179; Plants - 631; Viruses - 123; Other Eukaryotes - 6339 (source: NCBI BLink). |
| AT2G03150 | AT2G03150.1 | ATAAGCCCATTAA | embryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink). |
| AT2G03270 | AT2G03270.1 | CTAAGCCCATTAT | DNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae - 141; Bacteria - 1267; Metazoa - 1124; Fungi - 651; Plants - 305; Viruses - 8; Other Eukaryotes - 902 (source: NCBI BLink). |
| AT2G04230 | AT2G04230.1 | AAAAAGCCCATTTA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G49030.1); Has 1566 Blast hits to 1530 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 1562; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G15290 | AT2G15290.1 | AAAAAGCCCATTG | Encodes a protein located in the chloroplast inner envelope. The study of mutant defective in the gene product suggests that the protein is involved in the translocation of protein across the envelope membrane into the chloroplast stroma. |
| AT2G16510 | AT2G16510.1 | AATAGCCCATTTA | vacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). |
| AT2G16510.1 | TAAATGGGCTTTAA | vacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). |
| AT2G16600 | AT2G16600.1 | CAATGGGCTTC | Encodes cytosolic cyclophilin ROC3. |
| AT2G16600.2 | CAATGGGCTTC | Encodes cytosolic cyclophilin ROC3. |
| AT2G16780 | AT2G16780.1 | GAATGGGCTTTACAGGCCCATAA | Encodes a WD-40 repeat protein similar to yeast MSI1. |
| AT2G17972 | AT2G17972.1 | TAAAAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 19 Blast hits to 19 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G18510 | AT2G18510.1 | CTTAATGGGCTTATAGGCCCATTAG | embryo defective 2444 (emb2444); FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: PAB8 (POLY(A) BINDING PROTEIN 8); RNA binding / translation initiation factor (TAIR:AT1G49760.1); Has 56184 Blast hits to 33244 proteins in 1255 species: Archae - 48; Bacteria - 4095; Metazoa - 27429; Fungi - 7959; Plants - 8932; Viruses - 890; Other Eukaryotes - 6831 (source: NCBI BLink). |
| AT2G19270 | AT2G19270.1 | AAATGGGCTTTTAAATGGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitotic checkpoint protein PRCC, C-terminal (InterPro:IPR018800); Has 1029 Blast hits to 488 proteins in 117 species: Archae - 0; Bacteria - 14; Metazoa - 432; Fungi - 124; Plants - 39; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink). |
| AT2G20360 | AT2G20360.1 | TAAATGGGCTTA | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink). |
| AT2G20410 | AT2G20410.1 | GAAGCCCATTAAG | activating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). |
| AT2G20480 | AT2G20480.1 | AAATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20490 | AT2G20490.1 | AAAAAGCCCATTT | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT2G20490.2 | AAAAAGCCCATTT | NOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT2G20580 | AT2G20580.1 | TAATGGGCTGA | encoding the RPN subunits of the 26S proteasome |
| AT2G20580.1 | TTAATGGGCT | encoding the RPN subunits of the 26S proteasome |
| AT2G20830 | AT2G20830.2 | AAATGGGCTTC | folic acid binding / transferase; FUNCTIONS IN: folic acid binding, transferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Formiminotransferase, N-terminal (InterPro:IPR012886), Protein of unknown function DUF1715, eukaryotic (InterPro:IPR013179), Formiminotransferase (InterPro:IPR004227); Has 518 Blast hits to 515 proteins in 123 species: Archae - 8; Bacteria - 128; Metazoa - 139; Fungi - 30; Plants - 55; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). |
| AT2G20835 | AT2G20835.1 | AAATGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15534.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G20860 | AT2G20860.1 | ATAATGGGCTTTA | LIP1,Lipoic acid synthase, |
| AT2G21270 | AT2G21270.1 | GAGGCCCAATGGGCTA | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT2G21270.2 | GAGGCCCAATGGGCTA | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT2G21270.3 | GAGGCCCAATGGGCTA | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT2G21580 | AT2G21580.1 | TTAATGGGCTTG | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G21580.1 | TTAATGGGCTTT | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G21580.2 | TTAATGGGCTTG | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G21580.2 | TTAATGGGCTTT | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT2G21830 | AT2G21830.1 | AAATGGGCTCA | DC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21850.1); Has 1741 Blast hits to 575 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 78; Fungi - 0; Plants - 1624; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). |
| AT2G22370 | AT2G22370.1 | CTAATGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 87 Blast hits to 87 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G22400 | AT2G22400.1 | CTAATGGGCTTTATACGGCCCAAAA | NOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink). |
| AT2G24060 | AT2G24060.1 | TTAAAGCCCATAAGCCCATTAA | translation initiation factor 3 (IF-3) family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 3 (InterPro:IPR001288); BEST Arabidopsis thaliana protein match is: translation initiation factor 3 (IF-3) family protein (TAIR:AT4G30690.1); Has 17514 Blast hits to 8661 proteins in 1545 species: Archae - 56; Bacteria - 6187; Metazoa - 2053; Fungi - 689; Plants - 758; Viruses - 336; Other Eukaryotes - 7435 (source: NCBI BLink). |
| AT2G24500 | AT2G24500.1 | TAAAAGCCCATTAGAAAGCCCATTAG | Encodes a C2H2 zinc finger protein FZF. |
| AT2G25910 | AT2G25910.1 | GAATGGGCT | 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25920.1); Has 798 Blast hits to 798 proteins in 239 species: Archae - 0; Bacteria - 274; Metazoa - 164; Fungi - 38; Plants - 61; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT2G25910.2 | GAATGGGCT | 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein; FUNCTIONS IN: 3'-5' exonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25920.1); Has 798 Blast hits to 798 proteins in 239 species: Archae - 0; Bacteria - 274; Metazoa - 164; Fungi - 38; Plants - 61; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). |
| AT2G26140 | AT2G26140.1 | TAAGCCCATTT | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G26530 | AT2G26530.1 | AAATGGGCTAA | unknown function |
| AT2G26530.2 | AAATGGGCTAA | unknown function |
| AT2G28480 | AT2G28480.1 | ATAATGGGCTTG | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 212 Blast hits to 192 proteins in 26 species: Archae - 0; Bacteria - 3; Metazoa - 27; Fungi - 0; Plants - 169; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). |
| AT2G29400 | AT2G29400.1 | TAGCCCATTTACAGGCCCAATAA | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
| AT2G29560 | AT2G29560.1 | CTTATTGGGCCTAAAATGGGCTTTTA | enolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: glycolysis; LOCATED IN: phosphopyruvate hydratase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9375 Blast hits to 9353 proteins in 2216 species: Archae - 179; Bacteria - 3114; Metazoa - 1311; Fungi - 220; Plants - 152; Viruses - 0; Other Eukaryotes - 4399 (source: NCBI BLink). |
| AT2G30000 | AT2G30000.1 | ATAATGGGCTTTTA | LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). |
| AT2G30580 | AT2G30580.1 | AAAAGCCCATTTA | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. DRIP2 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
| AT2G31190 | AT2G31190.1 | TAAGCCCATTAG | LOCATED IN: mitochondrion, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: emb1879 (embryo defective 1879) (TAIR:AT5G49820.1); Has 274 Blast hits to 274 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 96; Fungi - 41; Plants - 94; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT2G31200 | AT2G31200.1 | CTAATGGGCTTA | Encodes actin depolymerizing factor 6 (ADF6). |
| AT2G31370 | AT2G31370.1 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.2 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.3 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.4 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31370.5 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink). |
| AT2G31490 | AT2G31490.1 | TAAATGGGCTTATGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G32060 | AT2G32060.1 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G32060.2 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G32060.3 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT2G32980 | AT2G32980.1 | TGGGCTAAGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 31; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G33430 | AT2G33430.1 | TTAATGGGCTTTGAGCCCAACT | DIFFERENTIATION AND GREENING-LIKE 1 (DAL1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: plastid organization, endonucleolytic cleavage of tetracistronic rRNA transcript (SSU-rRNA, LSU-rRNA, 4.5S-rRNA, 5S-rRNA); LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 147 Blast hits to 134 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G33570 | AT2G33570.1 | CAAGCCCATTC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44670.1); Has 131 Blast hits to 131 proteins in 18 species: Archae - 2; Bacteria - 4; Metazoa - 36; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT2G34250 | AT2G34250.1 | CAAAGCCCATTTGACCC | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). |
| AT2G34250.2 | CAAAGCCCATTTGACCC | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). |
| AT2G34480 | AT2G34480.1 | AGCCCATTGGGCTTTTA | 60S ribosomal protein L18A (RPL18aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aC) (TAIR:AT3G14600.1); Has 545 Blast hits to 543 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 93; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT2G34940 | AT2G34940.1 | TTAATGGGCTAATGAGGCCCATTAAG | vacuolar sorting receptor, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: protein targeting to vacuole; LOCATED IN: integral to plasma membrane, Golgi transport complex; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), EGF-like calcium-binding, conserved site (InterPro:IPR018097), EGF-like calcium-binding (InterPro:IPR001881), Growth factor, receptor (InterPro:IPR009030); BEST Arabidopsis thaliana protein match is: vacuolar sorting receptor, putative (TAIR:AT1G30900.1); Has 9390 Blast hits to 4743 proteins in 196 species: Archae - 0; Bacteria - 100; Metazoa - 8560; Fungi - 5; Plants - 215; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink). |
| AT2G35480 | AT2G35480.1 | AAAAGCCCAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32260.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G35620 | AT2G35620.1 | CAATGGGCTTTAGTAGGCCCAC | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
| AT2G35750 | AT2G35750.1 | CTAATGGGCTTAATTGGGCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G36000 | AT2G36000.1 | TGAGGCCCAATGGGCTTG | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT2G36000.2 | TGAGGCCCAATGGGCTTG | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT2G36170 | AT2G36170.1 | TTAATGGGCTTTG | ubiquitin extension protein 2 (UBQ2) / 60S ribosomal protein L40 (RPL40A); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein modification process, translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L40e (InterPro:IPR001975), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ1 (UBIQUITIN EXTENSION PROTEIN 1); protein binding / structural constituent of ribosome (TAIR:AT3G52590.1); Has 9155 Blast hits to 5428 proteins in 614 species: Archae - 0; Bacteria - 7; Metazoa - 4223; Fungi - 953; Plants - 1966; Viruses - 162; Other Eukaryotes - 1844 (source: NCBI BLink). |
| AT2G37340 | AT2G37340.1 | GAAGCCCATTT | encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. |
| AT2G37340.1 | GAAGCCCATTTA | encodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. |
| AT2G38290 | AT2G38290.2 | AAATGGGCT | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
| AT2G39280 | AT2G39280.1 | AAATGGGCT | RAB GTPase activator; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RabGAP/TBC domain-containing protein (TAIR:AT3G55020.1); Has 4701 Blast hits to 4645 proteins in 231 species: Archae - 15; Bacteria - 84; Metazoa - 2806; Fungi - 708; Plants - 245; Viruses - 9; Other Eukaryotes - 834 (source: NCBI BLink). |
| AT2G39290 | AT2G39290.1 | AGCCCATTT | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
| AT2G39390 | AT2G39390.1 | TCAGCCCATTAG | 60S ribosomal protein L35 (RPL35B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 796 Blast hits to 796 proteins in 298 species: Archae - 108; Bacteria - 128; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). |
| AT2G39760 | AT2G39760.1 | AGCCCATTA | BPM3; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), BTB/POZ fold (InterPro:IPR011333), BTB/POZ (InterPro:IPR013069), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: ATBPM1 (BTB-POZ and MATH domain 1); protein binding (TAIR:AT5G19000.1); Has 5596 Blast hits to 5441 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 4431; Fungi - 78; Plants - 862; Viruses - 29; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT2G39760.2 | AGCCCATTA | BPM3; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083), BTB/POZ fold (InterPro:IPR011333), BTB/POZ (InterPro:IPR013069), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: ATBPM1 (BTB-POZ and MATH domain 1); protein binding (TAIR:AT5G19000.1); Has 5596 Blast hits to 5441 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 4431; Fungi - 78; Plants - 862; Viruses - 29; Other Eukaryotes - 196 (source: NCBI BLink). |
| AT2G39930 | AT2G39930.1 | TTAAGGCCCGGCCCTAAAGCCCATTTA | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT2G40060 | AT2G40060.1 | AAAAAGCCCATTAAG | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 403 Blast hits to 391 proteins in 99 species: Archae - 2; Bacteria - 32; Metazoa - 184; Fungi - 36; Plants - 54; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). |
| AT2G40650 | AT2G40650.1 | AGCCCATTAA | pre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae - 56; Bacteria - 20349; Metazoa - 26407; Fungi - 5687; Plants - 2913; Viruses - 323; Other Eukaryotes - 11922 (source: NCBI BLink). |
| AT2G40660 | AT2G40660.1 | TTAATGGGCT | tRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae - 158; Bacteria - 2173; Metazoa - 404; Fungi - 148; Plants - 87; Viruses - 1; Other Eukaryotes - 649 (source: NCBI BLink). |
| AT2G40810 | AT2G40810.1 | TTAGCCCATTAT | AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT2G40810.2 | TTAGCCCATTAT | AtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). |
| AT2G41780 | AT2G41780.1 | TAAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G41780.2 | TAAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G42210 | AT2G42210.1 | TAAATGGGCTA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.2 | TAAATGGGCTA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.3 | TAAATGGGCTA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.4 | TAAATGGGCTA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42230 | AT2G42230.1 | CTTAATGGGCCGTTTAAAGCCCATTTA | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT2G42230.2 | CTTAATGGGCCGTTTAAAGCCCATTTA | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
| AT2G43350 | AT2G43350.1 | TAAGCCCATTAA | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. |
| AT2G43460 | AT2G43460.1 | ATTGGGCCTTAAAGCCCATTG | 60S ribosomal protein L38 (RPL38A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38B) (TAIR:AT3G59540.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
| AT2G44270 | AT2G44270.1 | CAAAGCCCATTTATGGCCCACA | ATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink). |
| AT2G44650 | AT2G44650.1 | TAAATGGGCT | Encodes a chloroplast-localized chaperonin 10 whose mRNA is expressed in leaves and stems but not roots. |
| AT2G44680 | AT2G44680.1 | AAAAGCCCATTT | Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock. |
| AT2G44680.2 | AAAAGCCCATTT | Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock. |
| AT2G45500 | AT2G45500.1 | TAAAGCCCATTAG | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). |
| AT2G45500.2 | TAAAGCCCATTAG | ATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink). |
| AT2G45510 | AT2G45510.1 | CTAATGGGCTTTA | member of CYP704A |
| AT2G45730 | AT2G45730.1 | TAAATGGGCT | eukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). |
| AT2G46060 | AT2G46060.1 | TAAAAGCCCATTAA | transmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G46060.2 | TAAAAGCCCATTAA | transmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT2G46090 | AT2G46090.1 | TAAGCCCATTAG | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT2G46220 | AT2G46220.1 | GAATGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G79510.2); Has 129 Blast hits to 129 proteins in 50 species: Archae - 0; Bacteria - 61; Metazoa - 17; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT2G46520 | AT2G46520.1 | AATAGCCCATTTAACCGACTTA | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative; FUNCTIONS IN: protein transporter activity, importin-alpha export receptor activity, binding; INVOLVED IN: intracellular protein transport, cell proliferation, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), CAS/CSE, C-terminal (InterPro:IPR005043), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Exportin, Cse1-like (InterPro:IPR013713); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT3G59020.2); Has 841 Blast hits to 834 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 412; Fungi - 251; Plants - 70; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). |
| AT3G01390 | AT3G01390.1 | GAATGGGCTTC | Subunit G of the vacuolar membrane ATPAse complex |
| AT3G01390.2 | GAATGGGCTTC | Subunit G of the vacuolar membrane ATPAse complex |
| AT3G01400 | AT3G01400.1 | GAAGCCCATTC | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT5G58680.1); Has 3812 Blast hits to 2325 proteins in 207 species: Archae - 0; Bacteria - 2; Metazoa - 1580; Fungi - 356; Plants - 1453; Viruses - 0; Other Eukaryotes - 421 (source: NCBI BLink). |
| AT3G01520 | AT3G01520.1 | AAATGGGCTAA | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT5G14680.1); Has 1147 Blast hits to 1145 proteins in 292 species: Archae - 54; Bacteria - 658; Metazoa - 30; Fungi - 22; Plants - 354; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT3G02065 | AT3G02065.1 | AAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.1 | TATGGCCCAGTAAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.2 | AAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.2 | TATGGCCCAGTAAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.3 | AAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02065.3 | TATGGCCCAGTAAAAAGCCCATTTA | DEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). |
| AT3G02180 | AT3G02180.1 | ATAAGCCCATTC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02180.2 | ATAAGCCCATTC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02180.3 | ATAAGCCCATTC | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02555 | AT3G02555.1 | TAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G02560 | AT3G02560.1 | TTAATGGGCTA | 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). |
| AT3G02560.2 | TTAATGGGCTA | 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). |
| AT3G02820 | AT3G02820.1 | TTAATGGGCTTC | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT3G03150 | AT3G03150.1 | AAATGGGCTTAAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03160 | AT3G03160.1 | TCAGCCCATTTAAGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03210 | AT3G03210.1 | TAAATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G03210.1 | TGGGCTAAATGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G04770 | AT3G04770.1 | TTTTGGGCTTGAAAGCCCATTTA | 40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT3G04770.2 | TTTTGGGCTTGAAAGCCCATTTA | 40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). |
| AT3G05020 | AT3G05020.1 | AAATGGGCTGA | encodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. |
| AT3G05210 | AT3G05210.1 | TTAATGGGCTTTA | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT3G05490 | AT3G05490.1 | CAAGCCCATTAT | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G05590 | AT3G05590.1 | CTAAGCCCATTT | Encodes cytoplasmic ribosomal protein L18. |
| AT3G05730 | AT3G05730.1 | AAATGGGCT | Encodes a defensin-like (DEFL) family protein. |
| AT3G05810 | AT3G05810.1 | TTAATGGGCTAGGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26800.1); Has 32 Blast hits to 32 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G06310 | AT3G06310.1 | AAATGGGCTATT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06310.2 | AAATGGGCTATT | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G06320 | AT3G06320.1 | AATAGCCCATTT | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). |
| AT3G06700 | AT3G06700.1 | CAATGGGCTTAT | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G06700.2 | CAATGGGCTTAT | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G06700.3 | CAATGGGCTTAT | 60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G06710 | AT3G06710.1 | ATAAGCCCATTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G07100 | AT3G07100.1 | TAAATGGGCT | protein transport protein Sec24, putative; FUNCTIONS IN: protein binding, transporter activity, zinc ion binding; INVOLVED IN: intracellular protein transport, transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 74720 Blast hits to 37673 proteins in 1279 species: Archae - 56; Bacteria - 8492; Metazoa - 38339; Fungi - 10824; Plants - 6948; Viruses - 1820; Other Eukaryotes - 8241 (source: NCBI BLink). |
| AT3G07310 | AT3G07310.1 | AGCCCATTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48590.1); Has 84 Blast hits to 82 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G07860 | AT3G07860.1 | TTAATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 107 Blast hits to 107 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT3G08510 | AT3G08510.1 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08510.2 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08510.3 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol. |
| AT3G08520 | AT3G08520.1 | ATAAAGCCCATTAAG | 60S ribosomal protein L41 (RPL41D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G08590 | AT3G08590.1 | TAAAGCCCATTAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08590.2 | TAAAGCCCATTAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
| AT3G08610 | AT3G08610.1 | GAAGCCCAAAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G08730 | AT3G08730.1 | GAATGGGCTTG | Encodes a protein-serine kinase that phosphorylates ribosomal protein in vitro. Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Involved in translational up-regulation of ribosomal proteins. Phosphorylated by PDK1. Interacts with RAPTOR1, which in turn interacts with TOR. SPK6 activity is affected by osmotic stress, and plants overexpressing S6k1 are hypersensitive to osmotic stress. The gene is expressed in all tissues examined, with highest expression level detected in metabolically active tissues. |
| AT3G08950 | AT3G08950.1 | CTTAATGGGCTTTAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: copper ion transport, respiratory chain complex IV assembly, cellular copper ion homeostasis, cell redox homeostasis; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synthesis of cytochrome c oxidase, Sco1/Sco2 (InterPro:IPR017276), Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT4G39740.1); Has 3037 Blast hits to 3037 proteins in 688 species: Archae - 11; Bacteria - 1550; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 1204 (source: NCBI BLink). |
| AT3G09250 | AT3G09250.1 | CAAAGCCCATTAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10925.2); Has 169 Blast hits to 169 proteins in 54 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G09570 | AT3G09570.1 | ATTAGGCCCAATGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18520.1); Has 385 Blast hits to 385 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 216; Fungi - 12; Plants - 132; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT3G10572 | AT3G10572.1 | GAAGCCCATTATATTGGCCCAATAG | 3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G10940 | AT3G10940.1 | CAATGGGCTA | protein phosphatase-related; FUNCTIONS IN: phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: SEX4 (STARCH-EXCESS 4); polysaccharide binding / protein tyrosine/serine/threonine phosphatase (TAIR:AT3G52180.2); Has 743 Blast hits to 742 proteins in 92 species: Archae - 5; Bacteria - 8; Metazoa - 545; Fungi - 12; Plants - 77; Viruses - 11; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT3G10940.1 | TTAAAGCCCATTAA | protein phosphatase-related; FUNCTIONS IN: phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: SEX4 (STARCH-EXCESS 4); polysaccharide binding / protein tyrosine/serine/threonine phosphatase (TAIR:AT3G52180.2); Has 743 Blast hits to 742 proteins in 92 species: Archae - 5; Bacteria - 8; Metazoa - 545; Fungi - 12; Plants - 77; Viruses - 11; Other Eukaryotes - 85 (source: NCBI BLink). |
| AT3G11500 | AT3G11500.1 | CCCATTAACAATGGGCTTGAAACGACG | small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SNRNP-G (PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G) (TAIR:AT2G23930.1); Has 921 Blast hits to 921 proteins in 197 species: Archae - 84; Bacteria - 0; Metazoa - 385; Fungi - 191; Plants - 117; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink). |
| AT3G11710 | AT3G11710.1 | CTAATGGGCTTG | ARABIDOPSIS THALIANA LYSYL-TRNA SYNTHETASE 1 (ATKRS-1); FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, lysine-tRNA ligase activity, ATP binding, nucleic acid binding; INVOLVED IN: lysyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Lysyl-tRNA synthetase, class II, C-terminal (InterPro:IPR018149), Lysyl-tRNA synthetase, class II (InterPro:IPR002313), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 15525 Blast hits to 13421 proteins in 1696 species: Archae - 251; Bacteria - 8760; Metazoa - 567; Fungi - 510; Plants - 102; Viruses - 0; Other Eukaryotes - 5335 (source: NCBI BLink). |
| AT3G12100 | AT3G12100.1 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G12100.1 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G12100.2 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G12100.2 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). |
| AT3G12110 | AT3G12110.1 | AGCCCATTAA | Encodes an actin that is expressed predominantly during reproductive development. |
| AT3G12150 | AT3G12150.1 | CAATGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 276 Blast hits to 200 proteins in 88 species: Archae - 0; Bacteria - 59; Metazoa - 189; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
| AT3G12260 | AT3G12260.1 | CTTAGGCCCATAAAAAGCCCATTAG | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT3G13120 | AT3G13120.1 | TTAATGGGCTTAG | 30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink). |
| AT3G14010 | AT3G14010.1 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G14010.2 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G14010.3 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2. |
| AT3G14730 | AT3G14730.1 | CAAGCCCATTTA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 14433 Blast hits to 4909 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 53; Fungi - 48; Plants - 14121; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). |
| AT3G15690 | AT3G15690.1 | GGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAAT | biotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). |
| AT3G15690.2 | GGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAAT | biotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). |
| AT3G15840 | AT3G15840.1 | GAATGGGCTTAT | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.1 | TGAGCCCATTC | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.2 | GAATGGGCTTAT | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.2 | TGAGCCCATTC | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.3 | GAATGGGCTTAT | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.3 | TGAGCCCATTC | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.4 | GAATGGGCTTAT | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15840.4 | TGAGCCCATTC | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G16840 | AT3G16840.1 | CTAATGGGCTTC | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink). |
| AT3G16950 | AT3G16950.1 | AAATGGGCTA | encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. |
| AT3G16950.1 | CAATGGGCTTTTT | encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. |
| AT3G16950.2 | AAATGGGCTA | encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. |
| AT3G16950.2 | CAATGGGCTTTTT | encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. |
| AT3G17590 | AT3G17590.1 | TGAGCCCATTTAAAGCCCACTA | Encodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes. |
| AT3G17890 | AT3G17890.1 | TAAATGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 6 species: Archae - 0; Bacteria - 4; Metazoa - 5; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G17900 | AT3G17900.1 | AGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G18380 | AT3G18380.1 | TAAAAGCCCATTA | sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18380.2 | TAAAAGCCCATTA | sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G18390 | AT3G18390.1 | TAATGGGCTTTTA | embryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae - 5; Bacteria - 10; Metazoa - 293; Fungi - 119; Plants - 305; Viruses - 46; Other Eukaryotes - 371 (source: NCBI BLink). |
| AT3G18480 | AT3G18480.1 | AATAGCCCATTG | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565–689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation. |
| AT3G18520 | AT3G18520.1 | TAATGGGCTTAT | Encodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. |
| AT3G18520.2 | TAATGGGCTTAT | Encodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. |
| AT3G20050 | AT3G20050.1 | AAATGGGCTTTG | Encodes a putative cytoplasmic chaperonin that is similar to mouse Tcp-1 (t complex polypeptide 1). |
| AT3G20270 | AT3G20270.1 | AAATGGGCTTTTT | lipid-binding serum glycoprotein family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Bactericidal permeability-increasing protein, alpha/beta domain (InterPro:IPR017943), Lipid-binding serum glycoprotein, N-terminal (InterPro:IPR017942), Lipid-binding serum glycoprotein, C-terminal (InterPro:IPR001124); BEST Arabidopsis thaliana protein match is: lipid-binding serum glycoprotein family protein (TAIR:AT1G04970.1); Has 353 Blast hits to 347 proteins in 49 species: Archae - 2; Bacteria - 0; Metazoa - 298; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G20630 | AT3G20630.1 | CTAATGGGCT | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. |
| AT3G21210 | AT3G21210.1 | TCAGCCCATTTTAGGCC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade, response to stress; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), UspA (InterPro:IPR006016), Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, PHD-type (InterPro:IPR001965), DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT1G34480.1); Has 1530 Blast hits to 740 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 1494; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT3G21300 | AT3G21300.1 | GAATGGGCT | RNA methyltransferase family protein; FUNCTIONS IN: methyltransferase activity, RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280), 23S rRNA methyltransferase/RumA (InterPro:IPR001566), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT2G28450.1); Has 5920 Blast hits to 5453 proteins in 1374 species: Archae - 144; Bacteria - 4401; Metazoa - 174; Fungi - 148; Plants - 63; Viruses - 6; Other Eukaryotes - 984 (source: NCBI BLink). |
| AT3G22150 | AT3G22150.1 | GTTTGGGCTTCTTAAAGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink). |
| AT3G22320 | AT3G22320.1 | CAAGCCCATTGGGCCTTTA | Non-catalytic subunit common to DNA-dependent RNA polymerases I, II, III and IV; homologous to budding yeast RPB5. |
| AT3G22330 | AT3G22330.1 | TAAAGGCCCAATGGGCTTG | putative mitochondrial RNA helicase 2 (PMH2); FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; LOCATED IN: mitochondrion, nucleolus, cell wall; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: PMH1 (PUTATIVE MITOCHONDRIAL RNA HELICASE 1); ATP-dependent helicase/ DNA binding / RNA binding (TAIR:AT3G22310.1); Has 88907 Blast hits to 51552 proteins in 2242 species: Archae - 850; Bacteria - 34069; Metazoa - 21460; Fungi - 7605; Plants - 6680; Viruses - 588; Other Eukaryotes - 17655 (source: NCBI BLink). |
| AT3G22590 | AT3G22590.1 | AAAAAGCCCATTAT | RNA pol II accessory factor Cdc73 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II accessory factor, Cdc73 (InterPro:IPR007852); Has 392 Blast hits to 300 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 87; Plants - 21; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). |
| AT3G22630 | AT3G22630.1 | AAAAGCCCATTT | Encodes 20S proteasome beta subunit PBD1 (PBD1). |
| AT3G23490 | AT3G23490.1 | CCCATTTAAAAGCCCATTTA | cyanase |
| AT3G23490.1 | TCAGCCCATTTA | cyanase |
| AT3G25520 | AT3G25520.1 | TAAAGCCCATTAA | Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. |
| AT3G25800 | AT3G25800.1 | TGGGCCAAAAGGCCCGTTAAAGCCCATTTA | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT3G25800.2 | TGGGCCAAAAGGCCCGTTAAAGCCCATTTA | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT3G26400 | AT3G26400.1 | CTAATGGGCTATTGTTGGGCTC | member of eIF4B - eukaryotic initiation factor 4B |
| AT3G26410 | AT3G26410.1 | TAAATGGGCTTTATTGGGCCCATG | methyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT3G26420 | AT3G26420.1 | CATGGGCCCAATAAAGCCCATTTA | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. |
| AT3G26560 | AT3G26560.1 | AAAGCCCATTAA | ATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink). |
| AT3G26618 | AT3G26618.1 | AGCCCATTC | eukaryotic release factor 1-3 (ERF1-3); FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube, leaf; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: eRF1 domain 2 (InterPro:IPR005141), eRF1 domain 3 (InterPro:IPR005142), eRF1 domain 1 (InterPro:IPR005140), Peptide chain release factor eRF/aRF subunit 1 (InterPro:IPR004403); BEST Arabidopsis thaliana protein match is: ERF1-2 (EUKARYOTIC RELEASE FACTOR 1-2); translation release factor (TAIR:AT1G12920.1); Has 801 Blast hits to 799 proteins in 274 species: Archae - 191; Bacteria - 2; Metazoa - 164; Fungi - 97; Plants - 79; Viruses - 1; Other Eukaryotes - 267 (source: NCBI BLink). |
| AT3G26618.1 | ATAATGGGCTTTTA | eukaryotic release factor 1-3 (ERF1-3); FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube, leaf; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: eRF1 domain 2 (InterPro:IPR005141), eRF1 domain 3 (InterPro:IPR005142), eRF1 domain 1 (InterPro:IPR005140), Peptide chain release factor eRF/aRF subunit 1 (InterPro:IPR004403); BEST Arabidopsis thaliana protein match is: ERF1-2 (EUKARYOTIC RELEASE FACTOR 1-2); translation release factor (TAIR:AT1G12920.1); Has 801 Blast hits to 799 proteins in 274 species: Archae - 191; Bacteria - 2; Metazoa - 164; Fungi - 97; Plants - 79; Viruses - 1; Other Eukaryotes - 267 (source: NCBI BLink). |
| AT3G27110 | AT3G27110.1 | GAAGCCCATTAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). |
| AT3G27110.2 | GAAGCCCATTAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink). |
| AT3G27330 | AT3G27330.1 | GAAGCCCATTG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40720.1); Has 6969 Blast hits to 6918 proteins in 1619 species: Archae - 0; Bacteria - 145; Metazoa - 5625; Fungi - 356; Plants - 343; Viruses - 13; Other Eukaryotes - 487 (source: NCBI BLink). |
| AT3G27340 | AT3G27340.1 | CAATGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). |
| AT3G27340.2 | CAATGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). |
| AT3G27340.3 | CAATGGGCTTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). |
| AT3G27430 | AT3G27430.1 | TAAATGGGCTCA | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
| AT3G27430.2 | TAAATGGGCTCA | Encodes 20S proteasome beta subunit PBB1 (PBB1). |
| AT3G27770 | AT3G27770.1 | ATAATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G27770.2 | ATAATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G46020 | AT3G46020.1 | TAAGCCCATTT | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink). |
| AT3G46030 | AT3G46030.1 | TAAGCCCATTT | HTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae - 0; Bacteria - 1; Metazoa - 1863; Fungi - 166; Plants - 361; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink). |
| AT3G46040 | AT3G46040.1 | AAATGGGCTTA | Regulated by TCP20. |
| AT3G46040.1 | ATAATGGGCTTAG | Regulated by TCP20. |
| AT3G46100 | AT3G46100.1 | ATAAAGCCCAGCCCATTAG | histidyl-tRNA synthetase |
| AT3G46310 | AT3G46310.1 | GAAGCCCATTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46300.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G46430 | AT3G46430.1 | AAAAAGCCCATTATGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59613.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G46520 | AT3G46520.1 | CTTAGGCCCAAATGGGCTCA | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT3G49000 | AT3G49000.1 | AAATGGGCTAA | RNA polymerase III subunit RPC82 family protein; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase III subunit RPC82-related, helix-turn-helix (InterPro:IPR013197), RNA polymerase III Rpc82, C -terminal (InterPro:IPR008806); Has 175 Blast hits to 170 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 45; Plants - 23; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G49500 | AT3G49500.1 | TAAAAGCCCATTAA | Encodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance. |
| AT3G49560 | AT3G49560.1 | TAAATGGGCTTTTTTCAGGCCCAG | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT5G24650.1); Has 56 Blast hits to 54 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G49800 | AT3G49800.1 | CTAAGCCCATTT | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 131 Blast hits to 121 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 1; Plants - 111; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT3G49910 | AT3G49910.1 | ACAGGCCCAGCCCATTC | 60S ribosomal protein L26 (RPL26A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, translation; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), KOW (InterPro:IPR005824), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26B) (TAIR:AT5G67510.1); Has 870 Blast hits to 870 proteins in 315 species: Archae - 232; Bacteria - 6; Metazoa - 311; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink). |
| AT3G50080 | AT3G50080.1 | ATAAAGCCCATTGGGCCAA | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT3G50210 | AT3G50210.1 | AGCCCATTAG | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G50210.2 | AGCCCATTAG | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G50210.3 | AGCCCATTAG | 2-oxoacid-dependent oxidase, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding; INVOLVED IN: aging, cellular response to starvation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: DIN11 (DARK INDUCIBLE 11); iron ion binding / oxidoreductase (TAIR:AT3G49620.1); Has 6172 Blast hits to 6127 proteins in 685 species: Archae - 0; Bacteria - 736; Metazoa - 131; Fungi - 690; Plants - 2990; Viruses - 0; Other Eukaryotes - 1625 (source: NCBI BLink). |
| AT3G50590 | AT3G50590.1 | TTAAAGCCCATTTAGGCCCATTAAACGACA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink). |
| AT3G50920 | AT3G50920.1 | AAAAGCCCATTAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT3G50920.2 | AAAAGCCCATTAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT3G52040 | AT3G52040.1 | AGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G52050 | AT3G52050.1 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.2 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.3 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.4 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52050.5 | ATAATGGGCT | 5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). |
| AT3G52140 | AT3G52140.1 | AAAAAGCCCAAACAAAGCCCATTAG | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G15290.1); Has 9395 Blast hits to 2929 proteins in 282 species: Archae - 109; Bacteria - 2193; Metazoa - 5294; Fungi - 854; Plants - 176; Viruses - 9; Other Eukaryotes - 760 (source: NCBI BLink). |
| AT3G52730 | AT3G52730.1 | AAATGGGCTTA | ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G52730.1 | TAAATGGGCTA | ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT3G53500 | AT3G53500.2 | TTAATGGGCTTTA | RSZ32; FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, RNA splicing; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: RSZ33; nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT2G37340.1); Has 19457 Blast hits to 16188 proteins in 516 species: Archae - 6; Bacteria - 235; Metazoa - 7507; Fungi - 1066; Plants - 1444; Viruses - 8093; Other Eukaryotes - 1106 (source: NCBI BLink). |
| AT3G53580 | AT3G53580.1 | CTTAATGGGCTTTTT | diaminopimelate epimerase family protein; FUNCTIONS IN: diaminopimelate epimerase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diaminopimelate epimerase, active site (InterPro:IPR018510), Diaminopimelate epimerase (InterPro:IPR001653); Has 5079 Blast hits to 5075 proteins in 1167 species: Archae - 51; Bacteria - 2343; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 2658 (source: NCBI BLink). |
| AT3G54860 | AT3G54860.1 | TGAGGCCCATTTCTAAGCCCATTTA | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. |
| AT3G54860.2 | TGAGGCCCATTTCTAAGCCCATTTA | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. |
| AT3G55460 | AT3G55460.1 | AAAACGCGATAAGGCCAAAAGCCCATTTA | encodes an SC35-like splicing factor that is localized to nuclear specks. |
| AT3G55480 | AT3G55480.1 | AGCCCATTC | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). |
| AT3G55480.2 | AGCCCATTC | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, endocytosis, protein transport; LOCATED IN: membrane coat, Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein complex AP-3, beta subunit (InterPro:IPR017108), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G11380.1); Has 2205 Blast hits to 1398 proteins in 174 species: Archae - 0; Bacteria - 749; Metazoa - 715; Fungi - 369; Plants - 87; Viruses - 0; Other Eukaryotes - 285 (source: NCBI BLink). |
| AT3G55600 | AT3G55600.1 | TTAAAGCCCAGCCTAGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: cation exchanger, putative (CAX10) (TAIR:AT1G54110.1); Has 167 Blast hits to 167 proteins in 56 species: Archae - 0; Bacteria - 8; Metazoa - 84; Fungi - 28; Plants - 42; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT3G56720 | AT3G56720.1 | TAAATGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5618 Blast hits to 4117 proteins in 284 species: Archae - 6; Bacteria - 147; Metazoa - 3194; Fungi - 606; Plants - 492; Viruses - 13; Other Eukaryotes - 1160 (source: NCBI BLink). |
| AT3G56720.1 | TCAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5618 Blast hits to 4117 proteins in 284 species: Archae - 6; Bacteria - 147; Metazoa - 3194; Fungi - 606; Plants - 492; Viruses - 13; Other Eukaryotes - 1160 (source: NCBI BLink). |
| AT3G56820 | AT3G56820.1 | TGAGCCCATTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
| AT3G56860 | AT3G56860.1 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G56860.2 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G56860.3 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT3G57030 | AT3G57030.1 | AAATGGGCTTC | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT5G22020.1); Has 821 Blast hits to 814 proteins in 170 species: Archae - 1; Bacteria - 197; Metazoa - 197; Fungi - 12; Plants - 301; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). |
| AT3G57490 | AT3G57490.1 | TAATGGGCTTAT | 40S ribosomal protein S2 (RPS2D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 6002 Blast hits to 5992 proteins in 1677 species: Archae - 183; Bacteria - 2906; Metazoa - 580; Fungi - 160; Plants - 108; Viruses - 0; Other Eukaryotes - 2065 (source: NCBI BLink). |
| AT3G57900 | AT3G57900.1 | TTAATGGGCTTTAATTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: epidermis; Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G57910 | AT3G57910.1 | TTATTGGGCCTAATTAAAGCCCATTAA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT5G26610.2); Has 5088 Blast hits to 3153 proteins in 241 species: Archae - 10; Bacteria - 109; Metazoa - 2809; Fungi - 372; Plants - 190; Viruses - 44; Other Eukaryotes - 1554 (source: NCBI BLink). |
| AT3G58730 | AT3G58730.1 | TTAGCCCATTT | vacuolar ATP synthase subunit D (VATD) / V-ATPase D subunit / vacuolar proton pump D subunit (VATPD); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuolar membrane, plasma membrane, vacuole, membrane, plant-type vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V1/A1 complex, subunit D (InterPro:IPR002699); Has 941 Blast hits to 939 proteins in 387 species: Archae - 165; Bacteria - 273; Metazoa - 208; Fungi - 93; Plants - 54; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). |
| AT3G60250 | AT3G60250.1 | GAAGCCCATTG | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
| AT3G60250.2 | GAAGCCCATTG | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
| AT3G60640 | AT3G60640.1 | ATAATGGGCTTC | AUTOPHAGY 8G (ATG8G); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: ATG8F (autophagy 8f); microtubule binding (TAIR:AT4G16520.2); Has 1156 Blast hits to 1154 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 574; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink). |
| AT3G61360 | AT3G61360.1 | AAATGGGCT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02420.1); Has 11229 Blast hits to 4504 proteins in 162 species: Archae - 1; Bacteria - 22; Metazoa - 203; Fungi - 245; Plants - 10371; Viruses - 0; Other Eukaryotes - 387 (source: NCBI BLink). |
| AT3G62360 | AT3G62360.1 | TAGTGGGCTTTATAAAGCCCATTAAGCCCTA | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT3G62370 | AT3G62370.1 | TAGGGCTTAATGGGCTTTATAAAGCCCACTA | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G62840 | AT3G62840.1 | GAATGGGCTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G62840.1 | TTAATGGGCTTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G62840.2 | GAATGGGCTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G62840.2 | TTAATGGGCTTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT3G63000 | AT3G63000.1 | TAAAAGCCCATTAT | NPL4-LIKE PROTEIN 1 (NPL41); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NPL4 (InterPro:IPR007717); BEST Arabidopsis thaliana protein match is: NPL4 family protein (TAIR:AT2G47970.1); Has 296 Blast hits to 296 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 86; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). |
| AT3G63070 | AT3G63070.1 | ATAATGGGCTGA | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink). |
| AT3G63070.1 | GAATGGGCTTAG | PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink). |
| AT3G63310 | AT3G63310.1 | AAATGGGCT | glutamate binding; FUNCTIONS IN: glutamate binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: glutamate binding (TAIR:AT1G03070.1); Has 3660 Blast hits to 3660 proteins in 893 species: Archae - 0; Bacteria - 1631; Metazoa - 704; Fungi - 90; Plants - 142; Viruses - 53; Other Eukaryotes - 1040 (source: NCBI BLink). |
| AT4G00026 | AT4G00026.1 | AAAAAGCCCATTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); Has 168 Blast hits to 168 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 52; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G00030 | AT4G00030.1 | AAATGGGCTTTTT | plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 126 Blast hits to 126 proteins in 26 species: Archae - 0; Bacteria - 11; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G00058 | AT4G00058.1 | CAATGGGCTCAAGCCCAGGCCCGTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown. |
| AT4G00090 | AT4G00090.1 | AAATGGGCTTTG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). |
| AT4G00090.1 | TAAATGGGCTTTG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). |
| AT4G00550 | AT4G00550.1 | CAATGGGCTTG | encodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane. |
| AT4G00585 | AT4G00585.1 | TAAATGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 29 Blast hits to 29 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 6; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G00590 | AT4G00590.1 | TAAGCCCATTTA | asparaginase 2 family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase T2, asparaginase 2 (InterPro:IPR000246); BEST Arabidopsis thaliana protein match is: L-asparaginase, putative / L-asparagine amidohydrolase, putative (TAIR:AT3G16150.1); Has 2162 Blast hits to 2119 proteins in 522 species: Archae - 71; Bacteria - 869; Metazoa - 420; Fungi - 151; Plants - 90; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). |
| AT4G00895 | AT4G00895.1 | AATAGCCCATTT | ATP synthase delta chain-related; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: proton-transporting ATP synthase complex, catalytic core F(1), chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); Has 40 Blast hits to 40 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT4G01220 | AT4G01220.1 | GAATGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RGXT1 (rhamnogalacturonan xylosyltransferase 1); UDP-xylosyltransferase (TAIR:AT4G01770.1); Has 188 Blast hits to 185 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT4G01220.2 | GAATGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RGXT1 (rhamnogalacturonan xylosyltransferase 1); UDP-xylosyltransferase (TAIR:AT4G01770.1); Has 188 Blast hits to 185 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
| AT4G01400 | AT4G01400.2 | TAAGCCCATTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink). |
| AT4G01860 | AT4G01860.1 | TAAGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT4G01860.2 | TAAGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). |
| AT4G02080 | AT4G02080.1 | CTAATGGGCTTG | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT4G02080.1 | TAAATGGGCTTATTGGG | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT4G02230 | AT4G02230.1 | AGGCCTATAATGGGCTTAG | 60S ribosomal protein L19 (RPL19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: emb2386 (embryo defective 2386); structural constituent of ribosome (TAIR:AT1G02780.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). |
| AT4G02290 | AT4G02290.1 | GAATGGGCTTC | Arabidopsis thaliana glycosyl hydrolase 9B13 (AtGH9B13); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Six-hairpin glycosidase (InterPro:IPR012341), Glycoside hydrolase, family 9, active site (InterPro:IPR018221), Six-hairpin glycosidase-like (InterPro:IPR008928), Glycoside hydrolase, family 9 (InterPro:IPR001701); BEST Arabidopsis thaliana protein match is: ATCEL2; cellulase/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G02800.1); Has 1099 Blast hits to 1093 proteins in 183 species: Archae - 0; Bacteria - 295; Metazoa - 138; Fungi - 14; Plants - 625; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
| AT4G02590 | AT4G02590.1 | AGCCCATTTA | unfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02590.2 | AGCCCATTTA | unfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02590.3 | AGCCCATTTA | unfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02930 | AT4G02930.1 | AAATGGGCTTA | elongation factor Tu, putative / EF-Tu, putative; FUNCTIONS IN: translation elongation factor activity, ATP binding; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, cell wall; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, bacterial and organelle (InterPro:IPR004541), Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: ATRABE1B (ARABIDOPSIS RAB GTPASE HOMOLOG E1B); GTP binding / GTPase/ translation elongation factor (TAIR:AT4G20360.1); Has 60152 Blast hits to 60103 proteins in 12753 species: Archae - 783; Bacteria - 22701; Metazoa - 13343; Fungi - 6902; Plants - 1303; Viruses - 3; Other Eukaryotes - 15117 (source: NCBI BLink). |
| AT4G03030 | AT4G03030.1 | AAATGGGCTTA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 1405 Blast hits to 1314 proteins in 98 species: Archae - 0; Bacteria - 31; Metazoa - 962; Fungi - 4; Plants - 358; Viruses - 9; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT4G03280 | AT4G03280.1 | TAAATGGGCTA | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03280.1 | TAAGCCCATTAAG | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03280.2 | TAAATGGGCTA | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03280.2 | TAAGCCCATTAAG | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03430 | AT4G03430.1 | AAAAAGCCCATTAAAAAGCCCACTA | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G05410 | AT4G05410.1 | TTAATGGGCTCA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink). |
| AT4G06634 | AT4G06634.1 | TAAAAGCCCATTT | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, C2H2-type/integrase, DNA-binding (InterPro:IPR013087); BEST Arabidopsis thaliana protein match is: ELF6 (EARLY FLOWERING 6); transcription factor (TAIR:AT5G04240.1); Has 105509 Blast hits to 34937 proteins in 883 species: Archae - 4; Bacteria - 37; Metazoa - 99278; Fungi - 2690; Plants - 257; Viruses - 38; Other Eukaryotes - 3205 (source: NCBI BLink). |
| AT4G06634.2 | TAAAAGCCCATTT | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, C2H2-type/integrase, DNA-binding (InterPro:IPR013087); BEST Arabidopsis thaliana protein match is: ELF6 (EARLY FLOWERING 6); transcription factor (TAIR:AT5G04240.1); Has 105509 Blast hits to 34937 proteins in 883 species: Archae - 4; Bacteria - 37; Metazoa - 99278; Fungi - 2690; Plants - 257; Viruses - 38; Other Eukaryotes - 3205 (source: NCBI BLink). |
| AT4G09000 | AT4G09000.1 | AAAAAGCCCATTAA | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09000.1 | GGCTTTAAAGCCCATTC | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09000.2 | AAAAAGCCCATTAA | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G09000.2 | GGCTTTAAAGCCCATTC | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT4G10040 | AT4G10040.1 | TGAGCCCATTT | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. |
| AT4G10320 | AT4G10320.1 | TTAATGGGCTTA | isoleucyl-tRNA synthetase, putative / isoleucine--tRNA ligase, putative; FUNCTIONS IN: isoleucine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: male gametophyte, guard cell, epidermis, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Isoleucyl-tRNA synthetase (InterPro:IPR018353), Isoleucyl-tRNA synthetase, class Ia (InterPro:IPR002301), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Isoleucyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015905), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ catalytic/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.1); Has 27648 Blast hits to 24183 proteins in 1801 species: Archae - 699; Bacteria - 11987; Metazoa - 692; Fungi - 480; Plants - 135; Viruses - 0; Other Eukaryotes - 13655 (source: NCBI BLink). |
| AT4G10480 | AT4G10480.1 | CTAATGGGCTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G10480.2 | CTAATGGGCTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G11380 | AT4G11380.1 | TAAATGGGCTAA | beta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink). |
| AT4G13830 | AT4G13830.1 | CTAATGGGCT | DnaJ-like protein (J20); nuclear gene |
| AT4G13830.2 | CTAATGGGCT | DnaJ-like protein (J20); nuclear gene |
| AT4G14270 | AT4G14270.1 | CTTAATGGGCTTATGGGCTTC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G14270.2 | CTTAATGGGCTTATGGGCTTC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins. |
| AT4G14300 | AT4G14300.1 | TAGCCCATTAT | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT2G33410.1); Has 82956 Blast hits to 37358 proteins in 1472 species: Archae - 56; Bacteria - 18252; Metazoa - 33610; Fungi - 7047; Plants - 9752; Viruses - 546; Other Eukaryotes - 13693 (source: NCBI BLink). |
| AT4G14320 | AT4G14320.1 | TTAATGGGCTTTTT | 60S ribosomal protein L36a/L44 (RPL36aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aA) (TAIR:AT3G23390.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT4G14330 | AT4G14330.1 | AAAAAGCCCATTAA | phragmoplast-associated kinesin-related protein 2 (PAKRP2); FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: phragmoplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATK1 (ARABIDOPSIS THALIANA KINESIN 1); microtubule motor/ minus-end-directed microtubule motor (TAIR:AT4G21270.1); Has 19997 Blast hits to 14982 proteins in 632 species: Archae - 102; Bacteria - 784; Metazoa - 9932; Fungi - 1679; Plants - 1066; Viruses - 71; Other Eukaryotes - 6363 (source: NCBI BLink). |
| AT4G14490 | AT4G14490.1 | TAAAAGCCCATTTAAGGCCCATTAA | forkhead-associated domain-containing protein / FHA domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253); BEST Arabidopsis thaliana protein match is: forkhead-associated domain-containing protein / FHA domain-containing protein / AT hook motif-containing protein (TAIR:AT3G02400.1); Has 1075 Blast hits to 1048 proteins in 243 species: Archae - 14; Bacteria - 671; Metazoa - 68; Fungi - 54; Plants - 81; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink). |
| AT4G14905 | AT4G14905.1 | AAATGGGCTTTATAGGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G14905.2 | AAATGGGCTTTATAGGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). |
| AT4G14950 | AT4G14950.1 | AAATGGGCTTTAAAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT4G14950.2 | AAATGGGCTTTAAAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT4G14950.3 | AAATGGGCTTTAAAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
| AT4G15030 | AT4G15030.1 | TACGGCCCAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT4G15030.2 | TACGGCCCAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages. |
| AT4G15720 | AT4G15720.1 | GAAGCCCATTG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 12291 Blast hits to 4744 proteins in 127 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 17; Plants - 12032; Viruses - 0; Other Eukaryotes - 202 (source: NCBI BLink). |
| AT4G16450 | AT4G16450.1 | TAAATGGGCTCATTCGGGTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 25; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G16630 | AT4G16630.1 | ATAAGCCCATTAA | DEAD/DEAH box helicase, putative (RH28); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G16280.1); Has 75014 Blast hits to 49574 proteins in 2104 species: Archae - 542; Bacteria - 21437; Metazoa - 22382; Fungi - 7369; Plants - 2826; Viruses - 629; Other Eukaryotes - 19829 (source: NCBI BLink). |
| AT4G17190 | AT4G17190.1 | TAAATGGGCCACAAAAAGCCCATTTA | Encodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers. |
| AT4G17190.2 | TAAATGGGCCACAAAAAGCCCATTTA | Encodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers. |
| AT4G17300 | AT4G17300.1 | TAAATGGGCTTAT | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT4G17650 | AT4G17650.1 | ATAAAGCCCATTGGGCCCAACA | aromatic-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); Has 1885 Blast hits to 1881 proteins in 667 species: Archae - 0; Bacteria - 1017; Metazoa - 157; Fungi - 73; Plants - 26; Viruses - 1; Other Eukaryotes - 611 (source: NCBI BLink). |
| AT4G17840 | AT4G17840.1 | AAAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35260.1); Has 1905 Blast hits to 183 proteins in 52 species: Archae - 0; Bacteria - 24; Metazoa - 708; Fungi - 70; Plants - 25; Viruses - 2; Other Eukaryotes - 1076 (source: NCBI BLink). |
| AT4G17960 | AT4G17960.1 | GTGGGCTTTTATTAATGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46620.1); Has 22 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18100 | AT4G18100.1 | TGAGCCCATTTA | 60S ribosomal protein L32 (RPL32A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: callus, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32e (InterPro:IPR001515), Ribosomal protein L32e, conserved site (InterPro:IPR018263); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L32 (RPL32B) (TAIR:AT5G46430.2); Has 1112 Blast hits to 1112 proteins in 342 species: Archae - 217; Bacteria - 0; Metazoa - 540; Fungi - 96; Plants - 104; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). |
| AT4G18140 | AT4G18140.1 | ATATGGGCCTAAGCCCATTAT | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G18140.2 | ATATGGGCCTAAGCCCATTAT | phosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dullard-like phosphatase domain (InterPro:IPR011948), NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: NLI interacting factor (NIF) family protein (TAIR:AT5G46410.1); Has 13 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G22756 | AT4G22756.1 | ATAATGGGCTTTTA | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase. |
| AT4G22910 | AT4G22910.1 | CAAGCCCATTAA | FIZZY-RELATED 2 (FZR2); FUNCTIONS IN: signal transducer activity; INVOLVED IN: trichome branching, signal transduction, DNA endoreduplication, cell growth; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: CCS52A2; signal transducer (TAIR:AT4G11920.1); Has 32185 Blast hits to 17091 proteins in 521 species: Archae - 40; Bacteria - 4571; Metazoa - 14163; Fungi - 6386; Plants - 2781; Viruses - 0; Other Eukaryotes - 4244 (source: NCBI BLink). |
| AT4G23620 | AT4G23620.1 | TTAAAGCCCATTG | 50S ribosomal protein-related; FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25 (InterPro:IPR001021), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66860.1); Has 2862 Blast hits to 2862 proteins in 613 species: Archae - 0; Bacteria - 1307; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1515 (source: NCBI BLink). |
| AT4G24570 | AT4G24570.1 | CAATGGGCT | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: UCP5 (UNCOUPLING PROTEIN 5); binding (TAIR:AT2G22500.1); Has 15369 Blast hits to 9513 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 7655; Fungi - 4171; Plants - 2183; Viruses - 0; Other Eukaryotes - 1360 (source: NCBI BLink). |
| AT4G24770 | AT4G24770.1 | AGCCCATTT | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G24920 | AT4G24920.1 | GCCGTTTAAAATGGGCTTTG | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT5G50460.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT4G25360 | AT4G25360.1 | TTAATGGGCT | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: YLS7 (TAIR:AT5G51640.1); Has 699 Blast hits to 688 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25360.2 | TTAATGGGCT | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: YLS7 (TAIR:AT5G51640.1); Has 699 Blast hits to 688 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G25580 | AT4G25580.1 | GAATGGGCTAGTGGGCTAA | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink). |
| AT4G26000 | AT4G26000.1 | AAATGGGCTAA | Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. |
| AT4G26240 | AT4G26240.1 | AATAGCCCATTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G26310 | AT4G26310.1 | TTAATGGGCTA | elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink). |
| AT4G26400 | AT4G26400.1 | TTAATGGGCTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7059 Blast hits to 7033 proteins in 227 species: Archae - 0; Bacteria - 6; Metazoa - 2361; Fungi - 631; Plants - 2786; Viruses - 51; Other Eukaryotes - 1224 (source: NCBI BLink). |
| AT4G26400.2 | TTAATGGGCTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7059 Blast hits to 7033 proteins in 227 species: Archae - 0; Bacteria - 6; Metazoa - 2361; Fungi - 631; Plants - 2786; Viruses - 51; Other Eukaryotes - 1224 (source: NCBI BLink). |
| AT4G26410 | AT4G26410.1 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022280 (InterPro:IPR016803); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45060.1); Has 47 Blast hits to 47 proteins in 12 species: Archae - 3; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 40; Viruses - 1; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT4G26600 | AT4G26600.1 | AGCCCATTAG | nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink). |
| AT4G26600.1 | CAAGCCCATTAAG | nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink). |
| AT4G26670 | AT4G26670.1 | TAAATGGGCTA | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter/ protein transporter (TAIR:AT5G55510.1); Has 467 Blast hits to 467 proteins in 116 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 144; Plants - 82; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). |
| AT4G26760 | AT4G26760.1 | TAAGCCCATTAAG | MAP65-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anaphase; LOCATED IN: cortical microtubule, preprophase band, phragmoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MAP65/ASE1 (InterPro:IPR007145); BEST Arabidopsis thaliana protein match is: ATMAP65-1 (MICROTUBULE-ASSOCIATED PROTEINS 65-1); microtubule binding (TAIR:AT5G55230.1); Has 7158 Blast hits to 5289 proteins in 462 species: Archae - 120; Bacteria - 495; Metazoa - 4190; Fungi - 430; Plants - 357; Viruses - 13; Other Eukaryotes - 1553 (source: NCBI BLink). |
| AT4G26840 | AT4G26840.1 | ATAAGCCCATTAT | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
| AT4G26870 | AT4G26870.1 | TAAGCCCATTT | aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G31180.2); Has 18508 Blast hits to 15212 proteins in 1719 species: Archae - 299; Bacteria - 10385; Metazoa - 672; Fungi - 662; Plants - 233; Viruses - 0; Other Eukaryotes - 6257 (source: NCBI BLink). |
| AT4G27520 | AT4G27520.1 | TTAGCCCATTAT | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT5G53870.1); Has 143503 Blast hits to 63556 proteins in 1855 species: Archae - 183; Bacteria - 22350; Metazoa - 60212; Fungi - 22770; Plants - 10839; Viruses - 3626; Other Eukaryotes - 23523 (source: NCBI BLink). |
| AT4G28450 | AT4G28450.1 | AAAAAGCCCATTAAG | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT4G28660 | AT4G28660.1 | AAATGGGCTTAT | Similar to PsbW subunit of photosystem II. |
| AT4G28770 | AT4G28770.1 | CTAAGCCCATTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetraspanin (InterPro:IPR018499); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20230.1); Has 94 Blast hits to 94 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G28770.1 | TAGCCCATTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetraspanin (InterPro:IPR018499); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20230.1); Has 94 Blast hits to 94 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT4G30620 | AT4G30620.1 | TAAAAGCCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24020.1); Has 1303 Blast hits to 1303 proteins in 522 species: Archae - 0; Bacteria - 1050; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
| AT4G30750 | AT4G30750.1 | CTTAATGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30760 | AT4G30760.1 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30760.2 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31120 | AT4G31120.1 | ATAAAGCCCATTAGAAAAGCCC | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
| AT4G31120.1 | TAAATGGGCTA | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
| AT4G31120.2 | ATAAAGCCCATTAGAAAAGCCC | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
| AT4G31120.2 | TAAATGGGCTA | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
| AT4G31420 | AT4G31420.1 | GAATGGGCCAAATGGGCTA | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: FZF; transcription factor (TAIR:AT2G24500.1); Has 503 Blast hits to 486 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 160; Plants - 53; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT4G31420.2 | GAATGGGCCAAATGGGCTA | zinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: FZF; transcription factor (TAIR:AT2G24500.1); Has 503 Blast hits to 486 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 160; Plants - 53; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT4G31560 | AT4G31560.1 | TCAGCCCATTG | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane. |
| AT4G31930 | AT4G31930.1 | GAAGCCCATTAA | mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 212 Blast hits to 212 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 66; Plants - 109; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT4G32050 | AT4G32050.1 | CAAAGCCCATTG | neurochondrin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Neurochondrin (InterPro:IPR008709); Has 126 Blast hits to 126 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 5; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT4G32272 | AT4G32272.1 | TAAATGGGCTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related (TAIR:AT4G31600.1); Has 1302 Blast hits to 1300 proteins in 174 species: Archae - 0; Bacteria - 4; Metazoa - 376; Fungi - 239; Plants - 567; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT4G32390 | AT4G32390.1 | ATAAGCCCATTAG | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT2G25520.1); Has 1575 Blast hits to 1573 proteins in 180 species: Archae - 0; Bacteria - 6; Metazoa - 425; Fungi - 287; Plants - 687; Viruses - 0; Other Eukaryotes - 170 (source: NCBI BLink). |
| AT4G32590 | AT4G32590.1 | TAAATGGGCTTG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.1 | TAAATGGGCTTGTTAATGGG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.2 | TAAATGGGCTTG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.2 | TAAATGGGCTTGTTAATGGG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.3 | TAAATGGGCTTG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.3 | TAAATGGGCTTGTTAATGGG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.4 | TAAATGGGCTTG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32590.4 | TAAATGGGCTTGTTAATGGG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
| AT4G32660 | AT4G32660.1 | AAAAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32660.1 | GAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32660.2 | AAAAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32660.2 | GAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32660.3 | AAAAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32660.3 | GAAGCCCATTT | Encodes protein kinase AME3. |
| AT4G32680 | AT4G32680.1 | GAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G32690 | AT4G32690.1 | ATAATGGGCTTC | Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. |
| AT4G33060 | AT4G33060.1 | TTAATGGGCTGGGCTTAG | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 18511 Blast hits to 16644 proteins in 1616 species: Archae - 90; Bacteria - 4190; Metazoa - 5100; Fungi - 1622; Plants - 926; Viruses - 34; Other Eukaryotes - 6549 (source: NCBI BLink). |
| AT4G33865 | AT4G33865.1 | GAATGGGCTA | 40S ribosomal protein S29 (RPS29C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S14 (InterPro:IPR001209); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S29 (RPS29B) (TAIR:AT3G44010.1); Has 694 Blast hits to 694 proteins in 260 species: Archae - 152; Bacteria - 0; Metazoa - 229; Fungi - 88; Plants - 102; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink). |
| AT4G34270 | AT4G34270.1 | TTAAAGCCCATTAAG | TIP41-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: TIP41-like protein (InterPro:IPR007303); Has 248 Blast hits to 248 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT4G34620 | AT4G34620.1 | CTAATGGGCTTA | Encodes ribosomal protein S16, has embryo-defective lethal mutant phenotype |
| AT4G34660 | AT4G34660.1 | CAAGCCCAATGGGCTATT | SH3 domain-containing protein 2 (SH3P2); FUNCTIONS IN: clathrin binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: clathrin binding (TAIR:AT4G18060.1); Has 1201 Blast hits to 1169 proteins in 144 species: Archae - 0; Bacteria - 12; Metazoa - 956; Fungi - 47; Plants - 87; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). |
| AT4G34670 | AT4G34670.1 | AATAGCCCATTGGGCTTG | 40S ribosomal protein S3A (RPS3aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S3Ae, conserved site (InterPro:IPR018281), Ribosomal protein S3Ae (InterPro:IPR001593); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3A (RPS3aA) (TAIR:AT3G04840.1); Has 941 Blast hits to 936 proteins in 297 species: Archae - 150; Bacteria - 1; Metazoa - 370; Fungi - 111; Plants - 126; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink). |
| AT4G35140 | AT4G35140.1 | TTAGCCCATTAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae - 10; Bacteria - 1449; Metazoa - 3242; Fungi - 1387; Plants - 483; Viruses - 0; Other Eukaryotes - 1167 (source: NCBI BLink). |
| AT4G35490 | AT4G35490.1 | CTAATGGGCTAA | MITOCHONDRIAL RIBOSOMAL PROTEIN L11 (MRPL11); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11, bacterial-type (InterPro:IPR006519), Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: PRPL11 (PLASTID RIBOSOMAL PROTEIN L11); structural constituent of ribosome (TAIR:AT1G32990.1); Has 5744 Blast hits to 5744 proteins in 1575 species: Archae - 191; Bacteria - 2960; Metazoa - 99; Fungi - 83; Plants - 65; Viruses - 0; Other Eukaryotes - 2346 (source: NCBI BLink). |
| AT4G35730 | AT4G35730.1 | CAAAGCCCATCTAAGCCCATTAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT4G35730.1 | GAAGCCCATTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT4G37090 | AT4G37090.1 | TTAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). |
| AT4G37090.2 | TTAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). |
| AT4G37460 | AT4G37460.1 | TAGCCCATTG | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms.Involved in mediating effector-triggered immunity. |
| AT4G37880 | AT4G37880.1 | ATAATGGGCTTTTT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22690.2); Has 631 Blast hits to 627 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 324; Fungi - 158; Plants - 74; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT4G38225 | AT4G38225.1 | AGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.1 | GAATGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.2 | AGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.2 | GAATGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.3 | AGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38225.3 | GAATGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38380 | AT4G38380.1 | AGTGGGCTTTAATGGGCTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink). |
| AT4G38930 | AT4G38930.1 | AGCCCATTGGGCT | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT4G38930.2 | AGCCCATTGGGCT | ubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 484 Blast hits to 484 proteins in 153 species: Archae - 0; Bacteria - 0; Metazoa - 126; Fungi - 135; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT4G39080 | AT4G39080.1 | GAAGCCCATTAAAAGCCCAATA | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. |
| AT4G39240 | AT4G39240.1 | ATATGGGCCTAAGCCCATTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink). |
| AT4G39470 | AT4G39470.1 | CTAATGGGCTATT | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: tetratricopeptide repeat (TPR)-containing protein (TAIR:AT3G18420.1); Has 1025 Blast hits to 856 proteins in 182 species: Archae - 118; Bacteria - 326; Metazoa - 111; Fungi - 9; Plants - 62; Viruses - 0; Other Eukaryotes - 399 (source: NCBI BLink). |
| AT4G40040 | AT4G40040.1 | TGAGCCCATTAA | histone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink). |
| AT4G40040.2 | TGAGCCCATTAA | histone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink). |
| AT4G40042 | AT4G40042.1 | TTAATGGGCTCA | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, integral to membrane, signal peptidase complex; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT2G22425.2); Has 218 Blast hits to 218 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 56; Plants - 39; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
| AT5G01960 | AT5G01960.1 | TTAAAGCCCATTTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G65040.3); Has 3886 Blast hits to 3874 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 2090; Fungi - 415; Plants - 660; Viruses - 46; Other Eukaryotes - 675 (source: NCBI BLink). |
| AT5G02150 | AT5G02150.1 | CAATTGGGCCTGTTAAGCCCATTAT | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT5G02150.2 | CAATTGGGCCTGTTAAGCCCATTAT | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT5G02160 | AT5G02160.1 | ATAATGGGCTTAACAGGCCCAATTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G02790 | AT5G02790.1 | AAATGGGCTTA | In2-1 protein, putative; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: In2-1 protein, putative (TAIR:AT5G02780.1); Has 2811 Blast hits to 2774 proteins in 481 species: Archae - 2; Bacteria - 698; Metazoa - 592; Fungi - 122; Plants - 984; Viruses - 0; Other Eukaryotes - 413 (source: NCBI BLink). |
| AT5G03030 | AT5G03030.1 | CAAAGCCCATTAG | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G35795.1); Has 692 Blast hits to 692 proteins in 215 species: Archae - 0; Bacteria - 135; Metazoa - 169; Fungi - 136; Plants - 46; Viruses - 2; Other Eukaryotes - 204 (source: NCBI BLink). |
| AT5G03070 | AT5G03070.1 | TAAATGGGCTATT | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G03080 | AT5G03080.1 | AATAGCCCATTTA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); Has 539 Blast hits to 533 proteins in 226 species: Archae - 7; Bacteria - 211; Metazoa - 103; Fungi - 102; Plants - 38; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). |
| AT5G03430 | AT5G03430.1 | GAAGCCCATTAT | phosphoadenosine phosphosulfate (PAPS) reductase family protein; FUNCTIONS IN: transferase activity; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Molybdopterin binding (InterPro:IPR001453), Phosphoadenosine phosphosulphate reductase (InterPro:IPR002500); Has 3440 Blast hits to 3362 proteins in 916 species: Archae - 114; Bacteria - 1592; Metazoa - 215; Fungi - 195; Plants - 24; Viruses - 0; Other Eukaryotes - 1300 (source: NCBI BLink). |
| AT5G03560 | AT5G03560.1 | TAAATGGGCTA | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). |
| AT5G03560.2 | TAAATGGGCTA | nucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). |
| AT5G03770 | AT5G03770.1 | TTAATGGGCTTAAGGCC | 3-deoxy-D-manno-octulosonic acid transferase-related; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Three-deoxy-D-manno-octulosonic-acid transferase, N-terminal (InterPro:IPR007507); Has 3832 Blast hits to 3832 proteins in 736 species: Archae - 0; Bacteria - 1449; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 2371 (source: NCBI BLink). |
| AT5G04270 | AT5G04270.1 | GAAGCCCATTTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G09320.1); Has 3947 Blast hits to 3944 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1934; Fungi - 520; Plants - 397; Viruses - 0; Other Eukaryotes - 1096 (source: NCBI BLink). |
| AT5G04750 | AT5G04750.1 | TAGCCCATTG | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G04750.2 | TAGCCCATTG | F1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G05110 | AT5G05110.1 | AAATGGGCTTA | cysteine protease inhibitor, putative / cystatin, putative; FUNCTIONS IN: cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT3G12490.2); Has 445 Blast hits to 422 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 436; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G05110.1 | AAATGGGCTTT | cysteine protease inhibitor, putative / cystatin, putative; FUNCTIONS IN: cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT3G12490.2); Has 445 Blast hits to 422 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 436; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G05670 | AT5G05670.1 | TTAATGGGCTTTTATTCGGCCCATTAA | signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae - 2; Bacteria - 40; Metazoa - 443; Fungi - 156; Plants - 102; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT5G05670.2 | TTAATGGGCTTTTATTCGGCCCATTAA | signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae - 2; Bacteria - 40; Metazoa - 443; Fungi - 156; Plants - 102; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). |
| AT5G05680 | AT5G05680.1 | TTAATGGGCCGAATAAAAGCCCATTAA | nuclear pore complex protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; Has 361 Blast hits to 348 proteins in 84 species: Archae - 2; Bacteria - 20; Metazoa - 218; Fungi - 31; Plants - 27; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
| AT5G05780 | AT5G05780.1 | AAAAGCCCATT | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. |
| AT5G06110 | AT5G06110.1 | AAATGGGCTTA | DNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT3G11450.1); Has 30941 Blast hits to 21178 proteins in 1608 species: Archae - 101; Bacteria - 5693; Metazoa - 11416; Fungi - 3019; Plants - 1271; Viruses - 136; Other Eukaryotes - 9305 (source: NCBI BLink). |
| AT5G06260 | AT5G06260.1 | TTAAAGCCCATTT | nucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink). |
| AT5G06360 | AT5G06360.1 | AAAGCCCATTAT | ribosomal protein S8e family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047); Has 361 Blast hits to 360 proteins in 172 species: Archae - 6; Bacteria - 2; Metazoa - 152; Fungi - 111; Plants - 23; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G06360.1 | TTAGCCCATTAA | ribosomal protein S8e family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047); Has 361 Blast hits to 360 proteins in 172 species: Archae - 6; Bacteria - 2; Metazoa - 152; Fungi - 111; Plants - 23; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G07200 | AT5G07200.1 | AGCCCATTC | encodes a gibberellin 20-oxidase. |
| AT5G08190 | AT5G08190.1 | AAAAAGCCCATTT | NUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G08190.2 | AAAAAGCCCATTT | NUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). |
| AT5G08670 | AT5G08670.1 | ATAGGCCCAACTAAGCCCATTAACTAAGCCCAC | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G08690 | AT5G08690.1 | ATAAGCCCATTAT | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G08690.1 | ATAAGCCCATTAT | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT5G09390 | AT5G09390.1 | TCAGCCCATTAATACGGCCCAATT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT5G09390.2 | TCAGCCCATTAATACGGCCCAATT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). |
| AT5G09450 | AT5G09450.1 | CTAATGGGCTGA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G09450.1 | TAAGCCCATTC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G10110 | AT5G10110.1 | ATAATGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10160 | AT5G10160.1 | CTAATGGGCTTAG | beta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). |
| AT5G10350 | AT5G10350.1 | ATAATGGGCT | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10350.2 | ATAATGGGCT | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). |
| AT5G10700 | AT5G10700.1 | TAAAAGCCCATTAAG | aminoacyl-tRNA hydrolase/ protein tyrosine phosphatase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity, protein tyrosine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, translation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833), Protein-tyrosine phosphatase, low molecular weight (InterPro:IPR017867); Has 128 Blast hits to 128 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 81; Fungi - 6; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
| AT5G10710 | AT5G10710.1 | CTTAATGGGCTTTTA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G10710.2 | CTTAATGGGCTTTTA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G11200 | AT5G11200.1 | TAAAGCCCATTC | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G11200.2 | TAAAGCCCATTC | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G11200.3 | TAAAGCCCATTC | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1). |
| AT5G11680 | AT5G11680.1 | AAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 136 Blast hits to 136 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 26; Plants - 24; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). |
| AT5G14030 | AT5G14030.1 | GAATGGGCTTTTA | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.2 | GAATGGGCTTTTA | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.3 | GAATGGGCTTTTA | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G14030.4 | GAATGGGCTTTTA | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). |
| AT5G15020 | AT5G15020.1 | TAAGCCCATTAT | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT5G15350 | AT5G15350.1 | AAATGGGCTATT | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to plasma membrane, plasma membrane, vacuole, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT4G12880.1); Has 768 Blast hits to 760 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 768; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G16140 | AT5G16140.1 | TAAGCCCATTAA | peptidyl-tRNA hydrolase family protein; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G38290.2); Has 5393 Blast hits to 5390 proteins in 1416 species: Archae - 0; Bacteria - 2886; Metazoa - 37; Fungi - 45; Plants - 77; Viruses - 0; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT5G16140.2 | TAAGCCCATTAA | peptidyl-tRNA hydrolase family protein; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G38290.2); Has 5393 Blast hits to 5390 proteins in 1416 species: Archae - 0; Bacteria - 2886; Metazoa - 37; Fungi - 45; Plants - 77; Viruses - 0; Other Eukaryotes - 2348 (source: NCBI BLink). |
| AT5G16710 | AT5G16710.1 | TAATGGGCTGA | The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. |
| AT5G17520 | AT5G17520.1 | ATAATGGGCTTA | Encodes a maltose transporter that is expressed in leaves and roots. Mutations at the MEX1 locus cause accumulation of both starch and maltose in leaves, with maltose levels at least 40 times higher than that of wild-type. This gene encodes a protein located in the chloroplast envelope. |
| AT5G17550 | AT5G17550.1 | AAATGGGCTTA | PEX19-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome; CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); BEST Arabidopsis thaliana protein match is: PEX19-1 (peroxin 19-1) (TAIR:AT3G03490.1); Has 291 Blast hits to 285 proteins in 122 species: Archae - 0; Bacteria - 4; Metazoa - 130; Fungi - 93; Plants - 19; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT5G17550.1 | CTTAATGGGCTTT | PEX19-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome; CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); BEST Arabidopsis thaliana protein match is: PEX19-1 (peroxin 19-1) (TAIR:AT3G03490.1); Has 291 Blast hits to 285 proteins in 122 species: Archae - 0; Bacteria - 4; Metazoa - 130; Fungi - 93; Plants - 19; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). |
| AT5G17560 | AT5G17560.1 | AAAGCCCATTAAG | BolA-like family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BolA-like protein (InterPro:IPR002634); BEST Arabidopsis thaliana protein match is: BolA-like family protein (TAIR:AT1G55805.1); Has 1368 Blast hits to 1368 proteins in 267 species: Archae - 2; Bacteria - 509; Metazoa - 31; Fungi - 15; Plants - 67; Viruses - 0; Other Eukaryotes - 744 (source: NCBI BLink). |
| AT5G17560.1 | TAAGCCCATTT | BolA-like family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BolA-like protein (InterPro:IPR002634); BEST Arabidopsis thaliana protein match is: BolA-like family protein (TAIR:AT1G55805.1); Has 1368 Blast hits to 1368 proteins in 267 species: Archae - 2; Bacteria - 509; Metazoa - 31; Fungi - 15; Plants - 67; Viruses - 0; Other Eukaryotes - 744 (source: NCBI BLink). |
| AT5G18770 | AT5G18770.1 | TAGCCCATTAT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G18780.1); Has 1198 Blast hits to 1165 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1198; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G19620 | AT5G19620.1 | TAAATGGGCTTTAA | AtOEP80 is paralog to the chloroplastic protein translocation channel Toc75 |
| AT5G19930 | AT5G19930.1 | CTATTGGGTCAGCCCATTTGAGGCCCATG | integral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink). |
| AT5G19940 | AT5G19940.1 | CATGGGCCTCAAATGGGCTGACCCAATAG | plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G19940.2 | CATGGGCCTCAAATGGGCTGACCCAATAG | plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G20170 | AT5G20170.1 | TTTTGGGCTTTTAATGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 35; Fungi - 3; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G20180 | AT5G20180.1 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G20180.2 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink). |
| AT5G22210 | AT5G22210.1 | CTAATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G22210.2 | CTAATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G23630 | AT5G23630.1 | TTAATGGGCTA | A novel member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. |
| AT5G24165 | AT5G24165.1 | TCAGCCCATTAGCCCATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23885.1); Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G24520 | AT5G24520.1 | GAAGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.2 | GAAGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24520.3 | GAAGCCCATTAT | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. |
| AT5G24640 | AT5G24640.1 | TAATGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41730.1); Has 13 Blast hits to 13 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G24650 | AT5G24650.1 | TAATGGGCTTT | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT5G24840 | AT5G24840.1 | GAAGCCCATTAAG | tRNA (guanine-N7-)-methyltransferase; FUNCTIONS IN: tRNA (guanine-N7-)-methyltransferase activity; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, tRNA modification; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA (guanine-N-7) methyltransferase (InterPro:IPR003358); BEST Arabidopsis thaliana protein match is: tRNA (guanine-N7-)-methyltransferase (TAIR:AT5G17660.1); Has 3254 Blast hits to 3250 proteins in 1207 species: Archae - 0; Bacteria - 2194; Metazoa - 104; Fungi - 94; Plants - 68; Viruses - 0; Other Eukaryotes - 794 (source: NCBI BLink). |
| AT5G24840.1 | TAATGGGCT | tRNA (guanine-N7-)-methyltransferase; FUNCTIONS IN: tRNA (guanine-N7-)-methyltransferase activity; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, tRNA modification; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA (guanine-N-7) methyltransferase (InterPro:IPR003358); BEST Arabidopsis thaliana protein match is: tRNA (guanine-N7-)-methyltransferase (TAIR:AT5G17660.1); Has 3254 Blast hits to 3250 proteins in 1207 species: Archae - 0; Bacteria - 2194; Metazoa - 104; Fungi - 94; Plants - 68; Viruses - 0; Other Eukaryotes - 794 (source: NCBI BLink). |
| AT5G25510 | AT5G25510.1 | TAAATGGGCTTTAA | serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: ATB' GAMMA; poly(U) binding / protein phosphatase type 2A regulator (TAIR:AT4G15415.2); Has 855 Blast hits to 848 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 492; Fungi - 97; Plants - 156; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). |
| AT5G25520 | AT5G25520.1 | TTAAAGCCCATTTA | transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). |
| AT5G25520.2 | TTAAAGCCCATTTA | transcription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). |
| AT5G25780 | AT5G25780.1 | ATAATGGGCTTTG | member of eIF3b - eukaryotic initiation factor 3b |
| AT5G25780.1 | ATAATGGGCTTTG | member of eIF3b - eukaryotic initiation factor 3b |
| AT5G28370 | AT5G28370.1 | TAAGCCCATTAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G28460.1); Has 22506 Blast hits to 6026 proteins in 190 species: Archae - 7; Bacteria - 27; Metazoa - 841; Fungi - 534; Plants - 20012; Viruses - 0; Other Eukaryotes - 1085 (source: NCBI BLink). |
| AT5G28750 | AT5G28750.1 | AAAGCCCATTAG | thylakoid assembly protein, putative; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion, protein transport; LOCATED IN: chloroplast thylakoid membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Twin-arginine translocation protein TatB (InterPro:IPR003998), Bacterial sec-independent translocation protein mttA/Hcf106 (InterPro:IPR003369), Twin-arginine translocation protein TatA/E (InterPro:IPR006312); BEST Arabidopsis thaliana protein match is: HCF106; proton motive force dependent protein transmembrane transporter (TAIR:AT5G52440.1); Has 1888 Blast hits to 1888 proteins in 601 species: Archae - 44; Bacteria - 1428; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 356 (source: NCBI BLink). |
| AT5G35360 | AT5G35360.1 | CTTAATGGGCTTTAT | Encodes biotin carboxylase subunit (CAC2). |
| AT5G35360.2 | CTTAATGGGCTTTAT | Encodes biotin carboxylase subunit (CAC2). |
| AT5G38860 | AT5G38860.1 | TAAATGGGCTTTT | BES1-interacting Myc-like protein 3 (BIM3); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM2 (BES1-interacting Myc-like protein 2); DNA binding / transcription factor (TAIR:AT1G69010.1); Has 805 Blast hits to 803 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 24; Plants - 651; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G39250 | AT5G39250.1 | CTAATGGGCTTTGGGCCGGGCCGTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G39740 | AT5G39740.1 | TTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA | 60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). |
| AT5G39950 | AT5G39950.1 | TAAATGGGCTAA | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT5G40370 | AT5G40370.1 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink). |
| AT5G40370.2 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink). |
| AT5G40810 | AT5G40810.1 | ATAGGCCCTTAATGGGCTTTTA | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink). |
| AT5G40810.2 | ATAGGCCCTTAATGGGCTTTTA | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink). |
| AT5G41520 | AT5G41520.1 | TTAGCCCATTAA | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT5G41520.2 | TTAGCCCATTAA | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). |
| AT5G41960 | AT5G41960.1 | TGTTGGGCTAATGGGCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G42790 | AT5G42790.1 | GAAGCCCATTAA | encodes a protein with extensive homology to the largest subunit of the multicatalytic proteinase complex (proteasome) |
| AT5G43060 | AT5G43060.1 | TAGCCCATTAA | cysteine proteinase, putative / thiol protease, putative; FUNCTIONS IN: cysteine-type peptidase activity, cysteine-type endopeptidase activity; INVOLVED IN: response to salt stress; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Granulin (InterPro:IPR000118), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: RD21 (responsive to dehydration 21); cysteine-type endopeptidase/ cysteine-type peptidase (TAIR:AT1G47128.1); Has 7000 Blast hits to 6290 proteins in 593 species: Archae - 25; Bacteria - 79; Metazoa - 3655; Fungi - 4; Plants - 1235; Viruses - 122; Other Eukaryotes - 1880 (source: NCBI BLink). |
| AT5G43330 | AT5G43330.1 | TAAATGGGCTTA | malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: cellular carbohydrate metabolic process, glycolysis, malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT1G04410.1); Has 8255 Blast hits to 8253 proteins in 1762 species: Archae - 116; Bacteria - 4254; Metazoa - 1034; Fungi - 184; Plants - 466; Viruses - 0; Other Eukaryotes - 2201 (source: NCBI BLink). |
| AT5G43680 | AT5G43680.1 | TAAATGGGCTTCACGGCCCATAT | unknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 56 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT5G44170 | AT5G44170.1 | CAAGCCCATTCAAAAGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: Expressed protein (TAIR:AT1G08125.1); Has 565 Blast hits to 565 proteins in 102 species: Archae - 0; Bacteria - 6; Metazoa - 261; Fungi - 146; Plants - 99; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
| AT5G44320 | AT5G44320.1 | AAAAGCCCATTGAGGCCCATTAAG | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 40; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G44320.1 | ATAATGGGCTTA | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 40; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
| AT5G45360 | AT5G45360.1 | TTAGCCCATTTA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 132 Blast hits to 132 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 76; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G45930 | AT5G45930.1 | CAAGCCCATTAT | encodes a second Chl I gene (CHLI2), a subunit of magnesium chelatase which is required for chlorophyll biosynthesis. Has ATPase activity, regulated by TRX-f. Involved in the assembly of the Mg chelatase complex. |
| AT5G46030 | AT5G46030.1 | CAAGCCCATTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF701, zinc-binding putative (InterPro:IPR007808); Has 2456 Blast hits to 1418 proteins in 196 species: Archae - 2; Bacteria - 26; Metazoa - 1582; Fungi - 186; Plants - 111; Viruses - 40; Other Eukaryotes - 509 (source: NCBI BLink). |
| AT5G46840 | AT5G46840.2 | CTAATGGGCTGA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). |
| AT5G46840.2 | CTAATGGGCTTAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). |
| AT5G47030 | AT5G47030.1 | AAATGGGCTTTAA | Encodes the mitochondrial ATP synthase subunit delta. |
| AT5G47110 | AT5G47110.1 | CAAAGCCCATTAA | lil3 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis, light harvesting; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LIL3:1; transcription factor (TAIR:AT4G17600.1); Has 51 Blast hits to 51 proteins in 19 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G47210 | AT5G47210.1 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.1 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.2 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.2 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.3 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47210.3 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink). |
| AT5G47930 | AT5G47930.1 | CAATGGGCTGGGCCTATAAGGCCCAATG | 40S ribosomal protein S27 (RPS27D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein S27e (InterPro:IPR000592); BEST Arabidopsis thaliana protein match is: ARS27A (ARABIDOPSIS RIBOSOMAL PROTEIN S27); structural constituent of ribosome (TAIR:AT3G61110.1); Has 707 Blast hits to 707 proteins in 276 species: Archae - 87; Bacteria - 0; Metazoa - 301; Fungi - 98; Plants - 99; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink). |
| AT5G48710 | AT5G48710.1 | TCAGCCCATTAAGGCCCAACT | ubiquitin-related; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin-related (TAIR:AT5G48700.1); Has 703 Blast hits to 702 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 438; Fungi - 87; Plants - 102; Viruses - 1; Other Eukaryotes - 75 (source: NCBI BLink). |
| AT5G49680 | AT5G49680.2 | GAATGGGCT | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
| AT5G50240 | AT5G50240.3 | TTATTGGGCCTATAAAAGCCCATTTA | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
| AT5G50460 | AT5G50460.1 | AGCCCATTTA | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT4G24920.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). |
| AT5G50870 | AT5G50870.1 | AAATGGGCTTC | ubiquitin-conjugating enzyme 27 (UBC27); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: UBC8 (UBIQUITIN CONJUGATING ENZYME 8); protein binding / ubiquitin-protein ligase (TAIR:AT5G41700.4); Has 7501 Blast hits to 7499 proteins in 306 species: Archae - 0; Bacteria - 0; Metazoa - 3692; Fungi - 1438; Plants - 1085; Viruses - 19; Other Eukaryotes - 1267 (source: NCBI BLink). |
| AT5G50960 | AT5G50960.1 | CTTAATGGGCTTTAT | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT5G51110 | AT5G51110.1 | CAATGGGCTTC | 4-alpha-hydroxytetrahydrobiopterin dehydratase; FUNCTIONS IN: 4-alpha-hydroxytetrahydrobiopterin dehydratase activity; INVOLVED IN: tetrahydrobiopterin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional coactivator/pterin dehydratase (InterPro:IPR001533); BEST Arabidopsis thaliana protein match is: dehydratase family (TAIR:AT1G29810.1); Has 1563 Blast hits to 1563 proteins in 256 species: Archae - 17; Bacteria - 489; Metazoa - 0; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1013 (source: NCBI BLink). |
| AT5G51120 | AT5G51120.1 | GAAGCCCATTG | Encodes a homolog of the protein PABN1, a polyadenylation factor subunit. |
| AT5G51960 | AT5G51960.1 | AAAAGCCCATTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATP synthase assembly factor FMC1, mitochondrial (InterPro:IPR018471); Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G52180 | AT5G52180.1 | TTAAAGCCCATTGGGCCTTTT | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G52380 | AT5G52380.1 | GAAGCCCATTTA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G43590.1); Has 2838 Blast hits to 1585 proteins in 218 species: Archae - 0; Bacteria - 0; Metazoa - 882; Fungi - 700; Plants - 374; Viruses - 490; Other Eukaryotes - 392 (source: NCBI BLink). |
| AT5G52920 | AT5G52920.1 | TAAATGGGCTTAT | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. |
| AT5G53490 | AT5G53490.1 | TCAGGCCCAATGGGCTAA | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. |
| AT5G53490.2 | TCAGGCCCAATGGGCTAA | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. |
| AT5G53530 | AT5G53530.1 | TAAATGGGCTTG | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
| AT5G54600 | AT5G54600.1 | TAGCCCATTAAG | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT5G54600.2 | TAGCCCATTAAG | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink). |
| AT5G54900 | AT5G54900.1 | CTAATGGGCTGA | RNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). |
| AT5G55000 | AT5G55000.1 | TAAGCCCATTTA | FH protein interacting protein FIP2 |
| AT5G55000.2 | TAAGCCCATTTA | FH protein interacting protein FIP2 |
| AT5G55160 | AT5G55160.1 | AGCCCATTTGAGCCCATTAAG | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays. |
| AT5G55160.2 | AGCCCATTTGAGCCCATTAAG | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays. |
| AT5G55670 | AT5G55670.1 | CAAGCCCATTT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G13190.1); Has 39714 Blast hits to 21553 proteins in 936 species: Archae - 21; Bacteria - 7210; Metazoa - 18978; Fungi - 3959; Plants - 3841; Viruses - 192; Other Eukaryotes - 5513 (source: NCBI BLink). |
| AT5G55670.1 | TGAGCCCATTAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G13190.1); Has 39714 Blast hits to 21553 proteins in 936 species: Archae - 21; Bacteria - 7210; Metazoa - 18978; Fungi - 3959; Plants - 3841; Viruses - 192; Other Eukaryotes - 5513 (source: NCBI BLink). |
| AT5G56710 | AT5G56710.1 | ATTTGGGCCGTAAATGGGCTA | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT5G56710.2 | ATTTGGGCCGTAAATGGGCTA | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). |
| AT5G56900 | AT5G56900.1 | GAAGCCCATTAAG | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G56900.1 | GAAGCCCATTTA | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G56900.2 | GAAGCCCATTAAG | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G56900.2 | GAAGCCCATTTA | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). |
| AT5G56910 | AT5G56910.1 | CTTAATGGGCTTC | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56920.1); Has 34 Blast hits to 34 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G56910.1 | TAAATGGGCTTC | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56920.1); Has 34 Blast hits to 34 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G57290 | AT5G57290.1 | AAATGGGCTTTG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT5G57290.2 | AAATGGGCTTTG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT5G57290.3 | AAATGGGCTTTG | 60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). |
| AT5G57700 | AT5G57700.1 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G57700.2 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G57700.3 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G57700.4 | ATAAGCCCATTGGGCTTTTATAGGCCT | BNR/Asp-box repeat family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neuraminidase (InterPro:IPR011040); Has 487 Blast hits to 486 proteins in 178 species: Archae - 4; Bacteria - 371; Metazoa - 0; Fungi - 14; Plants - 21; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). |
| AT5G57815 | AT5G57815.1 | TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G58090 | AT5G58090.1 | AAATGGGCTTG | glycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT4G31140.1); Has 1739 Blast hits to 1690 proteins in 137 species: Archae - 0; Bacteria - 12; Metazoa - 0; Fungi - 53; Plants - 1666; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT5G58100 | AT5G58100.1 | CAAGCCCATTT | unknown protein; INVOLVED IN: pollen exine formation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28720.1); Has 82 Blast hits to 62 proteins in 14 species: Archae - 2; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
| AT5G58130 | AT5G58130.1 | TAAAAGCCCATTAAG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G50690.1); Has 13214 Blast hits to 6289 proteins in 622 species: Archae - 145; Bacteria - 5890; Metazoa - 2525; Fungi - 1196; Plants - 360; Viruses - 129; Other Eukaryotes - 2969 (source: NCBI BLink). |
| AT5G58140 | AT5G58140.1 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.2 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.3 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58140.4 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light. |
| AT5G58590 | AT5G58590.1 | GGGCCTTAATGGGCTTA | Encodes a Ran-binding protein 1 homolog (RanBP1). |
| AT5G58710 | AT5G58710.1 | TTAATGGGCT | Encodes cyclophilin ROC7. |
| AT5G58710.1 | TTAGCCCATTA | Encodes cyclophilin ROC7. |
| AT5G58800 | AT5G58800.1 | TGAGCCCATTTA | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). |
| AT5G58800.2 | TGAGCCCATTTA | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). |
| AT5G59500 | AT5G59500.1 | CAAAGCCCATTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 491 Blast hits to 491 proteins in 204 species: Archae - 22; Bacteria - 353; Metazoa - 4; Fungi - 21; Plants - 20; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
| AT5G59613 | AT5G59613.1 | TAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial respiratory chain complex III; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46430.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G59850 | AT5G59850.1 | AAAGGCCCAAAATAAAGCCCATTAT | 40S ribosomal protein S15A (RPS15aF); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: RPS15A (ribosomal protein s15a); structural constituent of ribosome (TAIR:AT1G07770.2); Has 2190 Blast hits to 2190 proteins in 758 species: Archae - 184; Bacteria - 927; Metazoa - 327; Fungi - 130; Plants - 162; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink). |
| AT5G60820 | AT5G60820.1 | CAAGCCCATTTA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G08139.1); Has 6800 Blast hits to 6591 proteins in 264 species: Archae - 0; Bacteria - 123; Metazoa - 2390; Fungi - 543; Plants - 2247; Viruses - 74; Other Eukaryotes - 1423 (source: NCBI BLink). |
| AT5G61020 | AT5G61020.1 | TCAGCCCATTT | ECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT5G61020.2 | TCAGCCCATTT | ECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). |
| AT5G61228 | AT5G61228.1 | GAATGGGCTA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF15 represents a conserved upstream opening reading frame relative to major ORF AT5G61230.1 |
| AT5G61840 | AT5G61840.1 | GCCCATTAAATAATGGGCT | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G61840.1 | TCAGCCCATTA | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
| AT5G62810 | AT5G62810.1 | ATAATGGGCTCA | mutant has a defect in the intracellular transport of thiolase from the cytosol to glyoxysomes (formerly known as ped2) |
| AT5G63190 | AT5G63190.1 | AGCCCATTG | MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). |
| AT5G63190.2 | AGCCCATTG | MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). |
| AT5G63890 | AT5G63890.1 | GAATGGGCTTTACGGGCCTTAA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT5G63890.2 | GAATGGGCTTTACGGGCCTTAA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT5G64330 | AT5G64330.1 | TAAGCCCATTA | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1.Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT5G64330.2 | TAAGCCCATTA | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1.Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT5G64990 | AT5G64990.1 | CAATGGGCTTC | Arabidopsis Rab GTPase homolog H1a (AtRABH1a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab6-related (InterPro:IPR015600); BEST Arabidopsis thaliana protein match is: AtRABH1e (Arabidopsis Rab GTPase homolog H1e); GTP binding (TAIR:AT5G10260.1); Has 20677 Blast hits to 20650 proteins in 589 species: Archae - 19; Bacteria - 94; Metazoa - 11535; Fungi - 2391; Plants - 1785; Viruses - 19; Other Eukaryotes - 4834 (source: NCBI BLink). |
| AT5G65650 | AT5G65650.1 | AAATGGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G36660.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G65940 | AT5G65940.1 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65940.2 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65940.3 | ATAAAGCCCATTAT | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G66190 | AT5G66190.1 | TGAGCCCATTAG | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G66190.2 | TGAGCCCATTAG | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G66290 | AT5G66290.1 | TGGGCCCAATAAAATGGGCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G66450 | AT5G66450.1 | TTAATGGGCTTTTA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT5G66450.2 | TTAATGGGCTTTTA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
| AT5G66680 | AT5G66680.1 | TAAGCCCATTAA | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. |
| AT5G67150 | AT5G67150.1 | TTAATGGGCTTA | transferase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G50280.1); Has 1367 Blast hits to 1362 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 151; Plants - 1216; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT5G67510 | AT5G67510.1 | ATAAGCCCATTAT | 60S ribosomal protein L26 (RPL26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26A) (TAIR:AT3G49910.1); Has 893 Blast hits to 893 proteins in 319 species: Archae - 233; Bacteria - 15; Metazoa - 308; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). |