Organism | Arabidopsis thaliana | |
ID | AtREG373 | |
Sequence | GGCCCAAA | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | GGGCC | one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); | TGGGCY | "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);) |
Total Entry Count | 648 |
Locus | Gene model | Sequence | Description |
AT1G01080 | AT1G01080.1 | TTTGGGCCTTTT | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).  |
AT1G01080.2 | TTTGGGCCTTTT | 33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).  | |
AT1G01160 | AT1G01160.1 | ATTGGCCCAAAT | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA  |
AT1G01160.1 | CTTAGGCCCAAAT | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA  | |
AT1G01160.2 | ATTGGCCCAAAT | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA  | |
AT1G01160.2 | CTTAGGCCCAAAT | Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA  | |
AT1G01510 | AT1G01510.1 | TTTTGGGCCCT | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction.  |
AT1G01730 | AT1G01730.1 | ATATGGGCCCAGAAAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G01840 | AT1G01840.1 | TTAAAGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G02130 | AT1G02130.1 | CAAGGCCCAAAC | Belongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation.  |
AT1G02160 | AT1G02160.1 | TTTTGGGCCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G02160.2 | TTTTGGGCCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G02290 | AT1G02290.1 | CCAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G02960 | AT1G02960.1 | TTGGCCCAAAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT1G02960.2 | TTGGCCCAAAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  | |
AT1G02960.3 | TTGGCCCAAAA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  | |
AT1G03140 | AT1G03140.1 | ATTTGGGCCTATA | splicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).  |
AT1G03150 | AT1G03150.1 | TATAGGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink).  |
AT1G03475 | AT1G03475.1 | TTTTGGGCCTAATTTGGGC | Encodes coproporphyrinogen III oxidase, a key enzyme in the biosynthetic pathway of chlorophyll and heme, a tetrapyrrole pathway. Mutants express cytological and molecular markers associated with the defense responses, usually activated by pathogen infection.  |
AT1G04130 | AT1G04130.1 | ATTTGGGCCCATAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink).  |
AT1G04410 | AT1G04410.1 | ATTTGGGCCTAAT | malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink).  |
AT1G04420 | AT1G04420.1 | ATTAGGCCCAAAT | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink).  |
AT1G04930 | AT1G04930.1 | AATACCCTCAGGCCCAGATCGGCCCAAAA | hydroxyproline-rich glycoprotein family protein; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT2G32840.1); Has 1563 Blast hits to 1268 proteins in 183 species: Archae - 0; Bacteria - 127; Metazoa - 510; Fungi - 165; Plants - 332; Viruses - 182; Other Eukaryotes - 247 (source: NCBI BLink).  |
AT1G04940 | AT1G04940.1 | TTTTGGGCCGATCTGGGCCTGAGGGTATT | Tic20 is believed to function as a component of the protein-conducting channel at the inner envelope membrane. Genes AT1G04940 and AT1G04945 were switched for the TAIR7 genome release to give consistency with MIPs annotation.  |
AT1G04950 | AT1G04950.1 | CTTATTGGGCCTTGGCCCAAAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.  |
AT1G04950.2 | CTTATTGGGCCTTGGCCCAAAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.  | |
AT1G04950.3 | CTTATTGGGCCTTGGCCCAAAA | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.  | |
AT1G05070 | AT1G05070.1 | CAAAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32580.1); Has 55 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G05940 | AT1G05940.1 | TAAAGGCCCAAA | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.  |
AT1G06670 | AT1G06670.1 | TGGCCCAAAAGGCCCAAAAAGCCCAAAA | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins  |
AT1G07020 | AT1G07020.1 | GTTTGGGCCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 22 Blast hits to 22 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 3; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G07400 | AT1G07400.1 | ATTTGGGCCTCA | 17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink).  |
AT1G07645 | AT1G07645.1 | GTAGGCCCAAAT | DESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT1G07810 | AT1G07810.1 | TATAGGCCCAAA | Encodes an ER-type Ca2+-pumping ATPase.  |
AT1G07940 | AT1G07940.1 | CAAGGCCCAAA | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).  |
AT1G07940.2 | CAAGGCCCAAA | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).  | |
AT1G08125 | AT1G08125.1 | ATTTGGGCCGAA | Expressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73320.1); Has 986 Blast hits to 984 proteins in 169 species: Archae - 0; Bacteria - 58; Metazoa - 387; Fungi - 270; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT1G08540 | AT1G08540.1 | AATAGGCCCAAAA | Enodes a subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme. SIG1 is induced by red and blue light.  |
AT1G08580 | AT1G08580.1 | AAAAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G08580.1 | AAAAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G08610 | AT1G08610.1 | ATTGGCCCAAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 19965 Blast hits to 5457 proteins in 167 species: Archae - 5; Bacteria - 16; Metazoa - 328; Fungi - 289; Plants - 18418; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink).  |
AT1G09415 | AT1G09415.1 | TTTGGGCCAA | encodes a kinase that physically interacts with NPR1/NIM1  |
AT1G09620 | AT1G09620.1 | GTGGCCCAAAT | ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding; FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: leucyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Leucyl-tRNA synthetase, class Ia, archaeal/eukaryotic cytosolic (InterPro:IPR004493), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding (TAIR:AT4G04350.1); Has 10914 Blast hits to 10382 proteins in 1644 species: Archae - 486; Bacteria - 5815; Metazoa - 490; Fungi - 313; Plants - 129; Viruses - 0; Other Eukaryotes - 3681 (source: NCBI BLink).  |
AT1G10090 | AT1G10090.1 | GTTTGGGCCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT1G11430 | AT1G11430.1 | TCAGGCCCAAAC | plastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G12810 | AT1G12810.1 | ATCGGCCCAAATCCAATAAG | proline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.  |
AT1G12810.2 | ATCGGCCCAAATCCAATAAG | proline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.  | |
AT1G12850 | AT1G12850.1 | GTTTGGGCCGGGTCG | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Uncharacterised conserved protein UCP036920, phosphoglycerate mutase, plant X4/Y4 (InterPro:IPR017070); BEST Arabidopsis thaliana protein match is: catalytic (TAIR:AT3G26780.1); Has 1266 Blast hits to 1214 proteins in 304 species: Archae - 4; Bacteria - 504; Metazoa - 376; Fungi - 31; Plants - 127; Viruses - 2; Other Eukaryotes - 222 (source: NCBI BLink).  |
AT1G13090 | AT1G13090.1 | ATTTGGGCCTAAACCCATTAG | putative cytochrome P450  |
AT1G13220 | AT1G13220.1 | TTTAGGCCCAAAA | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.  |
AT1G13220.2 | TTTAGGCCCAAAA | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.  | |
AT1G13350 | AT1G13350.1 | AGCCCAAAAGGCCCAAAA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink).  |
AT1G14270 | AT1G14270.1 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
AT1G14270.2 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14270.3 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14270.4 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14980 | AT1G14980.1 | TATAGGCCCAAAC | Encodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs.  |
AT1G15060 | AT1G15060.1 | TGGCCCAAAA | LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase, At1g15070 (InterPro:IPR016969); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73750.1); Has 120 Blast hits to 104 proteins in 29 species: Archae - 0; Bacteria - 61; Metazoa - 1; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT1G15120 | AT1G15120.1 | CAAAGGCCCAAAT | ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT2G01090.1).  |
AT1G15270 | AT1G15270.1 | TTTAACGGGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT1G15280 | AT1G15280.1 | TTTTGGGCCCGTTAAA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).  |
AT1G15280.2 | TTTTGGGCCCGTTAAA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).  | |
AT1G16180 | AT1G16180.1 | ATTTGGGCCATTAGTGGGCCAA | TMS membrane family protein / tumour differentially expressed (TDE) family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TMS membrane protein/tumour differentially expressed protein (InterPro:IPR005016); BEST Arabidopsis thaliana protein match is: TMS membrane family protein / tumour differentially expressed (TDE) family protein (TAIR:AT3G06170.1); Has 608 Blast hits to 602 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 87; Plants - 80; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink).  |
AT1G16870 | AT1G16870.1 | GGCCTTTATGGCCCAAAC | mitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT1G16970 | AT1G16970.1 | TTTTGGGCCTAAC | Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity.  |
AT1G17880 | AT1G17880.1 | TTTTGGGCCTTATGGGCCAAT | nascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).  |
AT1G21720 | AT1G21720.1 | GGCCTAAATTAGGCCCAAAA | 20S proteasome beta subunit PBC1 truncated protein (PBC1)  |
AT1G22450 | AT1G22450.1 | ACAGGCCCAAAT | subunit 6b of cytochrome c oxidase  |
AT1G23310 | AT1G23310.1 | AATAGGCCCAAA | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.  |
AT1G23310.2 | AATAGGCCCAAA | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.  | |
AT1G23780 | AT1G23780.1 | TATAGGCCCAAATACGGCCCATAA | F-box family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G23770.1); Has 177 Blast hits to 177 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G26580 | AT1G26580.1 | TTTTGGGCCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: myb family transcription factor / ELM2 domain-containing protein (TAIR:AT2G03470.1); Has 82 Blast hits to 82 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 78; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G26940 | AT1G26940.1 | TTTTGGGCCTTAA | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink).  |
AT1G28190 | AT1G28190.1 | GTTTGGGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12340.1); Has 113 Blast hits to 106 proteins in 30 species: Archae - 0; Bacteria - 2; Metazoa - 25; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT1G28375 | AT1G28375.1 | ATTTGGGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G29880 | AT1G29880.1 | CTTGGGCCCAAA | glycyl-tRNA synthetase / glycine--tRNA ligase; FUNCTIONS IN: glycine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, glycyl-tRNA aminoacylation; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Glycyl-tRNA synthetase, alpha2 dimer (InterPro:IPR002315), Anticodon-binding (InterPro:IPR004154), Glycyl-tRNA synthetase, alpha2 dimer, C-terminal (InterPro:IPR018160), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: tRNA synthetase class II (G, H, P and S) family protein (TAIR:AT1G29870.1); Has 4267 Blast hits to 3231 proteins in 634 species: Archae - 169; Bacteria - 1528; Metazoa - 158; Fungi - 116; Plants - 33; Viruses - 0; Other Eukaryotes - 2263 (source: NCBI BLink).  |
AT1G29990 | AT1G29990.1 | TTTTGGGCCTTAC | Encodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins.  |
AT1G30880 | AT1G30880.1 | ATTTGGGCCTAAATTGGGCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G30890 | AT1G30890.1 | ATTGGCCCAATTTAGGCCCAAAT | integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).  |
AT1G30890.2 | ATTGGCCCAATTTAGGCCCAAAT | integral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).  | |
AT1G32530 | AT1G32530.1 | TATATGGGCCCAAAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink).  |
AT1G33290 | AT1G33290.1 | TAAAAGCCCATAGGCCCAAAGGCCCATAA | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 615 Blast hits to 609 proteins in 245 species: Archae - 8; Bacteria - 419; Metazoa - 33; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
AT1G33290.2 | TAAAAGCCCATAGGCCCAAAGGCCCATAA | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 615 Blast hits to 609 proteins in 245 species: Archae - 8; Bacteria - 419; Metazoa - 33; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  | |
AT1G36050 | AT1G36050.1 | ATTTGGGCCTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22200.1); Has 910 Blast hits to 798 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 392; Fungi - 181; Plants - 141; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  |
AT1G36050.2 | ATTTGGGCCTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22200.1); Has 910 Blast hits to 798 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 392; Fungi - 181; Plants - 141; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  | |
AT1G41880 | AT1G41880.1 | ATTTGGGCCAA | 60S ribosomal protein L35a (RPL35aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aD) (TAIR:AT3G55750.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT1G41880.1 | GTTTGGGCCAA | 60S ribosomal protein L35a (RPL35aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aD) (TAIR:AT3G55750.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  | |
AT1G43170 | AT1G43170.1 | TGTTGGGCTTTAGGCCCAAAA | Encodes a cytoplasmic ribosomal protein.  |
AT1G43170.2 | TGTTGGGCTTTAGGCCCAAAA | Encodes a cytoplasmic ribosomal protein.  | |
AT1G43170.3 | TGTTGGGCTTTAGGCCCAAAA | Encodes a cytoplasmic ribosomal protein.  | |
AT1G43170.4 | TGTTGGGCTTTAGGCCCAAAA | Encodes a cytoplasmic ribosomal protein.  | |
AT1G48630 | AT1G48630.1 | TGGCCCAAAT | Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1B has no phenotype on its own and probably acts redundantly with RACK1A and RACK1C.  |
AT1G51060 | AT1G51060.1 | GTTTGGGCCGAA | Encodes HTA10, a histone H2A protein.  |
AT1G51400 | AT1G51400.1 | GTTTGGGCCA | photosystem II 5 kD protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to UV-B, response to wounding, response to ozone; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSBTN (photosystem II subunit T) (TAIR:AT3G21055.1); Has 59 Blast hits to 59 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G51620 | AT1G51620.1 | AACGGCCCAAAA | protein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, LP.12 twelve leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat protein kinase, putative (TAIR:AT1G51805.1); Has 67324 Blast hits to 66732 proteins in 1779 species: Archae - 34; Bacteria - 5197; Metazoa - 29240; Fungi - 4902; Plants - 16777; Viruses - 189; Other Eukaryotes - 10985 (source: NCBI BLink).  |
AT1G52360 | AT1G52360.1 | AGAGGCCCAAAC | coatomer protein complex, subunit beta 2 (beta prime), putative; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, COPI vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Coatomer, WD associated region (InterPro:IPR006692), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat (InterPro:IPR001680), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), Coatomer, beta' subunit (InterPro:IPR016453), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT3G15980.3); Has 57972 Blast hits to 24958 proteins in 644 species: Archae - 48; Bacteria - 5666; Metazoa - 27314; Fungi - 11164; Plants - 5401; Viruses - 42; Other Eukaryotes - 8337 (source: NCBI BLink).  |
AT1G55330 | AT1G55330.1 | GTTTGGGCCAA | Encodes a putative arabinogalactan-protein (AGP21).  |
AT1G55370 | AT1G55370.1 | TAAAGGCCCAAAC | NDH-DEPENDENT CYCLIC ELECTRON FLOW 5 (NDF5); FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: positive regulation of gene expression, photosynthetic electron transport in photosystem I; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013); BEST Arabidopsis thaliana protein match is: NDF2 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); carbohydrate binding / catalytic (TAIR:AT1G64770.1); Has 99 Blast hits to 98 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G55370.2 | TAAAGGCCCAAAC | NDH-DEPENDENT CYCLIC ELECTRON FLOW 5 (NDF5); FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: positive regulation of gene expression, photosynthetic electron transport in photosystem I; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013); BEST Arabidopsis thaliana protein match is: NDF2 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); carbohydrate binding / catalytic (TAIR:AT1G64770.1); Has 99 Blast hits to 98 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G55490 | AT1G55490.1 | TAAAGGCCCAAATAGGCCCAATAT | encodes the beta subunit of the chloroplast chaperonin 60, a homologue of bacterial GroEL. Mutants in this gene develops lesions on its leaves, expresses systemic acquired resistance (SAR) and develops accelerated cell death to heat shock stress. The protein has molecular chaperone activity for suppressing protein aggregation in vitro.  |
AT1G55490.2 | TAAAGGCCCAAATAGGCCCAATAT | encodes the beta subunit of the chloroplast chaperonin 60, a homologue of bacterial GroEL. Mutants in this gene develops lesions on its leaves, expresses systemic acquired resistance (SAR) and develops accelerated cell death to heat shock stress. The protein has molecular chaperone activity for suppressing protein aggregation in vitro.  | |
AT1G56060 | AT1G56060.1 | ATTGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32190.1); Has 124 Blast hits to 124 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G60890 | AT1G60890.1 | GGGCCCAAAA | phosphatidylinositol-4-phosphate 5-kinase family protein; FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: phosphatidylinositol metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G10900.1); Has 22998 Blast hits to 6300 proteins in 384 species: Archae - 0; Bacteria - 2356; Metazoa - 3944; Fungi - 305; Plants - 691; Viruses - 0; Other Eukaryotes - 15702 (source: NCBI BLink).  |
AT1G64850 | AT1G64850.1 | ATTGGCCCAAAT | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37445.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G66500 | AT1G66500.1 | ACTGGGCCTATAAACCGTGGCCCAAAACACGTGACA | zinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 85; Plants - 35; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT1G67250 | AT1G67250.1 | GTAGGCCCAAAT | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT5G38650.1); Has 170 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 2; Plants - 63; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT1G68340 | AT1G68340.1 | TGAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 137 Blast hits to 137 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G68680 | AT1G68680.1 | GTGGGCTTCGAGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; Has 12 Blast hits to 12 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G69510 | AT1G69510.1 | TTGGCCCAATTAAGGCCCAAAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G69510.2 | TTGGCCCAATTAAGGCCCAAAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G69510.3 | TTGGCCCAATTAAGGCCCAAAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lg106-like (InterPro:IPR012482); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64130.1); Has 92 Blast hits to 92 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G69620 | AT1G69620.1 | AGATGGGCCTTTGGGCCAA | putative 60S ribosomal protein L34  |
AT1G69770 | AT1G69770.1 | ATTAGGCCCAAAC | Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing.  |
AT1G70190 | AT1G70190.1 | TTTTGGGCCAA | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT4G37660.1); Has 5742 Blast hits to 5742 proteins in 1557 species: Archae - 0; Bacteria - 3189; Metazoa - 133; Fungi - 84; Plants - 174; Viruses - 0; Other Eukaryotes - 2162 (source: NCBI BLink).  |
AT1G70730 | AT1G70730.1 | TTTGGGCCAT | phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative; FUNCTIONS IN: intramolecular transferase activity, phosphotransferases, magnesium ion binding, phosphoglucomutase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-D-phosphohexomutase, conserved site (InterPro:IPR016066), Alpha-D-phosphohexomutase, C-terminal (InterPro:IPR005843), Alpha-D-phosphohexomutase, alpha/beta/alpha I, II and III (InterPro:IPR016055), Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (InterPro:IPR005846), Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (InterPro:IPR005845), Alpha-D-phosphohexomutase, N-terminal (InterPro:IPR005841), Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (InterPro:IPR005844); BEST Arabidopsis thaliana protein match is: phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative (TAIR:AT1G23190.1).  |
AT1G71730 | AT1G71730.1 | ATAAGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 32 Blast hits to 32 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G71780 | AT1G71780.1 | ATACCCTTTAGGCCCATCATAAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G72020 | AT1G72020.1 | TAAATGGGCCTGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G72140 | AT1G72140.1 | ATTTGGGCCTTT | proton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT1G22540.1); Has 4291 Blast hits to 4187 proteins in 759 species: Archae - 0; Bacteria - 1913; Metazoa - 527; Fungi - 296; Plants - 1112; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink).  |
AT1G75630 | AT1G75630.1 | GTTTGGGCCTTT | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA,  |
AT1G75840 | AT1G75840.1 | AACGGCCCAAAA | Belongs to the plant-specific ROP group of Rho GTPases; localized to the plasma membrane of tips of root hairs; involved in polar growth control.  |
AT1G76200 | AT1G76200.1 | AGGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 29; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT1G79710 | AT1G79710.1 | CAATGGGCCCAAAT | integral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae - 4; Bacteria - 113; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink).  |
AT1G79870 | AT1G79870.1 | TTATGGGCCCAAAAATAGGCCCATCT | oxidoreductase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19936 Blast hits to 19933 proteins in 1515 species: Archae - 283; Bacteria - 9447; Metazoa - 662; Fungi - 752; Plants - 323; Viruses - 5; Other Eukaryotes - 8464 (source: NCBI BLink).  |
AT1G80070 | AT1G80070.1 | ACGGCCCAAAT | a genetic locus involved in embryogenesis. Mutations in this locus result in an abnormal suspensor and embryo lethality.  |
AT1G80550 | AT1G80550.1 | ATCGGCCCAAAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).  |
AT1G80550.1 | GGGCTTTGGGCCCATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).  | |
AT1G80670 | AT1G80670.1 | AAAGTCAACATTGGGCCATAATAAGGCCCAAATATTAGGCCC | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  |
AT2G01060 | AT2G01060.1 | GTTTGGGCCTATA | myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G13040.2); Has 911 Blast hits to 902 proteins in 37 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 902; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT2G01060.1 | GTTTGGGCCTTAG | myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G13040.2); Has 911 Blast hits to 902 proteins in 37 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 902; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT2G01060.2 | GTTTGGGCCTATA | myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G13040.2); Has 911 Blast hits to 902 proteins in 37 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 902; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT2G01060.2 | GTTTGGGCCTTAG | myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G13040.2); Has 911 Blast hits to 902 proteins in 37 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 902; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT2G01270 | AT2G01270.1 | AGCCCAATTGGGCCCAAAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.  |
AT2G01640 | AT2G01640.1 | CTAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 18; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT2G01650 | AT2G01650.1 | TTGGCCCAAAA | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo.  |
AT2G01650.1 | TTGGCCCAAAAGGCCCATTAA | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo.  | |
AT2G02880 | AT2G02880.1 | ATTTGGGCCTCA | mucin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62270.1); Has 72 Blast hits to 72 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT2G04378 | AT2G04378.1 | TTTTGGGCCAA | beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G04378.2 | TTTTGGGCCAA | beta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G04390 | AT2G04390.1 | TTGGCCCAAAA | 40S ribosomal protein S17 (RPS17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus, plasma membrane; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT2G04410 | AT2G04410.1 | TAACGGGCCCATTAAGGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G15890 | AT2G15890.1 | TGGCCCAAA | maternal effect embryo arrest 14 (MEE14); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G15890.2 | TGGCCCAAA | maternal effect embryo arrest 14 (MEE14); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT2G16510 | AT2G16510.1 | TCGACCCGGCCCAAAA | vacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink).  |
AT2G17200 | AT2G17200.1 | TAAAGCCCTTTGGGCCTCA | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17190.1); Has 11842 Blast hits to 6071 proteins in 720 species: Archae - 6; Bacteria - 2895; Metazoa - 3957; Fungi - 1228; Plants - 1619; Viruses - 162; Other Eukaryotes - 1975 (source: NCBI BLink).  |
AT2G17670 | AT2G17670.1 | TTTGGGCCGAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink).  |
AT2G17670.2 | TTTGGGCCGAT | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink).  | |
AT2G18740 | AT2G18740.1 | ATTTGGGCCAA | small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative (TAIR:AT4G30330.1); Has 513 Blast hits to 513 proteins in 151 species: Archae - 78; Bacteria - 0; Metazoa - 173; Fungi - 106; Plants - 69; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).  |
AT2G18740.2 | ATTTGGGCCAA | small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative (TAIR:AT4G30330.1); Has 513 Blast hits to 513 proteins in 151 species: Archae - 78; Bacteria - 0; Metazoa - 173; Fungi - 106; Plants - 69; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).  | |
AT2G19270 | AT2G19270.1 | ATTTGGGCCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitotic checkpoint protein PRCC, C-terminal (InterPro:IPR018800); Has 1029 Blast hits to 488 proteins in 117 species: Archae - 0; Bacteria - 14; Metazoa - 432; Fungi - 124; Plants - 39; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink).  |
AT2G20060 | AT2G20060.1 | ATAAGCCCACAAGGCCCAAAT | ribosomal protein L4 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4 (InterPro:IPR015498), Ribosomal protein L4/L1e, bacterial-type (InterPro:IPR013005), Ribosomal protein L4/L1e (InterPro:IPR002136); BEST Arabidopsis thaliana protein match is: RPL4; poly(U) binding / structural constituent of ribosome (TAIR:AT1G07320.4); Has 5451 Blast hits to 5451 proteins in 1497 species: Archae - 63; Bacteria - 2944; Metazoa - 100; Fungi - 82; Plants - 60; Viruses - 0; Other Eukaryotes - 2202 (source: NCBI BLink).  |
AT2G20530 | AT2G20530.1 | TTTTGGGCCCAAA | PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink).  |
AT2G20530.2 | TTTTGGGCCCAAA | PROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink).  | |
AT2G20585 | AT2G20585.1 | TTGGCCCAAAA | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G20585.2 | TTGGCCCAAAA | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G20585.3 | TTGGCCCAAAA | NUCLEAR FUSION DEFECTIVE 6 (NFD6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28395.4); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G20610 | AT2G20610.1 | CCAGGCCCAAAC | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis.  |
AT2G20610.2 | CCAGGCCCAAAC | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis.  | |
AT2G20860 | AT2G20860.1 | AATAGGCCCAAAT | LIP1,Lipoic acid synthase,  |
AT2G21550 | AT2G21550.1 | ACGGCCCAAAT | bifunctional dihydrofolate reductase-thymidylate synthase, putative / DHFR-TS, putative; FUNCTIONS IN: thymidylate synthase activity, dihydrofolate reductase activity; INVOLVED IN: glycine biosynthetic process, one-carbon compound metabolic process, nucleotide biosynthetic process, dTMP biosynthetic process; EXPRESSED IN: stem, hypocotyl, root; CONTAINS InterPro DOMAIN/s: Dihydrofolate reductase region (InterPro:IPR001796), Dihydrofolate reductase conserved site (InterPro:IPR017925), Bifunctional dihydrofolate reductase/thymidylate synthase (InterPro:IPR012262), Thymidylate synthase, C-terminal (InterPro:IPR000398); BEST Arabidopsis thaliana protein match is: THY-1 (THYMIDYLATE SYNTHASE 1); dihydrofolate reductase/ thymidylate synthase (TAIR:AT2G16370.1); Has 8212 Blast hits to 8187 proteins in 1426 species: Archae - 15; Bacteria - 4426; Metazoa - 386; Fungi - 306; Plants - 51; Viruses - 195; Other Eukaryotes - 2833 (source: NCBI BLink).  |
AT2G22400 | AT2G22400.1 | CTAATGGGCTTTATACGGCCCAAAA | NOL1/NOP2/sun family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314); BEST Arabidopsis thaliana protein match is: NOL1/NOP2/sun family protein (TAIR:AT4G40000.1); Has 5426 Blast hits to 5396 proteins in 1280 species: Archae - 185; Bacteria - 3179; Metazoa - 525; Fungi - 201; Plants - 119; Viruses - 0; Other Eukaryotes - 1217 (source: NCBI BLink).  |
AT2G24500 | AT2G24500.1 | GTTTGGGCCAA | Encodes a C2H2 zinc finger protein FZF.  |
AT2G24765 | AT2G24765.1 | TTTAGGCCCAAAAAAAGCC | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner  |
AT2G24765.2 | TTTAGGCCCAAAAAAAGCC | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner  | |
AT2G27680 | AT2G27680.1 | ATTTGGGCCTGA | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G06690.1); Has 7113 Blast hits to 7107 proteins in 1067 species: Archae - 127; Bacteria - 5110; Metazoa - 109; Fungi - 309; Plants - 217; Viruses - 0; Other Eukaryotes - 1241 (source: NCBI BLink).  |
AT2G28230 | AT2G28230.1 | TTTTGGGCCTTCGGCCCATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TATA-binding related factor (InterPro:IPR013921); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09070.1); Has 43 Blast hits to 43 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT2G29650 | AT2G29650.1 | ATTTGGGCCTTATATGGGCTTTAT | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane.  |
AT2G29650.2 | ATTTGGGCCTTATATGGGCTTTAT | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane.  | |
AT2G29650.3 | ATTTGGGCCTTATATGGGCTTTAT | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane.  | |
AT2G29990 | AT2G29990.1 | ATAGGCCCAAAT | ALTERNATIVE NAD(P)H DEHYDROGENASE 2 (NDA2); FUNCTIONS IN: NADH dehydrogenase activity, oxidoreductase activity, FAD binding; LOCATED IN: intrinsic to mitochondrial inner membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327); BEST Arabidopsis thaliana protein match is: NDA1 (ALTERNATIVE NAD(P)H DEHYDROGENASE 1); NADH dehydrogenase (TAIR:AT1G07180.1); Has 6371 Blast hits to 6256 proteins in 1243 species: Archae - 141; Bacteria - 4567; Metazoa - 49; Fungi - 428; Plants - 224; Viruses - 0; Other Eukaryotes - 962 (source: NCBI BLink).  |
AT2G30060 | AT2G30060.1 | AATAGGCCCAAAAGGGCCCATTAT | Ran-binding protein 1b (RanBP1b); FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: intracellular transport, protein import into nucleus, translocation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ran Binding Protein 1 (InterPro:IPR000156), Pleckstrin homology-type (InterPro:IPR011993); BEST Arabidopsis thaliana protein match is: SIRANBP; Ran GTPase binding (TAIR:AT1G07140.1); Has 1190 Blast hits to 924 proteins in 176 species: Archae - 0; Bacteria - 3; Metazoa - 728; Fungi - 225; Plants - 88; Viruses - 2; Other Eukaryotes - 144 (source: NCBI BLink).  |
AT2G31190 | AT2G31190.1 | ATTTGGGCC | LOCATED IN: mitochondrion, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: emb1879 (embryo defective 1879) (TAIR:AT5G49820.1); Has 274 Blast hits to 274 proteins in 92 species: Archae - 0; Bacteria - 2; Metazoa - 96; Fungi - 41; Plants - 94; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT2G31200 | AT2G31200.1 | TGAGGCCCAAAT | Encodes actin depolymerizing factor 6 (ADF6).  |
AT2G31490 | AT2G31490.1 | TTTGGGCCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G31490.1 | TTTGGGCCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G31610 | AT2G31610.1 | AATAGGCCCAAAC | 40S ribosomal protein S3 (RPS3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation, response to abiotic stimulus; LOCATED IN: in 6 components; EXPRESSED IN: root, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3B) (TAIR:AT3G53870.1); Has 3946 Blast hits to 3943 proteins in 1195 species: Archae - 174; Bacteria - 1992; Metazoa - 298; Fungi - 94; Plants - 101; Viruses - 0; Other Eukaryotes - 1287 (source: NCBI BLink).  |
AT2G31740 | AT2G31740.1 | TGAGGCCCAAAT | methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: spermidine synthase-related / putrescine aminopropyltransferase-related (TAIR:AT5G04610.1); Has 1448 Blast hits to 1421 proteins in 339 species: Archae - 18; Bacteria - 478; Metazoa - 298; Fungi - 34; Plants - 123; Viruses - 0; Other Eukaryotes - 497 (source: NCBI BLink).  |
AT2G32415 | AT2G32415.1 | TTTTGGGCCAA | 3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae - 0; Bacteria - 1374; Metazoa - 367; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 953 (source: NCBI BLink).  |
AT2G32480 | AT2G32480.1 | ATTTGGGCCCTA | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink).  |
AT2G32480.2 | ATTTGGGCCCTA | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink).  | |
AT2G32520 | AT2G32520.1 | ATTTGGGCCTAATGGCCCATATA | dienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase (InterPro:IPR002155), Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT1G35420.1); Has 2362 Blast hits to 2362 proteins in 596 species: Archae - 20; Bacteria - 1757; Metazoa - 54; Fungi - 12; Plants - 53; Viruses - 0; Other Eukaryotes - 466 (source: NCBI BLink).  |
AT2G33040 | AT2G33040.1 | TTTGGGCCTTAT | ATP synthase gamma chain, mitochondrial (ATPC); FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, gamma subunit (InterPro:IPR000131); BEST Arabidopsis thaliana protein match is: ATPC1; enzyme regulator (TAIR:AT4G04640.1); Has 6854 Blast hits to 6853 proteins in 1574 species: Archae - 5; Bacteria - 3135; Metazoa - 212; Fungi - 103; Plants - 101; Viruses - 0; Other Eukaryotes - 3298 (source: NCBI BLink).  |
AT2G35520 | AT2G35520.1 | CTTGGGCCCAAAGGCCC | DEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT2G35520.2 | CTTGGGCCCAAAGGCCC | DEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  | |
AT2G35605 | AT2G35605.1 | GAGGCCCAAAACAGGCCCAAAC | SWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT1G31760.1); Has 726 Blast hits to 687 proteins in 149 species: Archae - 0; Bacteria - 129; Metazoa - 56; Fungi - 126; Plants - 201; Viruses - 8; Other Eukaryotes - 206 (source: NCBI BLink).  |
AT2G36070 | AT2G36070.1 | ATGGCCCAAAC | One of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP.  |
AT2G36130 | AT2G36130.1 | AAAAGGCCCAAA | peptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 12476 Blast hits to 12426 proteins in 1530 species: Archae - 82; Bacteria - 4056; Metazoa - 2344; Fungi - 974; Plants - 734; Viruses - 0; Other Eukaryotes - 4286 (source: NCBI BLink).  |
AT2G36160 | AT2G36160.1 | TTCGGCCCAAAT | 40S ribosomal protein S14 (RPS14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane, chloroplast, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971), Ribosomal S11, conserved site (InterPro:IPR018102); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S14 (RPS14B) (TAIR:AT3G11510.1); Has 6247 Blast hits to 6247 proteins in 1750 species: Archae - 169; Bacteria - 2829; Metazoa - 487; Fungi - 108; Plants - 517; Viruses - 0; Other Eukaryotes - 2137 (source: NCBI BLink).  |
AT2G37400 | AT2G37400.1 | TTGGGCTTATAAAGGCCCAAAT | chloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast thylakoid lumen, plastid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT3G53560.1); Has 1554 Blast hits to 1284 proteins in 289 species: Archae - 132; Bacteria - 762; Metazoa - 103; Fungi - 19; Plants - 70; Viruses - 0; Other Eukaryotes - 468 (source: NCBI BLink).  |
AT2G37600 | AT2G37600.1 | TTTGGGCCTGT | 60S ribosomal protein L36 (RPL36A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 94; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).  |
AT2G37600.2 | TTTGGGCCTGT | 60S ribosomal protein L36 (RPL36A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 195 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 94; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).  | |
AT2G37790 | AT2G37790.1 | TTAAGGCCCAAATATGGGCTTA | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37770.2); Has 14317 Blast hits to 14296 proteins in 1374 species: Archae - 187; Bacteria - 8146; Metazoa - 1861; Fungi - 1118; Plants - 723; Viruses - 0; Other Eukaryotes - 2282 (source: NCBI BLink).  |
AT2G39280 | AT2G39280.1 | TTTAGGCCCAAAA | RAB GTPase activator; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RabGAP/TBC domain-containing protein (TAIR:AT3G55020.1); Has 4701 Blast hits to 4645 proteins in 231 species: Archae - 15; Bacteria - 84; Metazoa - 2806; Fungi - 708; Plants - 245; Viruses - 9; Other Eukaryotes - 834 (source: NCBI BLink).  |
AT2G39290 | AT2G39290.1 | TTTTGGGCCTAAA | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria.  |
AT2G41945 | AT2G41945.1 | ATTTGGGCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1).  |
AT2G41945.2 | ATTTGGGCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1).  | |
AT2G41945.3 | ATTTGGGCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1).  | |
AT2G42370 | AT2G42370.1 | ATTTGGGCCGTA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58110.1); Has 174 Blast hits to 159 proteins in 47 species: Archae - 3; Bacteria - 17; Metazoa - 67; Fungi - 5; Plants - 22; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT2G43720 | AT2G43720.1 | CTAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31725.1); Has 203 Blast hits to 203 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 158; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT2G45640 | AT2G45640.1 | GTTAGGCCCAAAT | Involved in the regulation of salt stress. Expression of AtSAP18 is induced by NaCl, cold, drought, ABA, and ethylene treatment. AtSAP18 and HDA19 associate with ERF3 and ERF4 both in vitro and in vivo.  |
AT2G45790 | AT2G45790.1 | TGGCCCAAAT | encodes a phosphomannomutase, involved in ascorbate biosynthesis  |
AT2G46540 | AT2G46540.1 | ATTTGGGCCCAGTAACCCGACCCGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G47640 | AT2G47640.1 | CAAGGCCCAAAA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT2G47640.1 | TATGGCCCAAA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.2 | CAAGGCCCAAAA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.2 | TATGGCCCAAA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.3 | CAAGGCCCAAAA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.3 | TATGGCCCAAA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.4 | CAAGGCCCAAAA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT2G47640.4 | TATGGCCCAAA | small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT3G01150 | AT3G01150.1 | TATAGGCCCAAAA | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.  |
AT3G01150.2 | TATAGGCCCAAAA | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.  | |
AT3G01180 | AT3G01180.1 | GTGGCCCAAAT | starch synthase 2 (AtSS2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: cellulose biosynthetic process, glucan biosynthetic process, biosynthetic process, glycogen biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycogen/starch synthases, ADP-glucose type (InterPro:IPR011835), Starch synthase catalytic region (InterPro:IPR013534), Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: SSI1 (SUPPRESSOR OF SALICYLIC ACID INSENSITIVITY 1); starch synthase/ transferase, transferring glycosyl groups (TAIR:AT5G24300.1); Has 12527 Blast hits to 8643 proteins in 2404 species: Archae - 147; Bacteria - 2735; Metazoa - 1166; Fungi - 888; Plants - 3652; Viruses - 25; Other Eukaryotes - 3914 (source: NCBI BLink).  |
AT3G01320 | AT3G01320.1 | CCGGCCCAAAT | Encodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190).  |
AT3G01430 | AT3G01430.1 | TTTTGGGCCA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT5G14890.1); Has 48 Blast hits to 48 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G01520 | AT3G01520.1 | ATTTGGGCCCT | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT5G14680.1); Has 1147 Blast hits to 1145 proteins in 292 species: Archae - 54; Bacteria - 658; Metazoa - 30; Fungi - 22; Plants - 354; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT3G01540 | AT3G01540.1 | GTGGCCCAAAAGGGCCCAAAA | RNA HELICASE DRH1  |
AT3G01540.2 | GTGGCCCAAAAGGGCCCAAAA | RNA HELICASE DRH1  | |
AT3G01540.3 | GTGGCCCAAAAGGGCCCAAAA | RNA HELICASE DRH1  | |
AT3G01540.4 | GTGGCCCAAAAGGGCCCAAAA | RNA HELICASE DRH1  | |
AT3G01740 | AT3G01740.1 | ATTTGGGCCGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37, mitochondrial (InterPro:IPR013870); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14290.1); Has 117 Blast hits to 117 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 22; Plants - 27; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT3G01820 | AT3G01820.1 | GTTTGGGCCTTAT | adenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 6349 Blast hits to 6292 proteins in 1637 species: Archae - 58; Bacteria - 3459; Metazoa - 744; Fungi - 256; Plants - 228; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink).  |
AT3G02540 | AT3G02540.1 | TTTTGGGCCTAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  |
AT3G02540.2 | TTTTGGGCCTAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  | |
AT3G03010 | AT3G03010.1 | CAAAGGCCCAAAT | aminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 625 Blast hits to 625 proteins in 230 species: Archae - 158; Bacteria - 4; Metazoa - 158; Fungi - 86; Plants - 40; Viruses - 8; Other Eukaryotes - 171 (source: NCBI BLink).  |
AT3G03010.2 | CAAAGGCCCAAAT | aminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 625 Blast hits to 625 proteins in 230 species: Archae - 158; Bacteria - 4; Metazoa - 158; Fungi - 86; Plants - 40; Viruses - 8; Other Eukaryotes - 171 (source: NCBI BLink).  | |
AT3G03020 | AT3G03020.1 | ATTTGGGCCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G03020.2 | ATTTGGGCCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G03150 | AT3G03150.1 | TCGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G03160 | AT3G03160.1 | TTTTGGGCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G03220 | AT3G03220.1 | ATTTGGGCCTTAC | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)  |
AT3G04130 | AT3G04130.1 | GAGCCCAACTTTGGGCCGTA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).  |
AT3G04130.2 | GAGCCCAACTTTGGGCCGTA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).  | |
AT3G04560 | AT3G04560.1 | ATTTGGGCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 174 Blast hits to 172 proteins in 62 species: Archae - 0; Bacteria - 13; Metazoa - 84; Fungi - 25; Plants - 27; Viruses - 2; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT3G04600 | AT3G04600.1 | TTTTGGGCCA | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink).  |
AT3G04600.2 | TTTTGGGCCA | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink).  | |
AT3G04600.3 | TTTTGGGCCA | tRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink).  | |
AT3G04840 | AT3G04840.1 | AAGGCCCAAAA | 40S ribosomal protein S3A (RPS3aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane, chloroplast; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S3Ae, conserved site (InterPro:IPR018281), Ribosomal protein S3Ae (InterPro:IPR001593); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3A (RPS3aB) (TAIR:AT4G34670.1); Has 943 Blast hits to 938 proteins in 297 species: Archae - 150; Bacteria - 1; Metazoa - 369; Fungi - 110; Plants - 126; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).  |
AT3G05370 | AT3G05370.1 | TGGCCCAAATAAAAAGCCCAAAT | Receptor Like Protein 31 (AtRLP31); FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: AtRLP12 (Receptor Like Protein 12); protein binding (TAIR:AT1G71400.1); Has 71485 Blast hits to 19659 proteins in 809 species: Archae - 36; Bacteria - 3854; Metazoa - 21831; Fungi - 684; Plants - 39507; Viruses - 4; Other Eukaryotes - 5569 (source: NCBI BLink).  |
AT3G05500 | AT3G05500.1 | AACGGCCCAAA | rubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 77 Blast hits to 77 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G06420 | AT3G06420.1 | TGATGGGCCCAAAA | autophagy 8h (ATG8H); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8H (AUTOPHAGY 8H); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase/ microtubule binding (TAIR:AT3G15580.1); Has 1119 Blast hits to 1117 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 577; Fungi - 124; Plants - 171; Viruses - 3; Other Eukaryotes - 244 (source: NCBI BLink).  |
AT3G06570 | AT3G06570.1 | ACAGGCCCAAAA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT5G51250.1); Has 541 Blast hits to 526 proteins in 21 species: Archae - 0; Bacteria - 5; Metazoa - 6; Fungi - 0; Plants - 528; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G07230 | AT3G07230.1 | ATTTGGGCCATA | wound-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Wound-inducible basic (InterPro:IPR012643); Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G07300 | AT3G07300.1 | TTCGGCCCAAAA | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).  |
AT3G07300.1 | TTTTGGGCTTATTTTAGGCCCAAAT | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).  | |
AT3G07300.2 | TTCGGCCCAAAA | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).  | |
AT3G07300.2 | TTTTGGGCTTATTTTAGGCCCAAAT | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).  | |
AT3G07300.3 | TTCGGCCCAAAA | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).  | |
AT3G07300.3 | TTTTGGGCTTATTTTAGGCCCAAAT | eukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).  | |
AT3G07400 | AT3G07400.1 | ATTTGGGCCTAAAGCCCAATAG | lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); Has 274 Blast hits to 273 proteins in 48 species: Archae - 0; Bacteria - 6; Metazoa - 26; Fungi - 34; Plants - 176; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT3G07568 | AT3G07568.1 | TTTTGGGCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G07590 | AT3G07590.1 | TTTTGGGCCCAATAT | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).  |
AT3G08580 | AT3G08580.1 | CAAGGCCCAAAT | mitochondrial ADP/ATP carrier  |
AT3G08580.2 | CAAGGCCCAAAT | mitochondrial ADP/ATP carrier  | |
AT3G10110 | AT3G10110.1 | ACAGGCCCAAAA | maternal effect embryo arrest 67 (MEE67); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: embryonic development ending in seed dormancy, protein transport; LOCATED IN: mitochondrial inner membrane, chloroplast, mitochondrial inner membrane presequence translocase complex; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT1G18320.1); Has 509 Blast hits to 509 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 226; Fungi - 159; Plants - 86; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT3G10270 | AT3G10270.1 | TTTGGGCCGGG | Protein targeting to mitochondria is influenced by UTR sequences.  |
AT3G11200 | AT3G11200.1 | ATTTGGGCCGAT | AL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  |
AT3G11200.1 | ATTTGGGCCTAAA | AL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  | |
AT3G11200.2 | ATTTGGGCCGAT | AL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  | |
AT3G11200.2 | ATTTGGGCCTAAA | AL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.  | |
AT3G11240 | AT3G11240.1 | ATTAGGCCCAAAT | Encodes an arginyl-tRNA:protein arginyltransferase (ATE2), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination.  |
AT3G11250 | AT3G11250.1 | ATTTGGGCCTAAT | 60S acidic ribosomal protein P0 (RPP0C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, translation; LOCATED IN: cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0B) (TAIR:AT3G09200.1); Has 1503 Blast hits to 1500 proteins in 380 species: Archae - 223; Bacteria - 1; Metazoa - 578; Fungi - 277; Plants - 141; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink).  |
AT3G11270 | AT3G11270.1 | AAGGCCCAAAC | maternal effect embryo arrest 34 (MEE34); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: RPN8A (RP NON-ATPASE SUBUNIT 8A) (TAIR:AT5G05780.1); Has 981 Blast hits to 977 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 210; Plants - 166; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT3G11450 | AT3G11450.1 | ATAAGGCCCAAAT | DNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT5G06110.1); Has 51717 Blast hits to 34681 proteins in 2122 species: Archae - 166; Bacteria - 8879; Metazoa - 19405; Fungi - 4515; Plants - 2164; Viruses - 194; Other Eukaryotes - 16394 (source: NCBI BLink).  |
AT3G11800 | AT3G11800.1 | TCAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44150.1); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G11800.1 | TTTTGGGCCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44150.1); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT3G12390 | AT3G12390.1 | TTTTGGGCCTTTT | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA3 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3) (TAIR:AT5G13850.1); Has 5006 Blast hits to 2282 proteins in 284 species: Archae - 50; Bacteria - 639; Metazoa - 1963; Fungi - 710; Plants - 330; Viruses - 56; Other Eukaryotes - 1258 (source: NCBI BLink).  |
AT3G12930 | AT3G12930.1 | AGAGGCCCAAAA | INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Iojap-related protein (InterPro:IPR004394); Has 2517 Blast hits to 2517 proteins in 833 species: Archae - 0; Bacteria - 1551; Metazoa - 22; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink).  |
AT3G13120 | AT3G13120.1 | ATTTGGGCCTAATGGG | 30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink).  |
AT3G13300 | AT3G13300.1 | TTAAAGGCCCAAAC | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development.  |
AT3G13300.2 | TTAAAGGCCCAAAC | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development.  | |
AT3G13410 | AT3G13410.1 | TTTTGGGCCGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G13470 | AT3G13470.1 | ACAGGCCCAAAT | chaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24486 Blast hits to 24452 proteins in 5132 species: Archae - 390; Bacteria - 14009; Metazoa - 1525; Fungi - 954; Plants - 450; Viruses - 2; Other Eukaryotes - 7156 (source: NCBI BLink).  |
AT3G13860 | AT3G13860.1 | TTTTGGGCCAT | HEAT SHOCK PROTEIN 60-3A (HSP60-3A); FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: HSP60 (HEAT SHOCK PROTEIN 60); ATP binding (TAIR:AT3G23990.1); Has 24236 Blast hits to 24217 proteins in 5120 species: Archae - 378; Bacteria - 14012; Metazoa - 1390; Fungi - 947; Plants - 418; Viruses - 2; Other Eukaryotes - 7089 (source: NCBI BLink).  |
AT3G13882 | AT3G13882.1 | AATTGGGCCTGTGGCCCAAAGCCCAT | structural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271).  |
AT3G14010 | AT3G14010.1 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2.  |
AT3G14010.2 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2.  | |
AT3G14010.3 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2.  | |
AT3G14890 | AT3G14890.1 | TTGGCCCAAAC | phosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink).  |
AT3G14890.2 | TTGGCCCAAAC | phosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink).  | |
AT3G15040 | AT3G15040.1 | ATTTGGGCCTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 2804 Blast hits to 412 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 419; Fungi - 51; Plants - 212; Viruses - 0; Other Eukaryotes - 2100 (source: NCBI BLink).  |
AT3G15060 | AT3G15060.1 | GTGGCCCAAAT | Arabidopsis Rab GTPase homolog A1g (AtRABA1g); FUNCTIONS IN: GTP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1f (Arabidopsis Rab GTPase homolog A1f); GTP binding (TAIR:AT5G60860.1); Has 22374 Blast hits to 22336 proteins in 611 species: Archae - 21; Bacteria - 95; Metazoa - 12471; Fungi - 2920; Plants - 1850; Viruses - 19; Other Eukaryotes - 4998 (source: NCBI BLink).  |
AT3G15420 | AT3G15420.1 | TAATGGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G15430 | AT3G15430.1 | TTTTGGGCCCATTA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).  |
AT3G15430.2 | TTTTGGGCCCATTA | regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink).  | |
AT3G15690 | AT3G15690.1 | GGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAAT | biotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink).  |
AT3G15690.2 | GGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAAT | biotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink).  | |
AT3G16480 | AT3G16480.1 | ATTTGGGCCAA | mitochondrial processing peptidase alpha subunit (MPPalpha); FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 4301 Blast hits to 4224 proteins in 886 species: Archae - 10; Bacteria - 2091; Metazoa - 526; Fungi - 394; Plants - 137; Viruses - 3; Other Eukaryotes - 1140 (source: NCBI BLink).  |
AT3G16840 | AT3G16840.1 | AAAAGGCCCAAAT | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink).  |
AT3G18130 | AT3G18130.1 | CCGGCCCAAAT | Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1C has no phenotype on its own and probably acts redundantly with RACK1A and RACK1B.  |
AT3G18740 | AT3G18740.1 | GTTTGGGCCTTG | 60S ribosomal protein L30 (RPL30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L30e (InterPro:IPR000231); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L30 (RPL30B) (TAIR:AT1G77940.1); Has 768 Blast hits to 768 proteins in 281 species: Archae - 141; Bacteria - 3; Metazoa - 274; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).  |
AT3G18940 | AT3G18940.1 | ATCGGCCCAAAT | clast3-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP010044 (InterPro:IPR016562); Has 170 Blast hits to 170 proteins in 73 species: Archae - 1; Bacteria - 0; Metazoa - 98; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT3G20890 | AT3G20890.1 | AAGGCCCAAAC | RNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT5G66010.1); Has 18009 Blast hits to 6834 proteins in 573 species: Archae - 17; Bacteria - 2353; Metazoa - 8618; Fungi - 803; Plants - 4240; Viruses - 179; Other Eukaryotes - 1799 (source: NCBI BLink).  |
AT3G21160 | AT3G21160.1 | ATTTGGGCCTCT | mannosyl-oligosaccharide 1,2-alpha-mannosidase, putative; FUNCTIONS IN: mannosyl-oligosaccharide 1,2-alpha-mannosidase activity, calcium ion binding; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 47 (InterPro:IPR001382); BEST Arabidopsis thaliana protein match is: mannosyl-oligosaccharide 1,2-alpha-mannosidase, putative (TAIR:AT1G51590.1); Has 1485 Blast hits to 1396 proteins in 139 species: Archae - 0; Bacteria - 8; Metazoa - 690; Fungi - 531; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT3G21210 | AT3G21210.1 | ATTAGGCCCAAAT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade, response to stress; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), UspA (InterPro:IPR006016), Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, PHD-type (InterPro:IPR001965), DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT1G34480.1); Has 1530 Blast hits to 740 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 1494; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT3G21350 | AT3G21350.1 | TTTTGGGCCAAT | RNA polymerase transcriptional regulation mediator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit 6, metazoa/plant (InterPro:IPR016820), MED6 mediator (InterPro:IPR007018).  |
AT3G21350.2 | TTTTGGGCCAAT | RNA polymerase transcriptional regulation mediator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mediator complex, subunit 6, metazoa/plant (InterPro:IPR016820), MED6 mediator (InterPro:IPR007018).  | |
AT3G22110 | AT3G22110.1 | ATTTGGGCCTTTT | Encodes the alpha-3 subunit of 20s proteasome.  |
AT3G22110.1 | TTTTGGGCCTAAT | Encodes the alpha-3 subunit of 20s proteasome.  | |
AT3G22150 | AT3G22150.1 | AGAGGCCCAAAC | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink).  |
AT3G22460 | AT3G22460.1 | GGGCCCAAAA | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity.  |
AT3G22590 | AT3G22590.1 | GTTTGGGCCTTTT | RNA pol II accessory factor Cdc73 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase II accessory factor, Cdc73 (InterPro:IPR007852); Has 392 Blast hits to 300 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 87; Plants - 21; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  |
AT3G23325 | AT3G23325.1 | ATTTGGGCCA | splicing factor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor 3B subunit 5/RDS3 complex subunit 10 (InterPro:IPR009846), Splicing factor 3B, subunit 5 (InterPro:IPR017089); BEST Arabidopsis thaliana protein match is: pre-mRNA splicing factor 10 kDa subunit, putative (TAIR:AT4G14342.1); Has 220 Blast hits to 220 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 61; Plants - 31; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT3G23390 | AT3G23390.1 | CTAAGGCCCAAA | 60S ribosomal protein L36a/L44 (RPL36aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aB) (TAIR:AT4G14320.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT3G24515 | AT3G24515.1 | TTTTGGGCCCATAA | ubiquitin-conjugating enzyme 37 (UBC37); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC11 (UBIQUITIN-CONJUGATING ENZYME 11); ubiquitin-protein ligase (TAIR:AT3G08690.1); Has 7488 Blast hits to 7480 proteins in 304 species: Archae - 0; Bacteria - 0; Metazoa - 3738; Fungi - 1409; Plants - 1069; Viruses - 22; Other Eukaryotes - 1250 (source: NCBI BLink).  |
AT3G24860 | AT3G24860.1 | TGTTGGGCCCAAAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT2G44730.1); Has 700 Blast hits to 557 proteins in 131 species: Archae - 0; Bacteria - 29; Metazoa - 100; Fungi - 40; Plants - 346; Viruses - 61; Other Eukaryotes - 124 (source: NCBI BLink).  |
AT3G26560 | AT3G26560.1 | ATCGGCCCAAAT | ATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink).  |
AT3G26650 | AT3G26650.1 | AAAGGCCCAAAA | Encodes one of the two subunits forming the photosynthetic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and as such a constituent of the supramolecular complex with phosphoribulokinase (PRK) thought to be linked by a small peptide encoded by CP12-2. GapA-1 is coordinately expressed by light with PRK and CP12-2. The enzyme activity, tested in leaf protein extracts dropped significantly after external sucrose treatment for the photosynthetic GAPDH (NADPH-dependent) but not for the cytosolic GAPDH (NADH-dependent).  |
AT3G27240 | AT3G27240.1 | TTGGCCCATTAAGGCCCAAAT | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT5G40810.1); Has 2901 Blast hits to 2901 proteins in 507 species: Archae - 0; Bacteria - 704; Metazoa - 170; Fungi - 165; Plants - 63; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink).  |
AT3G28070 | AT3G28070.1 | ATTGGCCCAAA | nodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28080.1); Has 1514 Blast hits to 1505 proteins in 240 species: Archae - 12; Bacteria - 594; Metazoa - 6; Fungi - 2; Plants - 619; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink).  |
AT3G28070.2 | ATTGGCCCAAA | nodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28080.1); Has 1514 Blast hits to 1505 proteins in 240 species: Archae - 12; Bacteria - 594; Metazoa - 6; Fungi - 2; Plants - 619; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink).  | |
AT3G28070.3 | ATTGGCCCAAA | nodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28080.1); Has 1514 Blast hits to 1505 proteins in 240 species: Archae - 12; Bacteria - 594; Metazoa - 6; Fungi - 2; Plants - 619; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink).  | |
AT3G43270 | AT3G43270.1 | TTTTGGGCCGAA | pectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: enzyme inhibitor/ pectinesterase (TAIR:AT4G33220.1); Has 1380 Blast hits to 1337 proteins in 184 species: Archae - 0; Bacteria - 247; Metazoa - 1; Fungi - 134; Plants - 998; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G45740 | AT3G45740.1 | GTTTGGGCCTCTGGGCTAA | hydrolase family protein / HAD-superfamily protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIA, CECR5 (InterPro:IPR006353), HAD-superfamily hydrolase, subfamily IIA (InterPro:IPR006357); Has 367 Blast hits to 355 proteins in 105 species: Archae - 5; Bacteria - 2; Metazoa - 102; Fungi - 197; Plants - 14; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT3G46520 | AT3G46520.1 | CTTAGGCCCAAATGGGCTCA | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development.  |
AT3G46580 | AT3G46580.1 | CTTAATGGGCCCAAAAGCCCAAAA | Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.  |
AT3G47930 | AT3G47930.1 | AAAAGGCCCAAAA | L-Galactono-1,4-lactone dehydrogenase, catalyzes the final step of ascorbate biosynthesis  |
AT3G47930.2 | AAAAGGCCCAAAA | L-Galactono-1,4-lactone dehydrogenase, catalyzes the final step of ascorbate biosynthesis  | |
AT3G48330 | AT3G48330.1 | TTTTGGGCCAA | encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination.  |
AT3G48330.1 | TTTTGGGCCATA | encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination.  | |
AT3G48330.2 | TTTTGGGCCAA | encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination.  | |
AT3G48330.2 | TTTTGGGCCATA | encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination.  | |
AT3G49000 | AT3G49000.1 | GGGCCTGATAGGCCCAAAC | RNA polymerase III subunit RPC82 family protein; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase III subunit RPC82-related, helix-turn-helix (InterPro:IPR013197), RNA polymerase III Rpc82, C -terminal (InterPro:IPR008806); Has 175 Blast hits to 170 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 45; Plants - 23; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT3G49400 | AT3G49400.1 | ATTTGGGCCTATT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower, cultured cell; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 724 Blast hits to 645 proteins in 140 species: Archae - 0; Bacteria - 177; Metazoa - 195; Fungi - 136; Plants - 78; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  |
AT3G50930 | AT3G50930.1 | ATTTGGGCCCT | CYTOCHROME BC1 SYNTHESIS (BCS1); FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT3G50940.1); Has 14639 Blast hits to 13488 proteins in 1548 species: Archae - 792; Bacteria - 3998; Metazoa - 3028; Fungi - 1834; Plants - 1282; Viruses - 24; Other Eukaryotes - 3681 (source: NCBI BLink).  |
AT3G50930.1 | ATTTGGGCCTTAT | CYTOCHROME BC1 SYNTHESIS (BCS1); FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT3G50940.1); Has 14639 Blast hits to 13488 proteins in 1548 species: Archae - 792; Bacteria - 3998; Metazoa - 3028; Fungi - 1834; Plants - 1282; Viruses - 24; Other Eukaryotes - 3681 (source: NCBI BLink).  | |
AT3G52150 | AT3G52150.1 | CTAGGCCCAAATTATAGGCCTTAATAAGGCCCAATTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 25844 Blast hits to 15833 proteins in 627 species: Archae - 20; Bacteria - 2067; Metazoa - 14187; Fungi - 2805; Plants - 3913; Viruses - 0; Other Eukaryotes - 2852 (source: NCBI BLink).  |
AT3G52150.2 | CTAGGCCCAAATTATAGGCCTTAATAAGGCCCAATTA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 25844 Blast hits to 15833 proteins in 627 species: Archae - 20; Bacteria - 2067; Metazoa - 14187; Fungi - 2805; Plants - 3913; Viruses - 0; Other Eukaryotes - 2852 (source: NCBI BLink).  | |
AT3G52340 | AT3G52340.1 | ACGGCCCAAAA | sucrose-phosphatase (SPP2)  |
AT3G52340.2 | ACGGCCCAAAA | sucrose-phosphatase (SPP2)  | |
AT3G52340.3 | ACGGCCCAAAA | sucrose-phosphatase (SPP2)  | |
AT3G52730 | AT3G52730.1 | TGAGGCCCAAAT | ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G52730.1 | TTTTGGGCCTGA | ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT3G52930 | AT3G52930.1 | TCTGACGGTTTGGGCCGT | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, response to salt stress, pentose-phosphate shunt; LOCATED IN: in 7 components; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4403 Blast hits to 4398 proteins in 740 species: Archae - 0; Bacteria - 427; Metazoa - 1257; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2378 (source: NCBI BLink).  |
AT3G53120 | AT3G53120.1 | ATTTGGGCCTTTT | VPS37-1; LOCATED IN: ESCRT I complex; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36680.1); Has 356 Blast hits to 356 proteins in 75 species: Archae - 0; Bacteria - 4; Metazoa - 251; Fungi - 14; Plants - 42; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
AT3G53710 | AT3G53710.1 | ATTTGGGCCAT | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  |
AT3G53710.1 | TGAGGCCCAAAC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  | |
AT3G53710.2 | ATTTGGGCCAT | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  | |
AT3G53710.2 | TGAGGCCCAAAC | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  | |
AT3G53800 | AT3G53800.1 | ATTTGGGCCATA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 461 Blast hits to 458 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 134; Plants - 93; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
AT3G53800.1 | ATTTGGGCCATA | armadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 461 Blast hits to 458 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 134; Plants - 93; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  | |
AT3G53970 | AT3G53970.1 | GTAGGCCCAAAT | proteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink).  |
AT3G53970.2 | GTAGGCCCAAAT | proteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink).  | |
AT3G54540 | AT3G54540.1 | AAAAGGCCCAAAT | member of GCN subfamily  |
AT3G55030 | AT3G55030.1 | AAGGCCCAAAA | Encodes a phosphatidylglycerolphosphate synthase.  |
AT3G55200 | AT3G55200.1 | TTTTGGGCCGG | splicing factor, putative; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage and polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: splicing factor, putative (TAIR:AT3G55220.1); Has 768 Blast hits to 695 proteins in 165 species: Archae - 0; Bacteria - 2; Metazoa - 341; Fungi - 160; Plants - 119; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT3G55280 | AT3G55280.1 | TTAAGGCCCAAAA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA  |
AT3G55280.2 | TTAAGGCCCAAAA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA  | |
AT3G55280.3 | TTAAGGCCCAAAA | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA  | |
AT3G55620 | AT3G55620.1 | TAGGGCCCAAAC | embryo defective 1624 (emb1624); FUNCTIONS IN: ribosome binding, translation initiation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational initiation; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor IF6 (InterPro:IPR002769); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 6, putative / eIF-6, putative (TAIR:AT2G39820.1); Has 595 Blast hits to 595 proteins in 239 species: Archae - 161; Bacteria - 0; Metazoa - 147; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  |
AT3G55750 | AT3G55750.1 | ATTTGGGCCAA | 60S ribosomal protein L35a (RPL35aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aB) (TAIR:AT1G41880.1); Has 539 Blast hits to 539 proteins in 185 species: Archae - 19; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT3G55750.1 | GTTTGGGCCAA | 60S ribosomal protein L35a (RPL35aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aB) (TAIR:AT1G41880.1); Has 539 Blast hits to 539 proteins in 185 species: Archae - 19; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  | |
AT3G56110 | AT3G56110.1 | TTTTGGGCCG | PRENYLATED RAB ACCEPTOR 1.B1 (PRA1.B1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B2 (PRENYLATED RAB ACCEPTOR 1.B2) (TAIR:AT2G40380.1); Has 388 Blast hits to 388 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 73; Plants - 185; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT3G56120 | AT3G56120.1 | TTAAACCGGCCCAAAA | Met-10+ like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT4G27340.1); Has 933 Blast hits to 801 proteins in 255 species: Archae - 252; Bacteria - 75; Metazoa - 244; Fungi - 94; Plants - 62; Viruses - 0; Other Eukaryotes - 206 (source: NCBI BLink).  |
AT3G56270 | AT3G56270.1 | AACGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40480.1); Has 136 Blast hits to 136 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT3G56340 | AT3G56340.1 | TCAGGCCCAAAT | 40S ribosomal protein S26 (RPS26C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26A) (TAIR:AT2G40510.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT3G57220 | AT3G57220.1 | TTTTGGGCCTTTT | UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase, putative; FUNCTIONS IN: UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity; INVOLVED IN: polysaccharide biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 4, conserved region (InterPro:IPR018481); BEST Arabidopsis thaliana protein match is: GPT (UDP-GLCNAC%3ADOLICHOL+PHOSPHATE+GLCNAC-1-P+TRANSFERASE); UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase (TAIR:AT2G41490.1); Has 4108 Blast hits to 4107 proteins in 1267 species: Archae - 90; Bacteria - 2863; Metazoa - 110; Fungi - 83; Plants - 32; Viruses - 0; Other Eukaryotes - 930 (source: NCBI BLink).  |
AT3G58130 | AT3G58130.1 | TTTGGGCCGTAGTTGGGCCTAAA | N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl phosphatidylinositol deacetylase (InterPro:IPR003737); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27340.4); Has 346 Blast hits to 344 proteins in 163 species: Archae - 0; Bacteria - 54; Metazoa - 92; Fungi - 109; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT3G58130.2 | TTTGGGCCGTAGTTGGGCCTAAA | N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: N-acetylglucosaminyl phosphatidylinositol deacetylase (InterPro:IPR003737); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27340.4); Has 346 Blast hits to 344 proteins in 163 species: Archae - 0; Bacteria - 54; Metazoa - 92; Fungi - 109; Plants - 28; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  | |
AT3G58680 | AT3G58680.1 | ATTTGGGCCAA | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated.  |
AT3G58690 | AT3G58690.1 | TTTTGGGCCTGG | protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G54820.1); Has 86522 Blast hits to 85517 proteins in 2739 species: Archae - 60; Bacteria - 8012; Metazoa - 37169; Fungi - 6786; Plants - 19292; Viruses - 369; Other Eukaryotes - 14834 (source: NCBI BLink).  |
AT3G62560 | AT3G62560.1 | CAAGGCCCAAA | GTP-binding protein, putative; FUNCTIONS IN: GTP binding; INVOLVED IN: intracellular protein transport; LOCATED IN: endomembrane system, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), GTP-binding protein SAR1 (InterPro:IPR006687), ARF/SAR superfamily (InterPro:IPR006689); BEST Arabidopsis thaliana protein match is: ATSAR2 (ARABIDOPSIS THALIANA SECRETION-ASSOCIATED RAS SUPER FAMILY 2); GTP binding (TAIR:AT4G02080.1); Has 5231 Blast hits to 5228 proteins in 291 species: Archae - 2; Bacteria - 39; Metazoa - 2741; Fungi - 852; Plants - 681; Viruses - 0; Other Eukaryotes - 916 (source: NCBI BLink).  |
AT3G63030 | AT3G63030.1 | TTAAGGCCCAAAA | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.  |
AT3G63140 | AT3G63140.1 | ATTTGGGCCAAT | Encodes a protein with ribonuclease activity that is involved in plastid rRNA maturation.  |
AT3G63160 | AT3G63160.1 | TCAGCCCATATTAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G63340 | AT3G63340.1 | AAAAGGCCCAAAA | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT3G63320.1); Has 3271 Blast hits to 3269 proteins in 215 species: Archae - 0; Bacteria - 0; Metazoa - 1075; Fungi - 380; Plants - 1004; Viruses - 5; Other Eukaryotes - 807 (source: NCBI BLink).  |
AT3G63410 | AT3G63410.1 | ATTTGGGCCAAT | Encodes a MPBQ/MSBQ methyltransferase located in the chloroplast inner envelope membrane. Mutant plants lack plastoquinone (PQ), suggesting that the APG1 protein is involved in the methylation step of PQ biosynthesis. The gene product is also involved in tocopherol (vitamin E) biosynthesis.  |
AT3G63460 | AT3G63460.1 | CAAGGCCCAAAT | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink).  |
AT3G63460.2 | CAAGGCCCAAAT | WD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink).  | |
AT3G63520 | AT3G63520.1 | GTTTGGGCCGG | Encodes a protein with 9-<i>cis</i>-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-<i>trans</i>-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-<i>cis</i>-double or allenic bonds.  |
AT4G00020 | AT4G00020.1 | TTCGGCCCAAAT | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development.  |
AT4G00020.2 | TTCGGCCCAAAT | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development.  | |
AT4G00290 | AT4G00290.1 | ATTAGGCCCAAAAGGCCCAGA | mechanosensitive ion channel domain-containing protein / MS ion channel domain-containing protein; LOCATED IN: chloroplast, membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mechanosensitive ion channel MscS, transmembrane-2 (InterPro:IPR011014), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00234.1); Has 8044 Blast hits to 8044 proteins in 1230 species: Archae - 282; Bacteria - 5483; Metazoa - 2; Fungi - 2; Plants - 99; Viruses - 0; Other Eukaryotes - 2176 (source: NCBI BLink).  |
AT4G00530 | AT4G00530.1 | AGATGGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G00585 | AT4G00585.1 | AAGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 29 Blast hits to 29 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 6; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT4G00590 | AT4G00590.1 | TTTTGGGCCTT | asparaginase 2 family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase T2, asparaginase 2 (InterPro:IPR000246); BEST Arabidopsis thaliana protein match is: L-asparaginase, putative / L-asparagine amidohydrolase, putative (TAIR:AT3G16150.1); Has 2162 Blast hits to 2119 proteins in 522 species: Archae - 71; Bacteria - 869; Metazoa - 420; Fungi - 151; Plants - 90; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink).  |
AT4G00740 | AT4G00740.1 | CAAGGCCCAAAT | dehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive family protein (TAIR:AT4G10440.1); Has 538 Blast hits to 531 proteins in 57 species: Archae - 2; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 461; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G00890 | AT4G00890.1 | ATGGCCCAAA | Encodes a putative glycosyl hydrolase family 10 protein (xylanase).  |
AT4G01690 | AT4G01690.1 | ATTTGGGCCTAAC | Encodes protoporphyrinogen oxidase (PPOX).  |
AT4G01690.2 | ATTTGGGCCTAAC | Encodes protoporphyrinogen oxidase (PPOX).  | |
AT4G01790 | AT4G01790.1 | TTTTGGGCCTTTT | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein / ribonuclease P-related; FUNCTIONS IN: ribonuclease P activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); Has 68 Blast hits to 68 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G02195 | AT4G02195.1 | TAAATGGGCCTAAAAAGGCCCAAAT | member of SYP4 Gene Family  |
AT4G02210 | AT4G02210.1 | TGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G03260 | AT4G03260.1 | ATTAGGCCCAAAA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink).  |
AT4G03260.2 | ATTAGGCCCAAAA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink).  | |
AT4G03490 | AT4G03490.1 | AAAAGGCCCAAAT | protein binding; FUNCTIONS IN: protein binding; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G03500.1); Has 19395 Blast hits to 9360 proteins in 384 species: Archae - 23; Bacteria - 1025; Metazoa - 12359; Fungi - 1194; Plants - 1122; Viruses - 91; Other Eukaryotes - 3581 (source: NCBI BLink).  |
AT4G03490.1 | AGGGCCCAAAA | protein binding; FUNCTIONS IN: protein binding; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G03500.1); Has 19395 Blast hits to 9360 proteins in 384 species: Archae - 23; Bacteria - 1025; Metazoa - 12359; Fungi - 1194; Plants - 1122; Viruses - 91; Other Eukaryotes - 3581 (source: NCBI BLink).  | |
AT4G05460 | AT4G05460.1 | TTGGCCCAAAC | F-box family protein (FBL20); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL22) (TAIR:AT4G05490.1); Has 1604 Blast hits to 1357 proteins in 102 species: Archae - 0; Bacteria - 79; Metazoa - 945; Fungi - 61; Plants - 449; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT4G08280 | AT4G08280.1 | TAAAGGCCCAAAAGCCCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin 2 (InterPro:IPR008554), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); Has 214 Blast hits to 214 proteins in 65 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT4G08310 | AT4G08310.1 | TAGGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink).  |
AT4G09900 | AT4G09900.1 | GTGGGCCTGGGCTTTGGGCCTG | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro.  |
AT4G12620 | AT4G12620.1 | ATAAGCCCAATATTCGGCCCAAA | Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime.  |
AT4G12620.1 | ATCGGCCCAAAA | Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime.  | |
AT4G12640 | AT4G12640.1 | TTTGGGCCGAATATTGGGCTTAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 6679 Blast hits to 5578 proteins in 311 species: Archae - 8; Bacteria - 143; Metazoa - 3956; Fungi - 1074; Plants - 834; Viruses - 0; Other Eukaryotes - 664 (source: NCBI BLink).  |
AT4G12640.1 | TTTTGGGCCGAT | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 6679 Blast hits to 5578 proteins in 311 species: Archae - 8; Bacteria - 143; Metazoa - 3956; Fungi - 1074; Plants - 834; Viruses - 0; Other Eukaryotes - 664 (source: NCBI BLink).  | |
AT4G14230 | AT4G14230.1 | TAGGGCCCAAGGCCCAAAC | CBS domain-containing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14240.1); Has 6669 Blast hits to 6527 proteins in 1353 species: Archae - 64; Bacteria - 4331; Metazoa - 264; Fungi - 186; Plants - 121; Viruses - 0; Other Eukaryotes - 1703 (source: NCBI BLink).  |
AT4G14540 | AT4G14540.1 | TTGGCCCAAAT | NUCLEAR FACTOR Y, SUBUNIT B3 (NF-YB3); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB2 (NUCLEAR FACTOR Y, SUBUNIT B2); transcription factor (TAIR:AT5G47640.1); Has 1011 Blast hits to 1011 proteins in 186 species: Archae - 0; Bacteria - 1; Metazoa - 394; Fungi - 233; Plants - 298; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).  |
AT4G14615 | AT4G14615.1 | TGAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52825.1); Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G15410 | AT4G15410.1 | TTTGGGCCCATTAA | Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma (PUX5); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBX (InterPro:IPR001012), SEP (InterPro:IPR012989), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: PUX4; protein binding (TAIR:AT4G04210.1); Has 2169 Blast hits to 897 proteins in 184 species: Archae - 0; Bacteria - 87; Metazoa - 456; Fungi - 202; Plants - 88; Viruses - 16; Other Eukaryotes - 1320 (source: NCBI BLink).  |
AT4G16390 | AT4G16390.1 | ATTTGGGCCGG | LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Smr protein/MutS2 C-terminal (InterPro:IPR002625); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46580.1); Has 19821 Blast hits to 5782 proteins in 183 species: Archae - 2; Bacteria - 24; Metazoa - 276; Fungi - 350; Plants - 18437; Viruses - 0; Other Eukaryotes - 732 (source: NCBI BLink).  |
AT4G16500 | AT4G16500.1 | ATTGGCCCAAAT | cysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G16770 | AT4G16770.1 | GGGCCCAAA | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G16765.2); Has 6031 Blast hits to 6015 proteins in 680 species: Archae - 0; Bacteria - 734; Metazoa - 132; Fungi - 691; Plants - 2939; Viruses - 0; Other Eukaryotes - 1535 (source: NCBI BLink).  |
AT4G17560 | AT4G17560.1 | TGGGCCCAAAT | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink).  |
AT4G18040 | AT4G18040.1 | TTCGGCCCAAAA | eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein.  |
AT4G18570 | AT4G18570.1 | CAAAGGCCCAAAC | proline-rich family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: CHUP1 (CHLOROPLAST UNUSUAL POSITIONING 1) (TAIR:AT3G25690.1); Has 38999 Blast hits to 20613 proteins in 981 species: Archae - 88; Bacteria - 4167; Metazoa - 15425; Fungi - 4272; Plants - 8442; Viruses - 1480; Other Eukaryotes - 5125 (source: NCBI BLink).  |
AT4G19130 | AT4G19130.1 | TTTTGGGCCTT | DNA binding / nucleic acid binding / zinc ion binding; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Replication factor-A, C-terminal (InterPro:IPR013955), Replication factor-a protein 1 Rpa1 (InterPro:IPR004591), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Zinc finger, CCHC-type (InterPro:IPR001878), Replication factor-A protein 1, N-terminal (InterPro:IPR007199); BEST Arabidopsis thaliana protein match is: replication protein, putative (TAIR:AT5G45400.1); Has 609 Blast hits to 584 proteins in 169 species: Archae - 16; Bacteria - 0; Metazoa - 189; Fungi - 98; Plants - 176; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).  |
AT4G19140 | AT4G19140.1 | AAGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G20010 | AT4G20010.1 | TGAGGCCCATACAAGGCCCAAA | PLASTID TRANSCRIPTIONALLY ACTIVE 9 (PTAC9); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: OSB3 (ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3); single-stranded DNA binding (TAIR:AT5G44785.1); Has 116 Blast hits to 66 proteins in 12 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G20010.2 | TGAGGCCCATACAAGGCCCAAA | PLASTID TRANSCRIPTIONALLY ACTIVE 9 (PTAC9); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: OSB3 (ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3); single-stranded DNA binding (TAIR:AT5G44785.1); Has 116 Blast hits to 66 proteins in 12 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G20440 | AT4G20440.1 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  |
AT4G20440.2 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.3 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.4 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G21280 | AT4G21280.1 | TTCGGCCCAAAT | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.  |
AT4G21280.1 | TTTGGGCCTAC | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.  | |
AT4G21280.2 | TTCGGCCCAAAT | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.  | |
AT4G21280.2 | TTTGGGCCTAC | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.  | |
AT4G21860 | AT4G21860.1 | ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAAT | methionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink).  |
AT4G21860.2 | ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAAT | methionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink).  | |
AT4G23660 | AT4G23660.1 | TTCGGCCCAAAT | Encodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50).  |
AT4G23660.2 | TTCGGCCCAAAT | Encodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50).  | |
AT4G24550 | AT4G24550.1 | ATTTGGGCCATA | clathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT5G46630.1); Has 1549 Blast hits to 1524 proteins in 208 species: Archae - 0; Bacteria - 0; Metazoa - 875; Fungi - 294; Plants - 96; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink).  |
AT4G24550.2 | ATTTGGGCCATA | clathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT5G46630.1); Has 1549 Blast hits to 1524 proteins in 208 species: Archae - 0; Bacteria - 0; Metazoa - 875; Fungi - 294; Plants - 96; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink).  | |
AT4G24750 | AT4G24750.1 | CTTAGGCCCAAAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT3G08920.1); Has 222 Blast hits to 222 proteins in 59 species: Archae - 8; Bacteria - 82; Metazoa - 0; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).  |
AT4G25130 | AT4G25130.1 | GTTTGGGCCTT | peptide methionine sulfoxide reductase, putative; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity, oxidoreductase activity, acting on sulfur group of donors, disulfide as acceptor; INVOLVED IN: protein modification process, protein metabolic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase A (InterPro:IPR002569); BEST Arabidopsis thaliana protein match is: PMSR1 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE 1); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / peptide-methionine-(S)-S-oxide reductase (TAIR:AT5G61640.1); Has 7185 Blast hits to 7183 proteins in 1356 species: Archae - 86; Bacteria - 3332; Metazoa - 164; Fungi - 91; Plants - 129; Viruses - 1; Other Eukaryotes - 3382 (source: NCBI BLink).  |
AT4G25140 | AT4G25140.1 | AAGGCCCAAAC | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds.  |
AT4G25340 | AT4G25340.1 | TTAAGGCCCAAAC | immunophilin-related / FKBP-type peptidyl-prolyl cis-trans isomerase-related; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT5G05420.1); Has 31917 Blast hits to 22495 proteins in 1589 species: Archae - 95; Bacteria - 4690; Metazoa - 11105; Fungi - 3414; Plants - 1586; Viruses - 220; Other Eukaryotes - 10807 (source: NCBI BLink).  |
AT4G26210 | AT4G26210.1 | ATTTGGGCCTC | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G26210.2 | ATTTGGGCCTC | mitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT4G27090 | AT4G27090.1 | ATAGGCCCAAAC | 60S ribosomal protein L14 (RPL14B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14A) (TAIR:AT2G20450.1); Has 520 Blast hits to 520 proteins in 229 species: Archae - 47; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT4G27230 | AT4G27230.1 | TTTTGGGCCA | Encodes HTA2, a histone H2A protein.  |
AT4G27800 | AT4G27800.1 | ATTTGGGCCTAAGCCCAAAA | protein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink).  |
AT4G27800.2 | ATTTGGGCCTAAGCCCAAAA | protein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink).  | |
AT4G27800.3 | ATTTGGGCCTAAGCCCAAAA | protein phosphatase 2C PPH1 / PP2C PPH1 (PPH1); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: nucleolus, nucleus, chloroplast, protein serine/threonine phosphatase complex, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT1G43900.1); Has 3934 Blast hits to 3925 proteins in 294 species: Archae - 1; Bacteria - 130; Metazoa - 1167; Fungi - 465; Plants - 1291; Viruses - 9; Other Eukaryotes - 871 (source: NCBI BLink).  | |
AT4G27840 | AT4G27840.1 | GTTTGGGCCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G28030 | AT4G28030.1 | TATGGGCTCATATTGGGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).  |
AT4G28030.2 | TATGGGCTCATATTGGGCCCAAAT | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).  | |
AT4G28360 | AT4G28360.1 | TAACGGGCTCGGCCCAAAT | ribosomal protein L22 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22, bacterial-type (InterPro:IPR005727); BEST Arabidopsis thaliana protein match is: ribosomal protein L22 family protein (TAIR:AT1G52370.3); Has 5503 Blast hits to 5503 proteins in 1687 species: Archae - 0; Bacteria - 3089; Metazoa - 109; Fungi - 48; Plants - 431; Viruses - 0; Other Eukaryotes - 1826 (source: NCBI BLink).  |
AT4G28450 | AT4G28450.1 | TTTTGGGCCAAT | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  |
AT4G28540 | AT4G28540.1 | GTTTGGGCCGAT | CASEIN KINASE I-LIKE 6 (CKL6); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasmodesma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ADK1 (dual specificity kinase 1); kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT1G03930.1); Has 46100 Blast hits to 45721 proteins in 1424 species: Archae - 12; Bacteria - 5612; Metazoa - 19980; Fungi - 4668; Plants - 5911; Viruses - 338; Other Eukaryotes - 9579 (source: NCBI BLink).  |
AT4G28610 | AT4G28610.1 | TTTGGGCCTTTA | Similar to phosphate starvation response gene from Chlamydomonas. Weakly responsive to phosphate starvation. Acts upstream of PHO2 in phosphate signaling.  |
AT4G28880 | AT4G28880.1 | AGGGCCCAAAA | Casein Kinase I-like 3 (ckl3); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl4 (Casein Kinase I-like 4); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28860.1); Has 47686 Blast hits to 47386 proteins in 1403 species: Archae - 19; Bacteria - 6033; Metazoa - 20862; Fungi - 4890; Plants - 5655; Viruses - 307; Other Eukaryotes - 9920 (source: NCBI BLink).  |
AT4G29040 | AT4G29040.1 | GTTTGGGCCTAAT | 26S proteasome AAA-ATPase subunit RPT2a (RPT2a) mRNA,  |
AT4G29735 | AT4G29735.1 | ATTTGGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0197 (InterPro:IPR007915).  |
AT4G29735.2 | ATTTGGGCCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0197 (InterPro:IPR007915).  | |
AT4G29770 | AT4G29770.1 | GTGGCCCAAAA | Target of trans acting-siR480/255.  |
AT4G29840 | AT4G29840.1 | TTAATGGGCCCAAAA | threonine synthase  |
AT4G29910 | AT4G29910.1 | ATTTGGGCCTAAA | Origin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits.  |
AT4G30750 | AT4G30750.1 | CTTGGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30760 | AT4G30760.1 | TTTTGGGCCCAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30760.2 | TTTTGGGCCCAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G31270 | AT4G31270.1 | GTTTGGGCCAT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: gt-2-related (TAIR:AT2G33550.1); Has 142 Blast hits to 141 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 1; Plants - 121; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT4G31270.1 | GTTTGGGCCGAA | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: gt-2-related (TAIR:AT2G33550.1); Has 142 Blast hits to 141 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 1; Plants - 121; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT4G31270.1 | GTTTGGGCCTGT | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: gt-2-related (TAIR:AT2G33550.1); Has 142 Blast hits to 141 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 1; Plants - 121; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT4G31460 | AT4G31460.1 | ATTTGGGCCTAAG | ribosomal protein L28 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28 (InterPro:IPR001383); Has 797 Blast hits to 797 proteins in 221 species: Archae - 0; Bacteria - 262; Metazoa - 81; Fungi - 82; Plants - 19; Viruses - 0; Other Eukaryotes - 353 (source: NCBI BLink).  |
AT4G31490 | AT4G31490.1 | ATTTGGGCCTG | coatomer beta subunit, putative / beta-coat protein, putative / beta-COP, putative; FUNCTIONS IN: protein binding, clathrin binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Coatomer, beta subunit, C-terminal (InterPro:IPR011710), Armadillo-like helical (InterPro:IPR011989), Coatomer, beta subunit (InterPro:IPR016460), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: coatomer beta subunit, putative / beta-coat protein, putative / beta-COP, putative (TAIR:AT4G31480.1); Has 2132 Blast hits to 2068 proteins in 250 species: Archae - 0; Bacteria - 0; Metazoa - 1042; Fungi - 407; Plants - 225; Viruses - 0; Other Eukaryotes - 458 (source: NCBI BLink).  |
AT4G31580 | AT4G31580.1 | TAAGCCCAATAAATAGGCCCAAAT | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K.  |
AT4G31580.2 | TAAGCCCAATAAATAGGCCCAAAT | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K.  | |
AT4G31600 | AT4G31600.1 | TTTGGGCCTTTTGGGCCTTAC | UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32272.1); Has 1648 Blast hits to 1639 proteins in 227 species: Archae - 10; Bacteria - 72; Metazoa - 464; Fungi - 365; Plants - 570; Viruses - 0; Other Eukaryotes - 167 (source: NCBI BLink).  |
AT4G31600.2 | TTTGGGCCTTTTGGGCCTTAC | UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32272.1); Has 1648 Blast hits to 1639 proteins in 227 species: Archae - 10; Bacteria - 72; Metazoa - 464; Fungi - 365; Plants - 570; Viruses - 0; Other Eukaryotes - 167 (source: NCBI BLink).  | |
AT4G31670 | AT4G31670.1 | AAAGGCCCAAAC | UBIQUITIN-SPECIFIC PROTEASE 18 (UBP18); FUNCTIONS IN: cysteine-type endopeptidase activity, ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, MYND-type (InterPro:IPR002893), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (InterPro:IPR018200), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: UBP19 (UBIQUITIN-SPECIFIC PROTEASE 19); cysteine-type endopeptidase/ ubiquitin thiolesterase (TAIR:AT2G24640.1); Has 7197 Blast hits to 6335 proteins in 233 species: Archae - 2; Bacteria - 369; Metazoa - 3811; Fungi - 995; Plants - 557; Viruses - 7; Other Eukaryotes - 1456 (source: NCBI BLink).  |
AT4G31770 | AT4G31770.1 | TAGTGGGCTTTTGGGCCTAAC | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  |
AT4G32050 | AT4G32050.1 | TTGGCCCAAAA | neurochondrin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Neurochondrin (InterPro:IPR008709); Has 126 Blast hits to 126 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 5; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G32470 | AT4G32470.1 | AGATGGGCCACTTAAGGCCCAAAT | ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G32470.1 | TTAAGGCCCAAAT | ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  | |
AT4G32470.2 | AGATGGGCCACTTAAGGCCCAAAT | ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  | |
AT4G32470.2 | TTAAGGCCCAAAT | ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  | |
AT4G32660 | AT4G32660.1 | ATTTGGGCCAA | Encodes protein kinase AME3.  |
AT4G32660.1 | ATTTGGGCCGGG | Encodes protein kinase AME3.  | |
AT4G32660.2 | ATTTGGGCCAA | Encodes protein kinase AME3.  | |
AT4G32660.2 | ATTTGGGCCGGG | Encodes protein kinase AME3.  | |
AT4G32660.3 | ATTTGGGCCAA | Encodes protein kinase AME3.  | |
AT4G32660.3 | ATTTGGGCCGGG | Encodes protein kinase AME3.  | |
AT4G32710 | AT4G32710.1 | TTTGGGCCA | ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATPERK1 (PROLINE EXTENSIN-LIKE RECEPTOR KINASE 1); ATP binding / protein kinase (TAIR:AT3G24550.1); Has 87667 Blast hits to 86649 proteins in 3166 species: Archae - 53; Bacteria - 7959; Metazoa - 38002; Fungi - 7110; Plants - 19079; Viruses - 374; Other Eukaryotes - 15090 (source: NCBI BLink).  |
AT4G33030 | AT4G33030.1 | ATTTGGGCCAACCGGCCCAGTA | involved in sulfolipid biosynthesis  |
AT4G33030.1 | TTTGGGCCATA | involved in sulfolipid biosynthesis  | |
AT4G33920 | AT4G33920.1 | GTTTGGGCCAA | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3521 Blast hits to 3519 proteins in 216 species: Archae - 0; Bacteria - 7; Metazoa - 1157; Fungi - 386; Plants - 1254; Viruses - 3; Other Eukaryotes - 714 (source: NCBI BLink).  |
AT4G34090 | AT4G34090.1 | GTTTGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT4G34090.2 | GTTTGGGCCTTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT4G34100 | AT4G34100.1 | TTAAGGCCCAAAC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink).  |
AT4G34100.2 | TTAAGGCCCAAAC | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink).  | |
AT4G34710 | AT4G34710.1 | ATGGCCCAAAT | encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1.  |
AT4G34710.2 | ATGGCCCAAAT | encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1.  | |
AT4G34720 | AT4G34720.1 | TTTAGGCCCAAAC | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1)  |
AT4G35220 | AT4G35220.1 | ATTTGGGCCTATA | cyclase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Putative cyclase (InterPro:IPR007325); BEST Arabidopsis thaliana protein match is: cyclase family protein (TAIR:AT4G34180.1); Has 778 Blast hits to 778 proteins in 304 species: Archae - 55; Bacteria - 578; Metazoa - 30; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  |
AT4G35490 | AT4G35490.1 | ATAAGGCCCAAAT | MITOCHONDRIAL RIBOSOMAL PROTEIN L11 (MRPL11); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11, bacterial-type (InterPro:IPR006519), Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: PRPL11 (PLASTID RIBOSOMAL PROTEIN L11); structural constituent of ribosome (TAIR:AT1G32990.1); Has 5744 Blast hits to 5744 proteins in 1575 species: Archae - 191; Bacteria - 2960; Metazoa - 99; Fungi - 83; Plants - 65; Viruses - 0; Other Eukaryotes - 2346 (source: NCBI BLink).  |
AT4G35580 | AT4G35580.1 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G35580.2 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G35760 | AT4G35760.1 | ATTTGGGCCTC | LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vitamin K epoxide reductase (InterPro:IPR012932), Thioredoxin-like fold (InterPro:IPR012336); Has 447 Blast hits to 447 proteins in 86 species: Archae - 0; Bacteria - 179; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
AT4G36660 | AT4G36660.1 | ATGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65650.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G36750 | AT4G36750.1 | CTAGGCCCAAAT | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: FQR1 (FLAVODOXIN-LIKE QUINONE REDUCTASE 1); FMN binding / oxidoreductase, acting on NADH or NADPH, quinone or similar compound as acceptor (TAIR:AT5G54500.1); Has 2178 Blast hits to 2176 proteins in 677 species: Archae - 37; Bacteria - 1574; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 267 (source: NCBI BLink).  |
AT4G38170 | AT4G38170.1 | AGGGCCCAAAA | FAR1-related sequence 9 (FRS9); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PMZ-type (InterPro:IPR006564), MULE transposase, conserved domain (InterPro:IPR018289), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS5 (FAR1-related sequence 5); zinc ion binding (TAIR:AT4G38180.1); Has 575 Blast hits to 561 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 571; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G01290 | AT5G01290.1 | CAAAGGCCCAAAC | mRNA guanylyltransferase/ phosphatase/ polynucleotide 5'-phosphatase/ protein tyrosine phosphatase/ protein tyrosine/serine/threonine phosphatase; FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, protein tyrosine/serine/threonine phosphatase activity, mRNA guanylyltransferase activity, polynucleotide 5'-phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, mRNA processing, mRNA capping, dephosphorylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Protein-tyrosine phosphatase (InterPro:IPR000387), mRNA capping enzyme (InterPro:IPR001339), mRNA capping enzyme, bifunctional (InterPro:IPR017074), Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340), mRNA capping enzyme, C-terminal (InterPro:IPR013846); BEST Arabidopsis thaliana protein match is: mRNA capping enzyme family protein (TAIR:AT3G09100.2); Has 687 Blast hits to 666 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 240; Fungi - 154; Plants - 41; Viruses - 65; Other Eukaryotes - 187 (source: NCBI BLink).  |
AT5G01340 | AT5G01340.1 | AGAGGCCCAAAT | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G37890.1); Has 17641 Blast hits to 9745 proteins in 355 species: Archae - 0; Bacteria - 0; Metazoa - 9246; Fungi - 4407; Plants - 2419; Viruses - 0; Other Eukaryotes - 1569 (source: NCBI BLink).  |
AT5G02100 | AT5G02100.1 | TTTTGGGCCGTT | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent.  |
AT5G02150 | AT5G02150.1 | ATAAGGCCCAAAC | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  |
AT5G02150.2 | ATAAGGCCCAAAC | binding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 416 Blast hits to 414 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 103; Plants - 93; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  | |
AT5G02160 | AT5G02160.1 | GTTTGGGCCTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G02240 | AT5G02240.1 | GGCTGGGCCCAAAA | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.  |
AT5G02370 | AT5G02370.1 | TAAATGGGCCCAAAAAAGGCC | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink).  |
AT5G02450 | AT5G02450.1 | ATAAGGCCCAAAA | 60S ribosomal protein L36 (RPL36C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
AT5G02450.1 | GTTTGGGCCCAACA | 60S ribosomal protein L36 (RPL36C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  | |
AT5G02770 | AT5G02770.1 | ATTTGGGCCGGGCTATT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 367 Blast hits to 255 proteins in 95 species: Archae - 0; Bacteria - 48; Metazoa - 197; Fungi - 19; Plants - 22; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink).  |
AT5G03160 | AT5G03160.1 | TTTTGGGCCCATCA | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast.  |
AT5G03430 | AT5G03430.1 | TTTTGGGCCTTAG | phosphoadenosine phosphosulfate (PAPS) reductase family protein; FUNCTIONS IN: transferase activity; INVOLVED IN: Mo-molybdopterin cofactor biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Molybdopterin binding (InterPro:IPR001453), Phosphoadenosine phosphosulphate reductase (InterPro:IPR002500); Has 3440 Blast hits to 3362 proteins in 916 species: Archae - 114; Bacteria - 1592; Metazoa - 215; Fungi - 195; Plants - 24; Viruses - 0; Other Eukaryotes - 1300 (source: NCBI BLink).  |
AT5G03880 | AT5G03880.1 | TTAAGGCCCAAAAGTAAGGCCCATTAAG | electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae - 48; Bacteria - 196; Metazoa - 1; Fungi - 33; Plants - 60; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT5G03880.1 | TTAAGGCCCAAAATTAAGGCCCATTAT | electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae - 48; Bacteria - 196; Metazoa - 1; Fungi - 33; Plants - 60; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  | |
AT5G04280 | AT5G04280.1 | ATTTGGGCCTAG | glycine-rich RNA-binding protein; FUNCTIONS IN: RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: glycine-rich RNA-binding protein, putative (TAIR:AT1G60650.2); Has 24420 Blast hits to 18586 proteins in 789 species: Archae - 10; Bacteria - 1605; Metazoa - 14101; Fungi - 2458; Plants - 3834; Viruses - 39; Other Eukaryotes - 2373 (source: NCBI BLink).  |
AT5G04710 | AT5G04710.1 | CATGGGCCCAAAGCCCATA | aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink).  |
AT5G04840 | AT5G04840.1 | AGGGCCCAAAA | bZIP protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827); BEST Arabidopsis thaliana protein match is: bZIP transcription factor family protein (TAIR:AT2G42380.2); Has 249 Blast hits to 247 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 249; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G05090 | AT5G05090.1 | TTTTGGGCCTTG | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G10760.1); Has 890 Blast hits to 890 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 877; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT5G05740 | AT5G05740.1 | TTAAGGCCCAAAT | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria.  |
AT5G05740.2 | TTAAGGCCCAAAT | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria.  | |
AT5G05750 | AT5G05750.1 | ATTTGGGCCTTAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Tetratricopeptide region (InterPro:IPR013026), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G57340.2); Has 16636 Blast hits to 16631 proteins in 1960 species: Archae - 118; Bacteria - 5128; Metazoa - 3676; Fungi - 1518; Plants - 1246; Viruses - 21; Other Eukaryotes - 4929 (source: NCBI BLink).  |
AT5G06160 | AT5G06160.1 | AAAAGGCCCAAAA | Encodes a protein with similarity to pre-mRNA splicing factor SF3a60 that is involved in gametic cell fate determination. Loss of function results in the ectopic expression of egg cell makers suggesting a role in restriction of gametic cell fate. Expressed strongly in gametophytes and weakly in sporophytes.  |
AT5G06160.1 | AAAAGGCCCAAAA | Encodes a protein with similarity to pre-mRNA splicing factor SF3a60 that is involved in gametic cell fate determination. Loss of function results in the ectopic expression of egg cell makers suggesting a role in restriction of gametic cell fate. Expressed strongly in gametophytes and weakly in sporophytes.  | |
AT5G06780 | AT5G06780.1 | AATAGGCCCAAAA | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT3G12140.2); Has 145 Blast hits to 134 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G06780.1 | GTTTGGGCCAA | emsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT3G12140.2); Has 145 Blast hits to 134 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT5G08060 | AT5G08060.1 | TTTTGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G08180 | AT5G08180.1 | AAGGCCCAAATAATTGGGCCAT | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1570 Blast hits to 1570 proteins in 296 species: Archae - 226; Bacteria - 0; Metazoa - 560; Fungi - 291; Plants - 151; Viruses - 0; Other Eukaryotes - 342 (source: NCBI BLink).  |
AT5G08530 | AT5G08530.1 | ATTTGGGCCTGG | 51 kDa subunit of complex I (CI51); FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, NAD or NADH binding, FMN binding, NADH dehydrogenase (ubiquinone) activity, oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NADH-ubiquinone oxidoreductase, 51 kDa subunit, conserved site (InterPro:IPR001949), NADH-ubiquinone oxidoreductase, 51 kDa subunit (InterPro:IPR011538), NADH-ubiquinone oxidoreductase, F subunit (InterPro:IPR011537); Has 6830 Blast hits to 6821 proteins in 987 species: Archae - 16; Bacteria - 2579; Metazoa - 179; Fungi - 80; Plants - 67; Viruses - 0; Other Eukaryotes - 3909 (source: NCBI BLink).  |
AT5G08535 | AT5G08535.1 | CCAGGCCCAAAT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 689 Blast hits to 689 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 494; Fungi - 66; Plants - 91; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT5G08535.2 | CCAGGCCCAAAT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 689 Blast hits to 689 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 494; Fungi - 66; Plants - 91; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  | |
AT5G08620 | AT5G08620.1 | TTTTGGGCCAC | Similar in sequence to DEAD-box RNA helicases. Binds RNA. Involved in drought, salt and cold stress responses.  |
AT5G09770 | AT5G09770.1 | TATATGGGCCCAAAGCCCAAAC | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink).  |
AT5G10690 | AT5G10690.1 | CAAGGCCCAAAT | pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12775.1); Has 9217 Blast hits to 4059 proteins in 145 species: Archae - 2; Bacteria - 6; Metazoa - 124; Fungi - 115; Plants - 8658; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink).  |
AT5G10695 | AT5G10695.1 | ATTTGGGCCTTG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G10870 | AT5G10870.1 | AGTTGGGCCCAAAT | Encodes chorismate mutase AtCM2.  |
AT5G10910 | AT5G10910.1 | AAAAGGCCCAAAC | mraW methylase family protein; FUNCTIONS IN: methyltransferase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial methyltransferase (InterPro:IPR002903); Has 5437 Blast hits to 5435 proteins in 1466 species: Archae - 0; Bacteria - 2709; Metazoa - 101; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2607 (source: NCBI BLink).  |
AT5G11070 | AT5G11070.1 | TCAGGCCCAAAAGCCCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35090.1); Has 22 Blast hits to 22 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G11150 | AT5G11150.1 | TATAGGCCCAAAA | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family.  |
AT5G11680 | AT5G11680.1 | ATAAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 136 Blast hits to 136 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 26; Plants - 24; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT5G11900 | AT5G11900.1 | GAGGCCCAAAT | eukaryotic translation initiation factor SUI1 family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Density-regulated protein DRP1 (InterPro:IPR005873); Has 351 Blast hits to 351 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 157; Fungi - 113; Plants - 29; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT5G13070 | AT5G13070.1 | TAAAGGCCCAAAA | MSF1-like family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PRELI/MSF1 (InterPro:IPR006797); Has 651 Blast hits to 651 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 458; Fungi - 150; Plants - 18; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT5G14610 | AT5G14610.1 | CATGGGCCCAAAT | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / protein binding; FUNCTIONS IN: protein binding, helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), WW/Rsp5/WWP (InterPro:IPR001202), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DRH1 (DEAD BOX RNA HELICASE 1); ATP-dependent RNA helicase/ ATPase (TAIR:AT3G01540.4); Has 52477 Blast hits to 39251 proteins in 1971 species: Archae - 612; Bacteria - 22224; Metazoa - 10881; Fungi - 4675; Plants - 4189; Viruses - 260; Other Eukaryotes - 9636 (source: NCBI BLink).  |
AT5G15020 | AT5G15020.1 | TTTAACGGCCCAAAA | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190).  |
AT5G15450 | AT5G15450.1 | AACGGCCCAAAA | Encodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype.  |
AT5G15550 | AT5G15550.1 | TTTGGGCCCAAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink).  |
AT5G15550.2 | TTTGGGCCCAAAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink).  | |
AT5G15700 | AT5G15700.1 | TTTGGGCCGTT | DNA-directed RNA polymerase (RPOT2); FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: DNA-directed RNA polymerase, bacteriophage type (InterPro:IPR002092); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, mitochondrial (RPOMT) (TAIR:AT1G68990.1); Has 1079 Blast hits to 1064 proteins in 245 species: Archae - 0; Bacteria - 22; Metazoa - 122; Fungi - 163; Plants - 126; Viruses - 102; Other Eukaryotes - 544 (source: NCBI BLink).  |
AT5G15860 | AT5G15860.1 | TTTGGGCCCA | Encodes a protein with prenylcysteine methylesterase activity.  |
AT5G15860.2 | TTTGGGCCCA | Encodes a protein with prenylcysteine methylesterase activity.  | |
AT5G16220 | AT5G16220.1 | CATGGGCCCAAAT | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G19180 | AT5G19180.1 | TTTTGGGCCTAGCCCAGTA | Encodes a subunit of a RUB-activating enzyme analogous to the E1 ubiquitin-activating enzyme. ECR1 functions as a heterodimer with AXR1 to activate RUB, a ubiquitin-related protein.  |
AT5G19290 | AT5G19290.1 | GGGCCCAAAA | esterase/lipase/thioesterase family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT5G14980.1); Has 1459 Blast hits to 1457 proteins in 500 species: Archae - 13; Bacteria - 834; Metazoa - 101; Fungi - 51; Plants - 236; Viruses - 33; Other Eukaryotes - 191 (source: NCBI BLink).  |
AT5G19310 | AT5G19310.1 | CCCGGCCCAAAA | homeotic gene regulator, putative; FUNCTIONS IN: helicase activity, DNA binding, ATP binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); BEST Arabidopsis thaliana protein match is: ATCHR12; ATP binding / DNA binding / helicase/ nucleic acid binding (TAIR:AT3G06010.1); Has 23543 Blast hits to 17298 proteins in 1325 species: Archae - 119; Bacteria - 3571; Metazoa - 8080; Fungi - 3584; Plants - 1110; Viruses - 211; Other Eukaryotes - 6868 (source: NCBI BLink).  |
AT5G20290 | AT5G20290.1 | ATGGGCTTGGCCCAAAGGCC | 40S ribosomal protein S8 (RPS8A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047), Ribosomal protein S8e, conserved site (InterPro:IPR018283); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S8 (RPS8B) (TAIR:AT5G59240.1); Has 801 Blast hits to 797 proteins in 322 species: Archae - 165; Bacteria - 0; Metazoa - 295; Fungi - 110; Plants - 75; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).  |
AT5G20620 | AT5G20620.1 | TTTTGGGCCTTTGGGCCTTTTGGGCCAAT | encodes a ubiquitin polyprotein.  |
AT5G22140 | AT5G22140.1 | TCGGCCCAAAC | pyridine nucleotide-disulphide oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327); BEST Arabidopsis thaliana protein match is: pyridine nucleotide-disulphide oxidoreductase family protein (TAIR:AT3G44190.1); Has 8697 Blast hits to 8694 proteins in 1406 species: Archae - 266; Bacteria - 6387; Metazoa - 242; Fungi - 449; Plants - 207; Viruses - 0; Other Eukaryotes - 1146 (source: NCBI BLink).  |
AT5G22140.2 | TCGGCCCAAAC | pyridine nucleotide-disulphide oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327); BEST Arabidopsis thaliana protein match is: pyridine nucleotide-disulphide oxidoreductase family protein (TAIR:AT3G44190.1); Has 8697 Blast hits to 8694 proteins in 1406 species: Archae - 266; Bacteria - 6387; Metazoa - 242; Fungi - 449; Plants - 207; Viruses - 0; Other Eukaryotes - 1146 (source: NCBI BLink).  | |
AT5G22210 | AT5G22210.1 | TTGGCCCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G22210.2 | TTGGCCCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G22620 | AT5G22620.1 | TACGGCCCAAAT | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase (InterPro:IPR001345); Has 7256 Blast hits to 7163 proteins in 1237 species: Archae - 46; Bacteria - 4441; Metazoa - 577; Fungi - 226; Plants - 90; Viruses - 0; Other Eukaryotes - 1876 (source: NCBI BLink).  |
AT5G22620.2 | TACGGCCCAAAT | phosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Phosphoglycerate/bisphosphoglycerate mutase (InterPro:IPR001345); Has 7256 Blast hits to 7163 proteins in 1237 species: Archae - 46; Bacteria - 4441; Metazoa - 577; Fungi - 226; Plants - 90; Viruses - 0; Other Eukaryotes - 1876 (source: NCBI BLink).  | |
AT5G22790 | AT5G22790.1 | ATTTGGGCCGG | RETICULATA-RELATED 1 (RER1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: LCD1 (LOWER CELL DENSITY 1) (TAIR:AT2G37860.3); Has 3747 Blast hits to 1646 proteins in 237 species: Archae - 10; Bacteria - 594; Metazoa - 1288; Fungi - 337; Plants - 546; Viruses - 166; Other Eukaryotes - 806 (source: NCBI BLink).  |
AT5G23670 | AT5G23670.1 | ATTTGGGCCTAG | Encodes the LCB2 subunit of serine palmitoyltransferase, an enzyme involved in sphingosine biosynthesis. The protein is localized to the endoplasmic reticulum.  |
AT5G23670.2 | ATTTGGGCCTAG | Encodes the LCB2 subunit of serine palmitoyltransferase, an enzyme involved in sphingosine biosynthesis. The protein is localized to the endoplasmic reticulum.  | |
AT5G23740 | AT5G23740.1 | CAAAGGCCCAAAC | Encodes a putative ribosomal protein S11 (RPS11-beta).  |
AT5G23740.1 | TTGGCCCAAAAGGGCCCAACA | Encodes a putative ribosomal protein S11 (RPS11-beta).  | |
AT5G25610 | AT5G25610.1 | ATCGGCCCAAAT | responsive to dehydration 22 (RD22) mediated by ABA  |
AT5G26610 | AT5G26610.1 | TTTTGGGCCCAAT | D111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink).  |
AT5G26610.2 | TTTTGGGCCCAAT | D111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink).  | |
AT5G27120 | AT5G27120.1 | ATTAGGCCCAAAA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein  |
AT5G27400 | AT5G27400.1 | TATAGGCCCATTAGGCCCAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 806 Blast hits to 806 proteins in 171 species: Archae - 0; Bacteria - 62; Metazoa - 389; Fungi - 161; Plants - 105; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).  |
AT5G27460 | AT5G27460.1 | TACGGCCCAAAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02150.1); Has 3781 Blast hits to 2103 proteins in 60 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 13; Plants - 3697; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT5G27470 | AT5G27470.1 | ATTTGGGCCGTA | seryl-tRNA synthetase / serine--tRNA ligase; FUNCTIONS IN: serine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, seryl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: tRNA-binding arm (InterPro:IPR010978), Seryl-tRNA synthetase, class IIa, N-terminal (InterPro:IPR015866), Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Seryl-tRNA synthetase, class IIa (InterPro:IPR002317), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Seryl-tRNA synthetase, class IIa, C-terminal (InterPro:IPR018156); BEST Arabidopsis thaliana protein match is: SRS (SERYL-TRNA SYNTHETASE); serine-tRNA ligase (TAIR:AT1G11870.2); Has 7169 Blast hits to 7168 proteins in 1635 species: Archae - 140; Bacteria - 3036; Metazoa - 295; Fungi - 180; Plants - 68; Viruses - 0; Other Eukaryotes - 3450 (source: NCBI BLink).  |
AT5G35210 | AT5G35210.1 | CAAGGCCCAAAC | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein; FUNCTIONS IN: protein binding, DNA binding, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis, regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast envelope; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: DDT family (InterPro:IPR004022), Zinc finger, PHD-type (InterPro:IPR001965), Peptidase M50 (InterPro:IPR008915), DDT superfamily (InterPro:IPR018501), DDT subgroup (InterPro:IPR018500), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT5G22760.1); Has 3280 Blast hits to 2945 proteins in 255 species: Archae - 62; Bacteria - 178; Metazoa - 2100; Fungi - 246; Plants - 447; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
AT5G35210.1 | CAAGGCCCAAAGGCCCAAAA | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein; FUNCTIONS IN: protein binding, DNA binding, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis, regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast envelope; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: DDT family (InterPro:IPR004022), Zinc finger, PHD-type (InterPro:IPR001965), Peptidase M50 (InterPro:IPR008915), DDT superfamily (InterPro:IPR018501), DDT subgroup (InterPro:IPR018500), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT5G22760.1); Has 3280 Blast hits to 2945 proteins in 255 species: Archae - 62; Bacteria - 178; Metazoa - 2100; Fungi - 246; Plants - 447; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G35210.2 | CAAGGCCCAAAC | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein; FUNCTIONS IN: protein binding, DNA binding, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis, regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast envelope; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: DDT family (InterPro:IPR004022), Zinc finger, PHD-type (InterPro:IPR001965), Peptidase M50 (InterPro:IPR008915), DDT superfamily (InterPro:IPR018501), DDT subgroup (InterPro:IPR018500), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT5G22760.1); Has 3280 Blast hits to 2945 proteins in 255 species: Archae - 62; Bacteria - 178; Metazoa - 2100; Fungi - 246; Plants - 447; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G35210.2 | CAAGGCCCAAAGGCCCAAAA | peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein; FUNCTIONS IN: protein binding, DNA binding, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis, regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast envelope; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: DDT family (InterPro:IPR004022), Zinc finger, PHD-type (InterPro:IPR001965), Peptidase M50 (InterPro:IPR008915), DDT superfamily (InterPro:IPR018501), DDT subgroup (InterPro:IPR018500), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT5G22760.1); Has 3280 Blast hits to 2945 proteins in 255 species: Archae - 62; Bacteria - 178; Metazoa - 2100; Fungi - 246; Plants - 447; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G35620 | AT5G35620.1 | CCGGCCCAAAA | Cap-binding protein, binds to the 5' cap structure of nuclear-encoded mRNAs. Mutant is resistant to potyvirus infection.  |
AT5G35620.2 | CCGGCCCAAAA | Cap-binding protein, binds to the 5' cap structure of nuclear-encoded mRNAs. Mutant is resistant to potyvirus infection.  | |
AT5G38860 | AT5G38860.1 | ATTTGGGCCTGA | BES1-interacting Myc-like protein 3 (BIM3); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM2 (BES1-interacting Myc-like protein 2); DNA binding / transcription factor (TAIR:AT1G69010.1); Has 805 Blast hits to 803 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 24; Plants - 651; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT5G39250 | AT5G39250.1 | CTAATGGGCTTTGGGCCGGGCCGTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G39510 | AT5G39510.1 | GTTTGGGCCCTA | Encodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12.  |
AT5G39740 | AT5G39740.1 | TTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA | 60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT5G41190 | AT5G41190.1 | ATTTGGGCCTTGTGAGGCCCATTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nin one binding (NOB1) Zn-ribbon like (InterPro:IPR014881), D-site 20S pre-rRNA nuclease (InterPro:IPR017117); Has 855 Blast hits to 653 proteins in 196 species: Archae - 53; Bacteria - 16; Metazoa - 335; Fungi - 168; Plants - 29; Viruses - 10; Other Eukaryotes - 244 (source: NCBI BLink).  |
AT5G43970 | AT5G43970.1 | ATGGCCCAAAT | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.  |
AT5G44500 | AT5G44500.1 | CTAGGCCCAAAT | small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: smB (small nuclear ribonucleoprotein associated protein B) (TAIR:AT4G20440.4); Has 53621 Blast hits to 25379 proteins in 1012 species: Archae - 54; Bacteria - 5505; Metazoa - 29637; Fungi - 5515; Plants - 6455; Viruses - 1288; Other Eukaryotes - 5167 (source: NCBI BLink).  |
AT5G44500.2 | CTAGGCCCAAAT | small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: smB (small nuclear ribonucleoprotein associated protein B) (TAIR:AT4G20440.4); Has 53621 Blast hits to 25379 proteins in 1012 species: Archae - 54; Bacteria - 5505; Metazoa - 29637; Fungi - 5515; Plants - 6455; Viruses - 1288; Other Eukaryotes - 5167 (source: NCBI BLink).  | |
AT5G44785 | AT5G44785.1 | ATTTGGGCCTGT | ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3 (OSB3); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: PTAC9 (PLASTID TRANSCRIPTIONALLY ACTIVE 9); single-stranded DNA binding (TAIR:AT4G20010.2); Has 170 Blast hits to 86 proteins in 15 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT5G44785.2 | ATTTGGGCCTGT | ORGANELLAR SINGLE-STRANDED DNA BINDING PROTEIN 3 (OSB3); FUNCTIONS IN: single-stranded DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Primosome PriB/single-strand DNA-binding (InterPro:IPR000424); BEST Arabidopsis thaliana protein match is: PTAC9 (PLASTID TRANSCRIPTIONALLY ACTIVE 9); single-stranded DNA binding (TAIR:AT4G20010.2); Has 170 Blast hits to 86 proteins in 15 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT5G45260 | AT5G45260.1 | ATGGCCCAAAA | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2.  |
AT5G45260.2 | ATGGCCCAAAA | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2.  | |
AT5G45990 | AT5G45990.1 | GTTTGGGCCAT | crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink).  |
AT5G45990.1 | TTTTGGGCCAAT | crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink).  | |
AT5G47840 | AT5G47840.1 | GTTTGGGCCCT | Adenosine monophosphate kinase (AMK2); FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, adenylate kinase activity, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Adenylate kinase, zinc-finger lid region (InterPro:IPR007862), Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: adenylate kinase family protein (TAIR:AT5G35170.2); Has 8772 Blast hits to 8627 proteins in 1854 species: Archae - 64; Bacteria - 4464; Metazoa - 1141; Fungi - 289; Plants - 247; Viruses - 0; Other Eukaryotes - 2567 (source: NCBI BLink).  |
AT5G48730 | AT5G48730.1 | ATTTGGGCCTGGCCCAATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13431 Blast hits to 4993 proteins in 158 species: Archae - 3; Bacteria - 10; Metazoa - 241; Fungi - 171; Plants - 12464; Viruses - 0; Other Eukaryotes - 542 (source: NCBI BLink).  |
AT5G48730.1 | TTTTGGGCCCAAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13431 Blast hits to 4993 proteins in 158 species: Archae - 3; Bacteria - 10; Metazoa - 241; Fungi - 171; Plants - 12464; Viruses - 0; Other Eukaryotes - 542 (source: NCBI BLink).  | |
AT5G49220 | AT5G49220.1 | ATTTGGGCCTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16100.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G49270 | AT5G49270.1 | GTTTGGGCCGGG | Involved in successfully establishing tip growth in root hairs.  |
AT5G50080 | AT5G50080.1 | ATTTGGGCCCAAAT | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.  |
AT5G50460 | AT5G50460.1 | ATTTGGGCCATA | protein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT4G24920.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).  |
AT5G51700 | AT5G51700.1 | ATTTGGGCCGAGGCCCGTT | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation.  |
AT5G52070 | AT5G52070.1 | ATTTGGGCCC | agenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT5G42670.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G52470 | AT5G52470.1 | TTTGGGCCAAT | encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated.  |
AT5G52470.2 | TTTGGGCCAAT | encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated.  | |
AT5G55190 | AT5G55190.1 | TTTTGGGCCGG | A member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression.  |
AT5G56030 | AT5G56030.1 | AGTTGGGCCCAAAA | a member of heat shock protein 90 (HSP90) gene family. Expressed in all tissues and abundant in root apical meristem, pollen and tapetum. Expression is NOT heat-induced but induced by IAA and NaCl.  |
AT5G56120 | AT5G56120.1 | TTCGGCCCATTAAAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12870.1); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G56710 | AT5G56710.1 | ATTTGGGCCGTAAATGGGCTA | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  |
AT5G56710.2 | ATTTGGGCCGTAAATGGGCTA | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  | |
AT5G57160 | AT5G57160.1 | TTTTGGGCCTAG | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4.  |
AT5G57770 | AT5G57770.1 | ATGGCCCAAAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Pleckstrin-like, plant (InterPro:IPR013666), Protein of unknown function DUF828, plant (InterPro:IPR008546); Has 104 Blast hits to 104 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G57815 | AT5G57815.1 | TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT5G57860 | AT5G57860.1 | ATTTGGGCCTAAC | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT5G57860.2 | ATTTGGGCCTAAC | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G57860.3 | ATTTGGGCCTAAC | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G57860.4 | ATTTGGGCCTAAC | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G58005 | AT5G58005.1 | TTTTGGGCCGGGCCTAAATGGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 87 Blast hits to 87 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 28; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G58005.2 | TTTTGGGCCGGGCCTAAATGGGCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 87 Blast hits to 87 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 28; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT5G58020 | AT5G58020.1 | AAAGGCCCAAAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF602 (InterPro:IPR006735); Has 270 Blast hits to 270 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 71; Plants - 21; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
AT5G58310 | AT5G58310.1 | ATTTGGGCCTCA | Encodes a protein shown to have methyl IAA esterase activity in vitro. This protein does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro.  |
AT5G58310.1 | GTTTGGGCCTT | Encodes a protein shown to have methyl IAA esterase activity in vitro. This protein does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro.  | |
AT5G58420 | AT5G58420.1 | GTTTGGGCCTGG | 40S ribosomal protein S4 (RPS4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 941 Blast hits to 941 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).  |
AT5G58640 | AT5G58640.1 | ATTTGGGCCGTTTTGA | selenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT5G58640.2 | ATTTGGGCCGTTTTGA | selenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT5G58920 | AT5G58920.1 | ATAAGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G58950 | AT5G58950.1 | ATTTGGGCCA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G46930.1); Has 97287 Blast hits to 95864 proteins in 3755 species: Archae - 57; Bacteria - 8154; Metazoa - 43395; Fungi - 8207; Plants - 19435; Viruses - 506; Other Eukaryotes - 17533 (source: NCBI BLink).  |
AT5G58960 | AT5G58960.2 | AGGGCCCAAAA | Mutant plants display impaired light-regulation of the hypocotyl randomization response.  |
AT5G58960.3 | AGGGCCCAAAA | Mutant plants display impaired light-regulation of the hypocotyl randomization response.  | |
AT5G59850 | AT5G59850.1 | AAAGGCCCAAAATAAAGCCCATTAT | 40S ribosomal protein S15A (RPS15aF); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: RPS15A (ribosomal protein s15a); structural constituent of ribosome (TAIR:AT1G07770.2); Has 2190 Blast hits to 2190 proteins in 758 species: Archae - 184; Bacteria - 927; Metazoa - 327; Fungi - 130; Plants - 162; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink).  |
AT5G60140 | AT5G60140.1 | GTTTGGGCCTTAG | transcriptional factor B3 family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: transcriptional factor B3 family protein (TAIR:AT5G60130.1); Has 35622 Blast hits to 9758 proteins in 600 species: Archae - 149; Bacteria - 18835; Metazoa - 6044; Fungi - 2604; Plants - 1070; Viruses - 420; Other Eukaryotes - 6500 (source: NCBI BLink).  |
AT5G60390 | AT5G60390.1 | AAAGGCCCAAAACGCGT | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, nucleus, plasma membrane, vacuole, cytoplasm; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT1G07940.2); Has 56847 Blast hits to 56774 proteins in 13741 species: Archae - 656; Bacteria - 18823; Metazoa - 15489; Fungi - 8699; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).  |
AT5G60390.2 | AAAGGCCCAAAACGCGT | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, nucleus, plasma membrane, vacuole, cytoplasm; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT1G07940.2); Has 56847 Blast hits to 56774 proteins in 13741 species: Archae - 656; Bacteria - 18823; Metazoa - 15489; Fungi - 8699; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).  | |
AT5G60390.3 | AAAGGCCCAAAACGCGT | elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, nucleus, plasma membrane, vacuole, cytoplasm; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT1G07940.2); Has 56847 Blast hits to 56774 proteins in 13741 species: Archae - 656; Bacteria - 18823; Metazoa - 15489; Fungi - 8699; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).  | |
AT5G61450 | AT5G61450.1 | TTATGGGCTGGCCCAAAT | 2-phosphoglycerate kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; Has 393 Blast hits to 372 proteins in 106 species: Archae - 58; Bacteria - 24; Metazoa - 63; Fungi - 40; Plants - 52; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).  |
AT5G61830 | AT5G61830.1 | GTTTGGGCCAT | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT5G51030.1); Has 51963 Blast hits to 51927 proteins in 1956 species: Archae - 334; Bacteria - 30696; Metazoa - 4832; Fungi - 2627; Plants - 1498; Viruses - 0; Other Eukaryotes - 11976 (source: NCBI BLink).  |
AT5G62300 | AT5G62300.1 | GTTTGGGCCCAACA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  |
AT5G62300.2 | GTTTGGGCCCAACA | 40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).  | |
AT5G62700 | AT5G62700.1 | ATGGGCCCAAA | encodes tubulin beta-2/beta-3 chain  |
AT5G63520 | AT5G63520.1 | AAAAGGCCCAAAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FIST domain, N-terminal (InterPro:IPR013702); Has 96 Blast hits to 96 proteins in 46 species: Archae - 0; Bacteria - 72; Metazoa - 6; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G63840 | AT5G63840.1 | GTTTGGGCCGAA | radial swelling mutant shown to be specifically impaired in cellulose production. Encodes the alpha-subunit of a glucosidase II enzyme.  |
AT5G64400 | AT5G64400.1 | GTTTGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT5G64400.2 | GTTTGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G09570.1); Has 102 Blast hits to 100 proteins in 33 species: Archae - 0; Bacteria - 9; Metazoa - 16; Fungi - 2; Plants - 47; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  | |
AT5G64670 | AT5G64670.1 | ATTTGGGCCAT | ribosomal protein L15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15, bacterial-type (InterPro:IPR005749), Ribosomal protein L15 (InterPro:IPR001196); Has 5287 Blast hits to 5287 proteins in 1515 species: Archae - 0; Bacteria - 2940; Metazoa - 111; Fungi - 84; Plants - 51; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink).  |
AT5G64680 | AT5G64680.1 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  |
AT5G64680.2 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  | |
AT5G64680.3 | TTAAAGGCCCATTATGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages.  | |
AT5G64740 | AT5G64740.1 | AGAGGCCCAAAA | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles.  |
AT5G65400 | AT5G65400.1 | TTTTGGGCCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24380.1); Has 479 Blast hits to 479 proteins in 121 species: Archae - 0; Bacteria - 2; Metazoa - 88; Fungi - 285; Plants - 66; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT5G65750 | AT5G65750.1 | TTTTGGGCCGATAAGCCCAATAT | 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, oxoglutarate dehydrogenase (succinyl-transferring) activity, thiamin pyrophosphate binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative (TAIR:AT3G55410.1); Has 8716 Blast hits to 8694 proteins in 1114 species: Archae - 2; Bacteria - 2389; Metazoa - 550; Fungi - 187; Plants - 68; Viruses - 0; Other Eukaryotes - 5520 (source: NCBI BLink).  |
AT5G66010 | AT5G66010.1 | TTTGGGCCG | RNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G20890.1); Has 2870 Blast hits to 1043 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 2605; Fungi - 10; Plants - 100; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT5G66010.1 | TTTGGGCCGAT | RNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G20890.1); Has 2870 Blast hits to 1043 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 2605; Fungi - 10; Plants - 100; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  | |
AT5G66240 | AT5G66240.1 | ATTTGGGCCCATAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink).  |
AT5G66240.2 | ATTTGGGCCCATAT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink).  | |
AT5G67270 | AT5G67270.1 | GTTTGGGCCGA | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis.  |
AT5G67400 | AT5G67400.1 | TTGGCCCAAAA | peroxidase 73 (PER73) (P73) (PRXR11); FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G49960.1); Has 2886 Blast hits to 2873 proteins in 211 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 2764; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |