version

Summary of AtREG374 (All List)

OrganismArabidopsis thaliana  
IDAtREG374  
SequenceGGGCCTGA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE MotifGGGCC  one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);  
Total Entry Count156  

Entry Sequences (156 entries)

LocusGene modelSequenceDescription
AT1G03860AT1G03860.1ATAATGGGCCTGAprohibitin 2 
AT1G03860.2ATAATGGGCCTGAprohibitin 2 
AT1G03860.3ATAATGGGCCTGAprohibitin 2 
AT1G04930AT1G04930.1AATACCCTCAGGCCCAGATCGGCCCAAAAhydroxyproline-rich glycoprotein family protein; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT2G32840.1); Has 1563 Blast hits to 1268 proteins in 183 species: Archae - 0; Bacteria - 127; Metazoa - 510; Fungi - 165; Plants - 332; Viruses - 182; Other Eukaryotes - 247 (source: NCBI BLink). 
AT1G04940AT1G04940.1TTTTGGGCCGATCTGGGCCTGAGGGTATTTic20 is believed to function as a component of the protein-conducting channel at the inner envelope membrane. Genes AT1G04940 and AT1G04945 were switched for the TAIR7 genome release to give consistency with MIPs annotation. 
AT1G07745AT1G07745.1TCTGGGCCTGAIs a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination. 
AT1G07745.2TCTGGGCCTGAIs a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination. 
AT1G07840AT1G07840.1TAAATGGGGCCTGAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT1G07840.2TAAATGGGGCCTGAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT1G07840.3TAAATGGGGCCTGAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT1G11430AT1G11430.1TCAGGCCCAAACplastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G17370AT1G17370.1ATTGGGCCTGAoligouridylate binding protein 1B (UBP1B); FUNCTIONS IN: mRNA 3'-UTR binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: oligouridylate-binding protein, putative (TAIR:AT3G14100.1); Has 17907 Blast hits to 12570 proteins in 534 species: Archae - 0; Bacteria - 870; Metazoa - 10427; Fungi - 2031; Plants - 2891; Viruses - 0; Other Eukaryotes - 1688 (source: NCBI BLink). 
AT1G17370.2ATTGGGCCTGAoligouridylate binding protein 1B (UBP1B); FUNCTIONS IN: mRNA 3'-UTR binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: oligouridylate-binding protein, putative (TAIR:AT3G14100.1); Has 17907 Blast hits to 12570 proteins in 534 species: Archae - 0; Bacteria - 870; Metazoa - 10427; Fungi - 2031; Plants - 2891; Viruses - 0; Other Eukaryotes - 1688 (source: NCBI BLink). 
AT1G20540AT1G20540.1ATTGGGCCTGAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G76260.1); Has 6759 Blast hits to 5575 proteins in 300 species: Archae - 0; Bacteria - 624; Metazoa - 3227; Fungi - 1427; Plants - 781; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink). 
AT1G21560AT1G21560.1TTATGGGCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G23205AT1G23205.1TCAGGCCCAGATCGGCCCATTAAinvertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G70720.1); Has 417 Blast hits to 412 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 417; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G23890AT1G23890.1TCAGGCCCNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT1G23890.2TCAGGCCCNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT1G23900AT1G23900.1GGGCCTGAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane 
AT1G23900.2GGGCCTGAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane 
AT1G25280AT1G25280.2GGGCCTGAMember of TLP family 
AT1G25280.3GGGCCTGAMember of TLP family 
AT1G31812AT1G31812.1TTATGGGCCTGAAcyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases. 
AT1G34190AT1G34190.1TTAATGGGCCTGAArabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 1564; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G35220AT1G35220.1TCAGGCCCACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 247 Blast hits to 143 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). 
AT1G44810AT1G44810.1GTTGGGCCTGAtranscription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: DNA-binding storekeeper protein-related (TAIR:AT4G00250.1); Has 1057 Blast hits to 708 proteins in 132 species: Archae - 0; Bacteria - 85; Metazoa - 306; Fungi - 207; Plants - 172; Viruses - 6; Other Eukaryotes - 281 (source: NCBI BLink). 
AT1G52300AT1G52300.1TTAAGGCCCATGGGCCTGA60S ribosomal protein L37 (RPL37B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). 
AT1G54340AT1G54340.1TCAGGCCCATATANADP-specific isocitrate dehydrogenase (ICDH) 
AT1G55325AT1G55325.1AATTGGGCCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAP240 (InterPro:IPR009401); Has 190 Blast hits to 182 proteins in 65 species: Archae - 0; Bacteria - 45; Metazoa - 113; Fungi - 3; Plants - 23; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G56440AT1G56440.1GGGCCTGACCCGGTserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink). 
AT1G56450AT1G56450.1ACCGGGTCAGGCCC20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds 
AT1G57660AT1G57660.1TATGGCCCAATCAGGCCCATTTA60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). 
AT1G60780AT1G60780.1TATATGGGCCTGAHAPLESS 13 (HAP13); FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT1G10730.1); Has 1643 Blast hits to 1593 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 929; Fungi - 318; Plants - 104; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink). 
AT1G68300AT1G68300.1TCAGGCCCATCuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: ethylene-responsive protein, putative (TAIR:AT1G09740.1); Has 4247 Blast hits to 4068 proteins in 895 species: Archae - 347; Bacteria - 3225; Metazoa - 46; Fungi - 59; Plants - 390; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink). 
AT1G68310AT1G68310.1GATGGGCCTGAEncodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. 
AT1G68310.2GATGGGCCTGAEncodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. 
AT1G70680AT1G70680.1TCAGGCCCAATATcaleosin-related family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Caleosin related (InterPro:IPR007736); BEST Arabidopsis thaliana protein match is: caleosin-related family protein (TAIR:AT1G70670.1); Has 228 Blast hits to 223 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 44; Plants - 181; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT1G77710AT1G77710.1AAATGGGCCTAAAATGGGCCTGAINVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-like, Ufm1 (InterPro:IPR005375); Has 170 Blast hits to 170 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT2G02500AT2G02500.1TTAATGGGCCTGATGGGCTTATEncodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity). 
AT2G02510AT2G02510.1ATAAGCCCATCAGGCCCATTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G05920AT2G05920.1AAATGGGCCTGAsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae - 130; Bacteria - 2232; Metazoa - 135; Fungi - 512; Plants - 867; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink). 
AT2G17870AT2G17870.1CCATGGGCCTGAcold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink). 
AT2G19740AT2G19740.1AAAAGCCCATCAGGCCCATA60S ribosomal protein L31 (RPL31A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, chloroplast, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31C) (TAIR:AT5G56710.1); Has 851 Blast hits to 851 proteins in 263 species: Archae - 99; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). 
AT2G20530AT2G20530.1CTAATGGGCCTGAPROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink). 
AT2G20530.2CTAATGGGCCTGAPROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink). 
AT2G23780AT2G23780.1TCAGGCCCAATATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G19310.1); Has 2997 Blast hits to 2989 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 1936; Fungi - 317; Plants - 374; Viruses - 17; Other Eukaryotes - 353 (source: NCBI BLink). 
AT2G23930AT2G23930.1TTATTGGGCCTGAPROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G (SNRNP-G); FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative (TAIR:AT3G11500.1); Has 892 Blast hits to 892 proteins in 193 species: Archae - 86; Bacteria - 0; Metazoa - 373; Fungi - 185; Plants - 110; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT2G23930.2TTATTGGGCCTGAPROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G (SNRNP-G); FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative (TAIR:AT3G11500.1); Has 892 Blast hits to 892 proteins in 193 species: Archae - 86; Bacteria - 0; Metazoa - 373; Fungi - 185; Plants - 110; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT2G27680AT2G27680.1ATTTGGGCCTGAaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G06690.1); Has 7113 Blast hits to 7107 proteins in 1067 species: Archae - 127; Bacteria - 5110; Metazoa - 109; Fungi - 309; Plants - 217; Viruses - 0; Other Eukaryotes - 1241 (source: NCBI BLink). 
AT2G35490AT2G35490.1TCAGGCCCATTAGplastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: plastid-lipid associated protein PAP, putative (TAIR:AT4G22240.1); Has 293 Blast hits to 290 proteins in 66 species: Archae - 0; Bacteria - 78; Metazoa - 1; Fungi - 0; Plants - 205; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G35500AT2G35500.1CTAATGGGCCTGAshikimate kinase-related; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); Has 282 Blast hits to 282 proteins in 67 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). 
AT2G36900AT2G36900.1TCAGGCCCATAAmember of Membrin Gene Family 
AT2G36900.2TCAGGCCCATAAmember of Membrin Gene Family 
AT2G37660AT2G37660.1TCAGGCCCGTTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, apoplast, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 1711 Blast hits to 1685 proteins in 445 species: Archae - 20; Bacteria - 1147; Metazoa - 3; Fungi - 23; Plants - 245; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink). 
AT2G40600AT2G40600.1TCAGGCCCATAAappr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT1G69340.1); Has 2324 Blast hits to 2216 proteins in 788 species: Archae - 117; Bacteria - 1020; Metazoa - 576; Fungi - 86; Plants - 56; Viruses - 292; Other Eukaryotes - 177 (source: NCBI BLink). 
AT2G41840AT2G41840.1TCAGGCCCATTTAAGCCCACT40S ribosomal protein S2 (RPS2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 9044 Blast hits to 7622 proteins in 1716 species: Archae - 183; Bacteria - 3055; Metazoa - 2026; Fungi - 746; Plants - 385; Viruses - 17; Other Eukaryotes - 2632 (source: NCBI BLink). 
AT2G42560AT2G42560.1GGGCCTGAlate embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein (InterPro:IPR004238); BEST Arabidopsis thaliana protein match is: ATECP63 (EMBRYONIC CELL PROTEIN 63) (TAIR:AT2G36640.1); Has 12374 Blast hits to 7501 proteins in 1066 species: Archae - 63; Bacteria - 4676; Metazoa - 2087; Fungi - 744; Plants - 1442; Viruses - 129; Other Eukaryotes - 3233 (source: NCBI BLink). 
AT3G01130AT3G01130.1ATATGGGCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01130.2ATATGGGCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01700AT3G01700.1TGTGGGCCTGAEncodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. 
AT3G02050AT3G02050.1AGCCCATAATGGGCCTGApotassium transporter KUP3p (KUP3) 
AT3G04620AT3G04620.1TCAGGCCCATTTAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G29250.1); Has 89 Blast hits to 89 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT3G05060AT3G05060.1TCAGGCCCATTAASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein 
AT3G05070AT3G05070.1TTAATGGGCCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink). 
AT3G06400AT3G06400.1TCAGGCCCAACTEncodes a SWI2/SNF2 chromatin remodeling protein belonging to the ISWI family. Involved in nuclear proliferation during megagametogenesis and cell expansion in the sporophyte. Constitutively expressed. RNAi induced loss of function in megagametogenesis results in female sterility.35S:RNAi plants have reduced stature. 
AT3G07110AT3G07110.1AGATGGGCCTGA60S ribosomal protein L13A (RPL13aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1890 Blast hits to 1890 proteins in 584 species: Archae - 212; Bacteria - 573; Metazoa - 292; Fungi - 125; Plants - 164; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink). 
AT3G07110.2AGATGGGCCTGA60S ribosomal protein L13A (RPL13aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1890 Blast hits to 1890 proteins in 584 species: Archae - 212; Bacteria - 573; Metazoa - 292; Fungi - 125; Plants - 164; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink). 
AT3G09080AT3G09080.1TATATGGGCCTGAAAAGCCCACtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 11046 Blast hits to 7089 proteins in 331 species: Archae - 36; Bacteria - 2713; Metazoa - 3924; Fungi - 1952; Plants - 817; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink). 
AT3G09085AT3G09085.1GTGGGCTTTTCAGGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2253, membrane (InterPro:IPR018722); Has 550 Blast hits to 550 proteins in 186 species: Archae - 0; Bacteria - 294; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink). 
AT3G10530AT3G10530.1TCAGGCCCAATATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BING4, C-terminal (InterPro:IPR012952), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.3); Has 6810 Blast hits to 4312 proteins in 298 species: Archae - 16; Bacteria - 2174; Metazoa - 1948; Fungi - 1292; Plants - 310; Viruses - 0; Other Eukaryotes - 1070 (source: NCBI BLink). 
AT3G11800AT3G11800.1TCAGGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44150.1); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G16080AT3G16080.1TCAGGCCCACA60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). 
AT3G22780AT3G22780.1GAATGGGCCTGAputative DNA binding protein (tso1) mRNA, tso1-3 allele, 
AT3G26410AT3G26410.1GTGGGCCTGAmethyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G26420AT3G26420.1TCAGGCCCACZinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. 
AT3G49000AT3G49000.1GGGCCTGATAGGCCCAAACRNA polymerase III subunit RPC82 family protein; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase III subunit RPC82-related, helix-turn-helix (InterPro:IPR013197), RNA polymerase III Rpc82, C -terminal (InterPro:IPR008806); Has 175 Blast hits to 170 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 45; Plants - 23; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT3G49560AT3G49560.1TAAATGGGCTTTTTTCAGGCCCAGmitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT5G24650.1); Has 56 Blast hits to 54 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G50930AT3G50930.1GGGCCTGACYTOCHROME BC1 SYNTHESIS (BCS1); FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT3G50940.1); Has 14639 Blast hits to 13488 proteins in 1548 species: Archae - 792; Bacteria - 3998; Metazoa - 3028; Fungi - 1834; Plants - 1282; Viruses - 24; Other Eukaryotes - 3681 (source: NCBI BLink). 
AT3G51420AT3G51420.1ACTGGGCCTGASTRICTOSIDINE SYNTHASE-LIKE 4 (SSL4); FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 925 Blast hits to 920 proteins in 207 species: Archae - 3; Bacteria - 290; Metazoa - 196; Fungi - 4; Plants - 277; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT3G51880AT3G51880.1TCAGGCCCATATAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. 
AT3G51880.2TCAGGCCCATATAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. 
AT3G51880.3TCAGGCCCATATAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. 
AT3G52730AT3G52730.1TTTTGGGCCTGAubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G53710AT3G53710.1GTGGGCCTGAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT3G53710.2GTGGGCCTGAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. 
AT3G54050AT3G54050.1TCAGGCCCAACTfructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: response to cold, fructose metabolic process; LOCATED IN: apoplast, stromule, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT1G43670.1); Has 2353 Blast hits to 2350 proteins in 800 species: Archae - 24; Bacteria - 1225; Metazoa - 332; Fungi - 108; Plants - 224; Viruses - 0; Other Eukaryotes - 440 (source: NCBI BLink). 
AT3G56120AT3G56120.1GGGCCTGAMet-10+ like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT4G27340.1); Has 933 Blast hits to 801 proteins in 255 species: Archae - 252; Bacteria - 75; Metazoa - 244; Fungi - 94; Plants - 62; Viruses - 0; Other Eukaryotes - 206 (source: NCBI BLink). 
AT3G56340AT3G56340.1TCAGGCCCAAAT40S ribosomal protein S26 (RPS26C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26A) (TAIR:AT2G40510.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT3G59280AT3G59280.1AGATGGGCCTGAmutant exhibited resistance to growth on media containing thaxtomin due to a difference in the rate of uptake of the toxin.We proposed that TXR1 is a component of, or regulator of, a dispensable transport mechanism. 
AT3G62400AT3G62400.1TCAGGCCCATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G62400.2TCAGGCCCATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G05190AT4G05190.1TGATGGGCCTGAATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts. 
AT4G05190.1TGATGGGCCTGAATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts. 
AT4G10140AT4G10140.1GTTTGGGCTTGGGCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33490.1); Has 39 Blast hits to 39 proteins in 13 species: Archae - 0; Bacteria - 14; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G10180AT4G10180.1TCAGGCCCATTAAEncodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling. 
AT4G14320AT4G14320.1AGATGGGCCTGA60S ribosomal protein L36a/L44 (RPL36aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aA) (TAIR:AT3G23390.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT4G14330AT4G14330.1TCAGGCCCATCTphragmoplast-associated kinesin-related protein 2 (PAKRP2); FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: phragmoplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATK1 (ARABIDOPSIS THALIANA KINESIN 1); microtubule motor/ minus-end-directed microtubule motor (TAIR:AT4G21270.1); Has 19997 Blast hits to 14982 proteins in 632 species: Archae - 102; Bacteria - 784; Metazoa - 9932; Fungi - 1679; Plants - 1066; Viruses - 71; Other Eukaryotes - 6363 (source: NCBI BLink). 
AT4G15930AT4G15930.1ATAATGGGCCTGAmicrotubule motor; FUNCTIONS IN: microtubule motor activity; INVOLVED IN: microtubule-based process; LOCATED IN: microtubule associated complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dynein light chain, type 1 and 2 (InterPro:IPR001372); BEST Arabidopsis thaliana protein match is: dynein light chain, putative (TAIR:AT5G20110.1); Has 980 Blast hits to 980 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 538; Fungi - 74; Plants - 124; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). 
AT4G17510AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). 
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). 
AT4G20300AT4G20300.1TAGTGGGCCTGATAATGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT4G20300.2TAGTGGGCCTGATAATGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT4G23710AT4G23710.1TTAATGGGCCTGAVAG2; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances; INVOLVED IN: proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar (H+)-ATPase G subunit (InterPro:IPR005124); BEST Arabidopsis thaliana protein match is: VMA10 (VACUOLAR MEMBRANE ATPASE 10); hydrogen ion transporting ATP synthase, rotational mechanism (TAIR:AT3G01390.2); Has 470 Blast hits to 470 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 268; Fungi - 80; Plants - 75; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). 
AT4G26600AT4G26600.1TCAGGCCCATTAGnucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink). 
AT4G26780AT4G26780.1TCAGGCCCAGunknown function 
AT4G28830AT4G28830.1AAAGCCCAATGGGCCTGAmethyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase small (InterPro:IPR007848), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 2052 Blast hits to 2052 proteins in 760 species: Archae - 135; Bacteria - 1556; Metazoa - 106; Fungi - 2; Plants - 24; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). 
AT4G28830.2AAAGCCCAATGGGCCTGAmethyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase small (InterPro:IPR007848), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 2052 Blast hits to 2052 proteins in 760 species: Archae - 135; Bacteria - 1556; Metazoa - 106; Fungi - 2; Plants - 24; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink). 
AT4G30960AT4G30960.1TCAGGCCCEncodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. 
AT4G35220AT4G35220.1TCAGGCCCATAAcyclase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Putative cyclase (InterPro:IPR007325); BEST Arabidopsis thaliana protein match is: cyclase family protein (TAIR:AT4G34180.1); Has 778 Blast hits to 778 proteins in 304 species: Archae - 55; Bacteria - 578; Metazoa - 30; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink). 
AT4G35800AT4G35800.1ACTGGGCCTGAEncodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. 
AT5G03830AT5G03830.1TTTCCGGTTCAGGCCCCAATTGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: p21Cip1-binding protein-related (TAIR:AT2G44510.1); Has 225 Blast hits to 225 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 94; Fungi - 68; Plants - 27; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT5G05740AT5G05740.1TCAGGCCCS2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442–454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171–179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. 
AT5G05740.2TCAGGCCCS2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442–454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171–179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. 
AT5G05750AT5G05750.1GGGCCTGADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Tetratricopeptide region (InterPro:IPR013026), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G57340.2); Has 16636 Blast hits to 16631 proteins in 1960 species: Archae - 118; Bacteria - 5128; Metazoa - 3676; Fungi - 1518; Plants - 1246; Viruses - 21; Other Eukaryotes - 4929 (source: NCBI BLink). 
AT5G05780AT5G05780.1TCAGGCCCATCATATTGGGCTTAEncodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. 
AT5G09740AT5G09740.1CTAATGGGCCTGAEncodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. 
AT5G09740.2CTAATGGGCCTGAEncodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. 
AT5G10110AT5G10110.1TCAGGCCCATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G11070AT5G11070.1TCAGGCCCAAAAGCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35090.1); Has 22 Blast hits to 22 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G12030AT5G12030.1ATATGGGCCTGAEncodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development. 
AT5G12030.1CTTGGGCCTGAEncodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development. 
AT5G12040AT5G12040.1TCAGGCCCAAGcarbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT5G12040.1TCAGGCCCATATcarbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT5G12040.2TCAGGCCCAAGcarbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT5G12040.2TCAGGCCCATATcarbon-nitrogen hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds; INVOLVED IN: nitrogen compound metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (InterPro:IPR003010); BEST Arabidopsis thaliana protein match is: nitrilase, putative (TAIR:AT4G08790.1); Has 7669 Blast hits to 7633 proteins in 1259 species: Archae - 157; Bacteria - 4426; Metazoa - 472; Fungi - 267; Plants - 192; Viruses - 11; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT5G13700AT5G13700.1TCAGGCCCGTEncodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). 
AT5G14220AT5G14220.1ATAATGGGCCTGAEncodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. 
AT5G14260AT5G14260.1TCAGGCCCATTCSET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G14260.2TCAGGCCCATTCSET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G14260.3TCAGGCCCATTCSET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 473 Blast hits to 470 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 84; Plants - 171; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G15750AT5G15750.1ATGGGCTTCTCAGGCCCATAARNA-binding S4 domain-containing protein; FUNCTIONS IN: RNA binding, rRNA binding; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), RNA-binding S4 (InterPro:IPR002942); Has 877 Blast hits to 877 proteins in 267 species: Archae - 114; Bacteria - 0; Metazoa - 268; Fungi - 193; Plants - 105; Viruses - 0; Other Eukaryotes - 197 (source: NCBI BLink). 
AT5G19680AT5G19680.1TCAGGCCCACleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G15410.1); Has 29854 Blast hits to 15686 proteins in 655 species: Archae - 20; Bacteria - 8097; Metazoa - 15577; Fungi - 752; Plants - 2607; Viruses - 68; Other Eukaryotes - 2733 (source: NCBI BLink). 
AT5G22100AT5G22100.1GGGCCTGAGGCCCRNA cyclase family protein; FUNCTIONS IN: RNA-3'-phosphate cyclase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA 3'-terminal phosphate cyclase- like (InterPro:IPR000228), RNA 3'-terminal phosphate cyclase, insert region (InterPro:IPR013796), RNA 3'-terminal phosphate cyclase-like, eukaryotic (InterPro:IPR016443), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); Has 760 Blast hits to 750 proteins in 310 species: Archae - 113; Bacteria - 208; Metazoa - 233; Fungi - 95; Plants - 22; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink). 
AT5G24970AT5G24970.1TTAATGGGCCTGAABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink). 
AT5G24980AT5G24980.1TCAGGCCCATTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G27700AT5G27700.1GATGGGCCTGAstructural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e, conserved site (InterPro:IPR018279), Ribosomal protein S21e (InterPro:IPR001931); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S21 (RPS21B) (TAIR:AT3G53890.2); Has 477 Blast hits to 477 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT5G35995AT5G35995.1TCAGGCCCF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64540.1); Has 1046 Blast hits to 1019 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1046; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G35995.2TCAGGCCCF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64540.1); Has 1046 Blast hits to 1019 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1046; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G38860AT5G38860.1ATTTGGGCCTGABES1-interacting Myc-like protein 3 (BIM3); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM2 (BES1-interacting Myc-like protein 2); DNA binding / transcription factor (TAIR:AT1G69010.1); Has 805 Blast hits to 803 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 24; Plants - 651; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT5G40200AT5G40200.1TCAGGCCCATTTEncodes a putative DegP protease. 
AT5G52440AT5G52440.1TCAGGCCCAATAAHCF106; nuclear gene for chloroplast. Thylakoid membrane delta pH translocation pathway component protein; related to Escherichia coli TatA and TatB 
AT5G53490AT5G53490.1TCAGGCCCAATGGGCTAAthylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. 
AT5G53490.2TCAGGCCCAATGGGCTAAthylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. 
AT5G57290AT5G57290.1TCAGGCCCATCT60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G57290.2TCAGGCCCATCT60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G57290.3TCAGGCCCATCT60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G60620AT5G60620.1ATAATGGGCCTGAphospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: triglyceride biosynthetic process, diacylglycerol biosynthetic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: phospholipid/glycerol acyltransferase family protein (TAIR:AT1G80950.1); Has 820 Blast hits to 786 proteins in 139 species: Archae - 0; Bacteria - 81; Metazoa - 535; Fungi - 2; Plants - 72; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). 
AT5G62070AT5G62070.1TCAGGCCCATTGACTTTAACCGIQ-domain 23 (IQD23); FUNCTIONS IN: calmodulin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD24 (IQ-domain 24); calmodulin binding (TAIR:AT5G07240.1); Has 462 Blast hits to 452 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 4; Plants - 406; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT5G65950AT5G65950.1AGTGGGCTTATAATGGGCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT5G66055AT5G66055.1TCAGGCCCATATANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink). 
AT5G66055.2TCAGGCCCATATANKYRIN REPEAT PROTEIN (AKRP); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: EMB506 (embryo defective 506); protein binding (TAIR:AT5G40160.1); Has 70206 Blast hits to 22501 proteins in 882 species: Archae - 85; Bacteria - 4541; Metazoa - 37898; Fungi - 4361; Plants - 1873; Viruses - 1166; Other Eukaryotes - 20282 (source: NCBI BLink). 
AT5G66060AT5G66060.1ATATGGGCCTGAiron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process, peptidyl-proline hydroxylation to 4-hydroxy-L-proline; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G17720.1); Has 1779 Blast hits to 1774 proteins in 217 species: Archae - 0; Bacteria - 195; Metazoa - 891; Fungi - 57; Plants - 219; Viruses - 14; Other Eukaryotes - 403 (source: NCBI BLink). 
AT5G66590AT5G66590.1TTAATGGGCCTGAallergen V5/Tpx-1-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: allergen V5/Tpx-1-related family protein (TAIR:AT5G57625.1); Has 1763 Blast hits to 1704 proteins in 235 species: Archae - 0; Bacteria - 47; Metazoa - 893; Fungi - 192; Plants - 589; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). 
AT5G66910AT5G66910.1CAATGGGCCTGAdisease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae - 22; Bacteria - 1182; Metazoa - 2936; Fungi - 103; Plants - 14487; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink). 
AT5G67370AT5G67370.1GGGCCTGAGTGGCCCAATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1230 (InterPro:IPR009631); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11840.1); Has 264 Blast hits to 264 proteins in 69 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). 
AT5G67400AT5G67400.1GGGCCTGAAAGCCCATAAAAGTCAAperoxidase 73 (PER73) (P73) (PRXR11); FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G49960.1); Has 2886 Blast hits to 2873 proteins in 211 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 2764; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.