Organism | Arabidopsis thaliana | |
ID | AtREG379 | |
Sequence | ACGTGGCA | |
Annotation | ABA | |
PPDB Motif | ACGT | bZIP-binding motif, environmental responses |
PLACE Motif | ACGT | ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis; | ACGTG | ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis; | GCCAC | one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; SORLIP 1 is most over-represented, and most statistically singnificant; See also S000483, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); Over-represented in light-induced cotyledon and root common genes and root-specific genes (Jiao et al. 2005; see S000486); | ACGTGKC | Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T; |
Total Entry Count | 514 |
Locus | Gene model | Sequence | Description |
AT1G01140 | AT1G01140.1 | TACGTGGCAT | Encodes a CBL-interacting protein kinase with similarity to SOS2  |
AT1G01140.2 | TACGTGGCAT | Encodes a CBL-interacting protein kinase with similarity to SOS2  | |
AT1G01140.3 | TACGTGGCAT | Encodes a CBL-interacting protein kinase with similarity to SOS2  | |
AT1G02260 | AT1G02260.1 | GACGTGGCAG | transmembrane protein, putative; FUNCTIONS IN: citrate transmembrane transporter activity, transporter activity; INVOLVED IN: citrate transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Divalent ion symporter (InterPro:IPR004680); Has 5612 Blast hits to 3945 proteins in 1017 species: Archae - 185; Bacteria - 4274; Metazoa - 237; Fungi - 56; Plants - 87; Viruses - 2; Other Eukaryotes - 771 (source: NCBI BLink).  |
AT1G02340 | AT1G02340.1 | ACGTGGCAC | Encodes a light-inducible, nuclear bHLH protein involved in phytochrome signaling. Mutants exhibit a long-hypocotyl phenotype only under far-red light but not under red light and are defective in other phytochrome A-related responses. Mutants also show blue light response defects. HFR1 interacts with COP1, co-localizes to the nuclear specks and is ubiquinated by COP1.  |
AT1G03090 | AT1G03090.1 | ATGCCACGTCAC | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  |
AT1G03090.2 | ATGCCACGTCAC | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  | |
AT1G03470 | AT1G03470.1 | TACGTGGCAAT | kinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).  |
AT1G03470.2 | TACGTGGCAAT | kinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).  | |
AT1G04770 | AT1G04770.1 | TACGTGGCAC | male sterility MS5 family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ATSDI1 (SULPHUR DEFICIENCY-INDUCED 1); binding (TAIR:AT5G48850.1); Has 145 Blast hits to 145 proteins in 21 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
AT1G04920 | AT1G04920.1 | TTGCCACGTAATTA | Encodes a protein with putative sucrose-phosphate synthase activity.  |
AT1G05570 | AT1G05570.1 | GATGACGTGGCAG | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48.  |
AT1G06110 | AT1G06110.1 | GTGCCACGTGTA | SKP1/ASK-interacting protein 16 (SKIP16); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: SCF ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ApaG (InterPro:IPR007474); Has 1427 Blast hits to 1427 proteins in 496 species: Archae - 0; Bacteria - 836; Metazoa - 173; Fungi - 41; Plants - 47; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink).  |
AT1G06680 | AT1G06680.1 | CTGCCACGTGGCAC | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.  |
AT1G06680.2 | CTGCCACGTGGCAC | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.  | |
AT1G07510 | AT1G07510.1 | CTGCCACGTG | encodes an FtsH protease that is localized to the mitochondrion  |
AT1G07590 | AT1G07590.1 | ATGCCACGTGTA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 6623 Blast hits to 3122 proteins in 84 species: Archae - 0; Bacteria - 4; Metazoa - 30; Fungi - 22; Plants - 6377; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).  |
AT1G07600 | AT1G07600.1 | ATGCCACGTGTA | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage.  |
AT1G07645 | AT1G07645.1 | CACGTGGCAG | DESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT1G08190 | AT1G08190.1 | CACACGTGGCAC | vacuolar assembly protein, putative (VPS41); FUNCTIONS IN: protein binding, binding, nucleotide binding, zinc ion binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), WD40 repeat (InterPro:IPR001680), Vacuolar protein sorting-associated protein 41 (InterPro:IPR016902), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); Has 18653 Blast hits to 4150 proteins in 294 species: Archae - 4; Bacteria - 280; Metazoa - 13631; Fungi - 995; Plants - 521; Viruses - 352; Other Eukaryotes - 2870 (source: NCBI BLink).  |
AT1G08880 | AT1G08880.1 | CTGCCACGT | Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 1020 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin.  |
AT1G09350 | AT1G09350.1 | TTTAGGCCACGTGGCAT | Arabidopsis thaliana galactinol synthase 3 (AtGolS3); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, hypocotyl; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G56600.1); Has 871 Blast hits to 870 proteins in 198 species: Archae - 0; Bacteria - 55; Metazoa - 224; Fungi - 186; Plants - 285; Viruses - 70; Other Eukaryotes - 51 (source: NCBI BLink).  |
AT1G09520 | AT1G09520.1 | GTGCCACGTCA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G10090 | AT1G10090.1 | ATGCCACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT1G10220 | AT1G10220.2 | TACGTGGCAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: ZCF37 (TAIR:AT1G59590.1); Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G10350 | AT1G10350.1 | ATGCCACGTGGCTCCATTAAG | DNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT1G59725.1); Has 19690 Blast hits to 19405 proteins in 2073 species: Archae - 113; Bacteria - 5759; Metazoa - 3795; Fungi - 1695; Plants - 1434; Viruses - 18; Other Eukaryotes - 6876 (source: NCBI BLink).  |
AT1G10560 | AT1G10560.1 | CACGTGGCAC | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.  |
AT1G10760 | AT1G10760.1 | GTGCCACGTGGT | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position.  |
AT1G10960 | AT1G10960.1 | ACGCCACGTGGCAG | FERREDOXIN 1 (ATFD1); FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: FED A; 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G60950.1); Has 5347 Blast hits to 5345 proteins in 903 species: Archae - 63; Bacteria - 3637; Metazoa - 8; Fungi - 9; Plants - 447; Viruses - 2; Other Eukaryotes - 1181 (source: NCBI BLink).  |
AT1G11480 | AT1G11480.1 | CTGCCACGTA | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT1G11480.2 | CTGCCACGTA | eukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  | |
AT1G11870 | AT1G11870.1 | AACACGTGGCAA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  |
AT1G11870.2 | AACACGTGGCAA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  | |
AT1G11870.3 | AACACGTGGCAA | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.  | |
AT1G12920 | AT1G12920.1 | TTGCCACGTG | Encodes a eukaryotic release factor one homolog.  |
AT1G13640 | AT1G13640.1 | GTGACGTGGCAC | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 401 Blast hits to 395 proteins in 120 species: Archae - 0; Bacteria - 2; Metazoa - 139; Fungi - 53; Plants - 136; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
AT1G13670 | AT1G13670.1 | ACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G14010 | AT1G14010.1 | AACACGTGGCAAT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
AT1G14140 | AT1G14140.1 | TTGCCACGTCG | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).  |
AT1G14345 | AT1G14345.1 | CTTAGGCCACGTGGCAC | oxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); Has 255 Blast hits to 255 proteins in 67 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
AT1G15140 | AT1G15140.1 | ATCCACGTGGCAA | oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).  |
AT1G15140.2 | ATCCACGTGGCAA | oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).  | |
AT1G15140.3 | ATCCACGTGGCAA | oxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).  | |
AT1G15290 | AT1G15290.1 | TTGCCACGTGGG | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G28080.1); Has 8993 Blast hits to 2614 proteins in 265 species: Archae - 85; Bacteria - 2044; Metazoa - 4793; Fungi - 935; Plants - 100; Viruses - 4; Other Eukaryotes - 1032 (source: NCBI BLink).  |
AT1G15330 | AT1G15330.1 | ATGCCACGTGTT | CBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
AT1G15330.1 | ATTGCCACGTG | CBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  | |
AT1G16540 | AT1G16540.1 | TGACACGTGGCAC | Encodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. <i>sir</i> loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer.  |
AT1G16610 | AT1G16610.1 | CTGCCACGTA | SR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP.  |
AT1G16610.2 | CTGCCACGTA | SR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP.  | |
AT1G17430 | AT1G17430.1 | TTGCCACGT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G72620.1); Has 3179 Blast hits to 3177 proteins in 659 species: Archae - 36; Bacteria - 2008; Metazoa - 134; Fungi - 8; Plants - 175; Viruses - 0; Other Eukaryotes - 818 (source: NCBI BLink).  |
AT1G18260 | AT1G18260.1 | ACGTGGCAAT | suppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G73570.1); Has 15581 Blast hits to 5419 proteins in 820 species: Archae - 0; Bacteria - 9844; Metazoa - 747; Fungi - 658; Plants - 84; Viruses - 27; Other Eukaryotes - 4221 (source: NCBI BLink).  |
AT1G18330 | AT1G18330.1 | CTGACGTGGCAC | EARLY-PHYTOCHROME-RESPONSIVE1  |
AT1G18330.2 | CTGACGTGGCAC | EARLY-PHYTOCHROME-RESPONSIVE1  | |
AT1G18360 | AT1G18360.1 | ACGTGGCAT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G73480.1); Has 3797 Blast hits to 3785 proteins in 942 species: Archae - 19; Bacteria - 2420; Metazoa - 132; Fungi - 101; Plants - 246; Viruses - 60; Other Eukaryotes - 819 (source: NCBI BLink).  |
AT1G19000 | AT1G19000.1 | ATGCCACGTGGCTT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  |
AT1G19000.2 | ATGCCACGTGGCTT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT1G19110 | AT1G19110.1 | TTGCCACGTGAC | inter-alpha-trypsin inhibitor heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G72500.1); Has 1260 Blast hits to 1251 proteins in 217 species: Archae - 8; Bacteria - 393; Metazoa - 471; Fungi - 34; Plants - 117; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).  |
AT1G21680 | AT1G21680.1 | ATTGCCACGTGTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21670.1); Has 6869 Blast hits to 3873 proteins in 790 species: Archae - 41; Bacteria - 3697; Metazoa - 41; Fungi - 39; Plants - 64; Viruses - 0; Other Eukaryotes - 2987 (source: NCBI BLink).  |
AT1G21770 | AT1G21770.1 | CTGCCACGTGTAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: H3/H4 histone acetyltransferase (TAIR:AT1G77540.1); Has 221 Blast hits to 221 proteins in 107 species: Archae - 4; Bacteria - 182; Metazoa - 4; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G21780 | AT1G21780.1 | GTACACGTGGCAG | BTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B.  |
AT1G21780.2 | GTACACGTGGCAG | BTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B.  | |
AT1G22270 | AT1G22270.1 | GTCACGTGGCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78190.1); Has 289 Blast hits to 289 proteins in 134 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT1G22510 | AT1G22510.1 | ATTGCCACGTGTT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1232 (InterPro:IPR010652), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G72175.1); Has 530 Blast hits to 530 proteins in 91 species: Archae - 0; Bacteria - 15; Metazoa - 391; Fungi - 31; Plants - 40; Viruses - 2; Other Eukaryotes - 51 (source: NCBI BLink).  |
AT1G27000 | AT1G27000.1 | TTGCCACGTGGCGA | bZIP family transcription factor; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02730.2); Has 122 Blast hits to 113 proteins in 16 species: Archae - 0; Bacteria - 8; Metazoa - 2; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT1G27470 | AT1G27470.1 | CTACGTGGCAT | transducin-related / WD-40 repeat protein-related; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G07410.1); Has 6753 Blast hits to 4580 proteins in 346 species: Archae - 8; Bacteria - 2018; Metazoa - 1907; Fungi - 1463; Plants - 459; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink).  |
AT1G27480 | AT1G27480.1 | ATGCCACGTAG | lecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); Has 852 Blast hits to 847 proteins in 171 species: Archae - 0; Bacteria - 22; Metazoa - 582; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT1G28540 | AT1G28540.1 | CTGCCACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G29330 | AT1G29330.1 | ATTGCCACGTCATC | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves.  |
AT1G29920 | AT1G29920.1 | ATTGCCACGTA | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II.  |
AT1G30110 | AT1G30110.1 | TACACGTGGCAA | ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 25 (ATNUDX25); FUNCTIONS IN: bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: diadenosine tetraphosphate catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 4194 Blast hits to 4194 proteins in 805 species: Archae - 14; Bacteria - 2251; Metazoa - 23; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1859 (source: NCBI BLink).  |
AT1G30520 | AT1G30520.1 | CTGCCACGTCATC | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal.  |
AT1G31230 | AT1G31230.1 | TACACGTGGCAA | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.  |
AT1G31480 | AT1G31480.1 | CTACGTGGCAG | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole.  |
AT1G32550 | AT1G32550.1 | TTGCCACGTAG | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).  |
AT1G32550.2 | TTGCCACGTAG | ferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).  | |
AT1G32560 | AT1G32560.1 | CTACGTGGCAA | late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT2G35300.1); Has 190 Blast hits to 190 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G35720 | AT1G35720.1 | AACACGTGGCAG | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion.  |
AT1G43670 | AT1G43670.1 | CTGCCACGTGTCAT | fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: carbohydrate metabolic process, fructose metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT3G54050.1); Has 2339 Blast hits to 2334 proteins in 798 species: Archae - 22; Bacteria - 1225; Metazoa - 341; Fungi - 107; Plants - 205; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink).  |
AT1G47550 | AT1G47550.1 | TTGCCACGTA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, exocyst; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47560.1); Has 295 Blast hits to 291 proteins in 116 species: Archae - 3; Bacteria - 6; Metazoa - 134; Fungi - 71; Plants - 54; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).  |
AT1G48300 | AT1G48300.1 | CTACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 68 Blast hits to 62 proteins in 29 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 2; Plants - 37; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT1G48300.1 | TTCCACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 68 Blast hits to 62 proteins in 29 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 2; Plants - 37; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  | |
AT1G49330 | AT1G49330.1 | ACCACGTGGCAC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16190.1); Has 840 Blast hits to 686 proteins in 130 species: Archae - 0; Bacteria - 47; Metazoa - 222; Fungi - 69; Plants - 342; Viruses - 66; Other Eukaryotes - 94 (source: NCBI BLink).  |
AT1G51400 | AT1G51400.1 | AGACACGTGGCAA | photosystem II 5 kD protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to UV-B, response to wounding, response to ozone; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSBTN (photosystem II subunit T) (TAIR:AT3G21055.1); Has 59 Blast hits to 59 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G52220 | AT1G52220.1 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G52220.1 | CTGCCACGTGGCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G52220.2 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G52220.2 | CTGCCACGTGGCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G52220.3 | ATGCCACGTGGAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G52220.3 | CTGCCACGTGGCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G52230 | AT1G52230.1 | ATCCACGTGGCAT | PHOTOSYSTEM I SUBUNIT H2 (PSAH2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem I reaction centre subunit VI (InterPro:IPR004928); BEST Arabidopsis thaliana protein match is: PSAH-1 (photosystem I subunit H-1) (TAIR:AT3G16140.1); Has 72 Blast hits to 72 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G52230.1 | TCGCCACGTGGCAG | PHOTOSYSTEM I SUBUNIT H2 (PSAH2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem I reaction centre subunit VI (InterPro:IPR004928); BEST Arabidopsis thaliana protein match is: PSAH-1 (photosystem I subunit H-1) (TAIR:AT3G16140.1); Has 72 Blast hits to 72 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G52590 | AT1G52590.1 | ATGACGTGGCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).  |
AT1G52600 | AT1G52600.1 | ATGCCACGTCAT | signal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT1G53170 | AT1G53170.1 | AACACGTGGCAA | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.  |
AT1G53400 | AT1G53400.1 | GTGACGTGGCAA | unknown protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45740.1); Has 229 Blast hits to 229 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 40; Plants - 47; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT1G53670 | AT1G53670.1 | CGACGTGGCAG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink).  |
AT1G53670.2 | CGACGTGGCAG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink).  | |
AT1G54200 | AT1G54200.1 | AACACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13980.1); Has 1298 Blast hits to 515 proteins in 102 species: Archae - 0; Bacteria - 43; Metazoa - 442; Fungi - 73; Plants - 54; Viruses - 0; Other Eukaryotes - 686 (source: NCBI BLink).  |
AT1G55265 | AT1G55265.1 | TACACGTGGCAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19860.1); Has 266 Blast hits to 266 proteins in 15 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 259; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G55520 | AT1G55520.1 | AACACGTGGCAG | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex.  |
AT1G55520.2 | AACACGTGGCAG | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex.  | |
AT1G56220 | AT1G56220.1 | ATCCACGTGGCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G56220.2 | ATCCACGTGGCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G56220.3 | ATCCACGTGGCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G56220.4 | ATCCACGTGGCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G59950 | AT1G59950.1 | TACACGTGGCAT | aldo/keto reductase, putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase, putative (TAIR:AT1G59960.1); Has 11553 Blast hits to 11538 proteins in 1272 species: Archae - 159; Bacteria - 6414; Metazoa - 1616; Fungi - 1065; Plants - 853; Viruses - 0; Other Eukaryotes - 1446 (source: NCBI BLink).  |
AT1G61520 | AT1G61520.1 | ATTGCCACGTGGAC | PSI type III chlorophyll a/b-binding protein (Lhca3*1)  |
AT1G61520.2 | ATTGCCACGTGGAC | PSI type III chlorophyll a/b-binding protein (Lhca3*1)  | |
AT1G63290 | AT1G63290.1 | GTGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT3G01850.2); Has 6133 Blast hits to 6130 proteins in 1420 species: Archae - 32; Bacteria - 2852; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink).  |
AT1G67090 | AT1G67090.1 | TTCCACGTGGCAT | RIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).  |
AT1G67090.2 | TTCCACGTGGCAT | RIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).  | |
AT1G67700 | AT1G67700.1 | AACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G67700.2 | AACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT1G67785 | AT1G67785.1 | CGACACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G67960 | AT1G67960.1 | AACACGTGGCAG | EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  |
AT1G70480 | AT1G70480.1 | AAAACGACACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT1G70480.2 | AAAACGACACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT1G72650 | AT1G72650.1 | CTGACGTGGCAAT | Arabidopsis thaliana myb family transcription factor (At1g72650)  |
AT1G72650.2 | CTGACGTGGCAAT | Arabidopsis thaliana myb family transcription factor (At1g72650)  | |
AT1G73120 | AT1G73120.1 | ATGCCACGTGGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, cultured cell; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G73570 | AT1G73570.1 | ACGTGGCAAT | suppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G18260.1); Has 10975 Blast hits to 4576 proteins in 759 species: Archae - 0; Bacteria - 7044; Metazoa - 503; Fungi - 430; Plants - 71; Viruses - 21; Other Eukaryotes - 2906 (source: NCBI BLink).  |
AT1G74730 | AT1G74730.1 | CTGACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT1G74880 | AT1G74880.1 | TACGTGGCAT | Encodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly.  |
AT1G75440 | AT1G75440.1 | GTACACGTGGCAT | ubiquitin-conjugating enzyme 16 (UBC16); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC18 (ubiquitin-conjugating enzyme 18); small conjugating protein ligase/ ubiquitin-protein ligase (TAIR:AT5G42990.1); Has 6497 Blast hits to 6496 proteins in 295 species: Archae - 0; Bacteria - 2; Metazoa - 3150; Fungi - 1284; Plants - 976; Viruses - 16; Other Eukaryotes - 1069 (source: NCBI BLink).  |
AT1G75460 | AT1G75460.1 | CACGTGGCAT | ATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); BEST Arabidopsis thaliana protein match is: ATP-dependent protease La (LON) domain-containing protein (TAIR:AT1G19740.1); Has 2926 Blast hits to 2926 proteins in 561 species: Archae - 0; Bacteria - 1066; Metazoa - 150; Fungi - 29; Plants - 57; Viruses - 0; Other Eukaryotes - 1624 (source: NCBI BLink).  |
AT1G76020 | AT1G76020.1 | CTGCCACGTCAC | INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20225.1); Has 118 Blast hits to 116 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 12; Fungi - 4; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT1G76030 | AT1G76030.1 | GTGACGTGGCAG | Encodes the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus.  |
AT1G76100 | AT1G76100.1 | ATGCCACGTCAC | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions.  |
AT1G76540 | AT1G76540.1 | TACGTGGCAA | Encodes a cyclin-dependent protein kinase involved in regulation of the G2/M transition of the mitotic cell cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot meristem, young leaves and vascular tissue during the G2/M phase. Required for proper organization of the shoot apical meristem and for hormone signaling.  |
AT1G77120 | AT1G77120.1 | ATGCCACGTGGAC | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.  |
AT1G77370 | AT1G77370.1 | TTGCCACGTGTCAT | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G20500.1); Has 4324 Blast hits to 4321 proteins in 856 species: Archae - 10; Bacteria - 1999; Metazoa - 364; Fungi - 233; Plants - 336; Viruses - 107; Other Eukaryotes - 1275 (source: NCBI BLink).  |
AT1G77450 | AT1G77450.1 | CTGCCACGTGTCC | Arabidopsis NAC domain containing protein 32 (anac032); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ATAF1; transcription activator/ transcription factor (TAIR:AT1G01720.1); Has 1620 Blast hits to 1617 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1620; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G77810 | AT1G77810.1 | ATGACGTGGCAT | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT1G77810.2 | ATGACGTGGCAT | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT1G78040 | AT1G78040.1 | ATGCCACGT | pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G78040.2 | ATGCCACGT | pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G78140 | AT1G78140.1 | CTGCCACGTGTGA | methyltransferase-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase-related (TAIR:AT2G41040.1); Has 3459 Blast hits to 3458 proteins in 853 species: Archae - 143; Bacteria - 2524; Metazoa - 44; Fungi - 102; Plants - 117; Viruses - 0; Other Eukaryotes - 529 (source: NCBI BLink).  |
AT1G78150 | AT1G78150.1 | TCACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G78150.2 | TCACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G79040 | AT1G79040.1 | CTACGTGGCAT | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ.  |
AT1G79040.1 | CTACGTGGCAT | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ.  | |
AT1G79340 | AT1G79340.1 | ATGCCACGTCAG | metacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).  |
AT1G79440 | AT1G79440.1 | CGGTTAAACTGCCACGTGGAT | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004).  |
AT1G80480 | AT1G80480.1 | ATGCCACGTG | PLASTID TRANSCRIPTIONALLY ACTIVE17 (PTAC17); LOCATED IN: plastid chromosome, chloroplast stroma, chloroplast, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); BEST Arabidopsis thaliana protein match is: PRLI-interacting factor L, putative (TAIR:AT1G15730.1); Has 18597 Blast hits to 10859 proteins in 1179 species: Archae - 146; Bacteria - 6676; Metazoa - 2747; Fungi - 687; Plants - 516; Viruses - 15; Other Eukaryotes - 7810 (source: NCBI BLink).  |
AT1G80580 | AT1G80580.1 | ATTGCCACGTCAAAACGC | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.  |
AT1G80610 | AT1G80610.1 | ATGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15800.1); Has 41 Blast hits to 39 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT2G01420 | AT2G01420.1 | TTGCCACGTGTCC | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452).  |
AT2G01420.2 | TTGCCACGTGTCC | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452).  | |
AT2G01860 | AT2G01860.1 | TTGCCACGTA | EMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
AT2G02180 | AT2G02180.1 | GTGCCACGTGGA | Necessary for the efficient multiplication of tobamoviruses.  |
AT2G04032 | AT2G04032.1 | ACGTGGCAC | ZINC TRANSPORTER 7 PRECURSOR (ZIP7); FUNCTIONS IN: cation transmembrane transporter activity, zinc ion transmembrane transporter activity, metal ion transmembrane transporter activity; INVOLVED IN: cation transport, zinc ion transport, metal ion transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease, fungal and plant (InterPro:IPR004698), Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: IRT1 (iron-regulated transporter 1); cadmium ion transmembrane transporter/ copper uptake transmembrane transporter/ iron ion transmembrane transporter/ manganese ion transmembrane transporter/ zinc ion transmembrane transporter (TAIR:AT4G19690.2); Has 1314 Blast hits to 1247 proteins in 219 species: Archae - 0; Bacteria - 98; Metazoa - 346; Fungi - 382; Plants - 314; Viruses - 0; Other Eukaryotes - 174 (source: NCBI BLink).  |
AT2G04350 | AT2G04350.1 | ACGTGGCAA | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).  |
AT2G04350.2 | ACGTGGCAA | long-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).  | |
AT2G04550 | AT2G04550.1 | TCCACGTGGCAC | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid.  |
AT2G04550.3 | TCCACGTGGCAC | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid.  | |
AT2G06520 | AT2G06520.1 | CTGCCACGTA | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX.  |
AT2G15695 | AT2G15695.1 | ATGACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF829, eukaryotic (InterPro:IPR008547); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44250.1); Has 84 Blast hits to 84 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT2G15970 | AT2G15970.1 | CTGCCACGTGGCGT | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment.  |
AT2G20260 | AT2G20260.1 | TTGCCACGTCATC | Encodes subunit E of photosystem I.  |
AT2G20770 | AT2G20770.1 | ATGCCACGT | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase.  |
AT2G21330 | AT2G21330.1 | ATCCACGTGGCAA | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).  |
AT2G21330.2 | ATCCACGTGGCAA | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).  | |
AT2G21330.3 | ATCCACGTGGCAA | fructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).  | |
AT2G21410 | AT2G21410.1 | TACGTGGCAG | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast.  |
AT2G22470 | AT2G22470.1 | AACACGTGGCAG | Encodes arabinogalactan-protein (AGP2).  |
AT2G27590 | AT2G27590.1 | GGGCCTACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 78 Blast hits to 78 proteins in 13 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT2G29300 | AT2G29300.1 | ATGCCACGTA | tropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29320.1); Has 77732 Blast hits to 77581 proteins in 2156 species: Archae - 464; Bacteria - 43191; Metazoa - 4073; Fungi - 3687; Plants - 1470; Viruses - 5; Other Eukaryotes - 24842 (source: NCBI BLink).  |
AT2G29550 | AT2G29550.1 | TACGTGGCAT | Encodes a beta-tubulin that is expressed in leaves, roots and flowers.  |
AT2G31580 | AT2G31580.1 | TACGTGGCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: tRNAHis guanylyltransferase (InterPro:IPR007537); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32320.1); Has 640 Blast hits to 336 proteins in 155 species: Archae - 65; Bacteria - 47; Metazoa - 212; Fungi - 176; Plants - 43; Viruses - 2; Other Eukaryotes - 95 (source: NCBI BLink).  |
AT2G32080 | AT2G32080.1 | TACGTGGCAT | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication  |
AT2G32080.2 | TACGTGGCAT | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication  | |
AT2G33180 | AT2G33180.1 | TTGCCACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT2G34250 | AT2G34250.1 | GACGTGGCAG | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink).  |
AT2G34250.2 | GACGTGGCAG | protein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink).  | |
AT2G34460 | AT2G34460.1 | TTGCCACGTGGCGT | flavin reductase-related; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT3G18890.1); Has 2946 Blast hits to 2906 proteins in 716 species: Archae - 28; Bacteria - 1803; Metazoa - 133; Fungi - 58; Plants - 295; Viruses - 0; Other Eukaryotes - 629 (source: NCBI BLink).  |
AT2G34620 | AT2G34620.1 | GTGCCACGTGGAA | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G03050.1); Has 469 Blast hits to 329 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 400; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  |
AT2G34620.1 | GTGCCACGTGTT | mitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G03050.1); Has 469 Blast hits to 329 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 400; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).  | |
AT2G35290 | AT2G35290.1 | TTGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; Has 25 Blast hits to 25 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G36305 | AT2G36305.1 | ACGTGGCAC | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast.  |
AT2G36390 | AT2G36390.1 | TACACGTGGCAG | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues.  |
AT2G36895 | AT2G36895.1 | CACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G36895.2 | CACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G37250 | AT2G37250.1 | ATGCCACGTCAG | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth  |
AT2G38000 | AT2G38000.1 | TCACACGTGGCAAT | chaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).  |
AT2G40420 | AT2G40420.1 | ATGCCACGTA | Encodes a putative amino acid transporter.  |
AT2G40490 | AT2G40490.1 | ATGACGTGGCAG | HEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink).  |
AT2G42220 | AT2G42220.1 | TACGTGGCAAT | rhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT3G08920.1); Has 686 Blast hits to 686 proteins in 102 species: Archae - 12; Bacteria - 169; Metazoa - 1; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).  |
AT2G42750 | AT2G42750.1 | TTGCCACGTCAGC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1); Has 11990 Blast hits to 11989 proteins in 1806 species: Archae - 113; Bacteria - 4757; Metazoa - 2272; Fungi - 965; Plants - 810; Viruses - 15; Other Eukaryotes - 3058 (source: NCBI BLink).  |
AT2G43400 | AT2G43400.1 | TTGCCACGTCATC | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods.  |
AT2G45730 | AT2G45730.1 | ACCACGTGGCAC | eukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT2G45740 | AT2G45740.1 | GTGCCACGTGGT | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.  |
AT2G45740.2 | GTGCCACGTGGT | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.  | |
AT2G45740.3 | GTGCCACGTGGT | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.  | |
AT2G45820 | AT2G45820.1 | GTGACGTGGCAT | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / remorin family protein (TAIR:AT3G61260.1); Has 2170 Blast hits to 1469 proteins in 249 species: Archae - 2; Bacteria - 278; Metazoa - 371; Fungi - 179; Plants - 300; Viruses - 4; Other Eukaryotes - 1036 (source: NCBI BLink).  |
AT2G46910 | AT2G46910.1 | CTGCCACGTA | plastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 169 Blast hits to 169 proteins in 57 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT2G47400 | AT2G47400.1 | GTACACGTGGCAA | CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The annotation of this gene is based on article 32494.  |
AT2G47780 | AT2G47780.1 | ATGCCACGTGGCT | rubber elongation factor (REF) protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) family protein (TAIR:AT3G05500.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G01090 | AT3G01090.1 | ATGCCACGTC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase  |
AT3G01090.2 | ATGCCACGTC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase  | |
AT3G01090.3 | ATGCCACGTC | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase  | |
AT3G01280 | AT3G01280.1 | TTGCCACGTA | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol.  |
AT3G01570 | AT3G01570.1 | GTGCCACGTCAC | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO2 (OLEOSIN 2) (TAIR:AT5G40420.1); Has 384 Blast hits to 384 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G01850 | AT3G01850.1 | ATGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink).  |
AT3G01850.2 | ATGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink).  | |
AT3G01990 | AT3G01990.1 | GTGCCACGTCATC | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding.  |
AT3G02020 | AT3G02020.1 | ATGCCACGTA | encodes a monofunctional aspartate kinase  |
AT3G02540 | AT3G02540.1 | ACCACGTGGCAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  |
AT3G02540.2 | ACCACGTGGCAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  | |
AT3G02990 | AT3G02990.1 | GTGCCACGTA | member of Heat Stress Transcription Factor (Hsf) family  |
AT3G03590 | AT3G03590.1 | ACGTCGTCACGTGGCAG | SWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT2G35605.1); Has 852 Blast hits to 809 proteins in 169 species: Archae - 0; Bacteria - 136; Metazoa - 165; Fungi - 132; Plants - 207; Viruses - 8; Other Eukaryotes - 204 (source: NCBI BLink).  |
AT3G04040 | AT3G04040.1 | TAATTACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1); Has 32 Blast hits to 32 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G04420 | AT3G04420.1 | GTGCCACGTA | Arabidopsis NAC domain containing protein 48 (anac048); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC003 (Arabidopsis NAC domain containing protein 3); transcription factor (TAIR:AT1G02220.1); Has 1450 Blast hits to 1439 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1449; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G04420.2 | GTGCCACGTA | Arabidopsis NAC domain containing protein 48 (anac048); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC003 (Arabidopsis NAC domain containing protein 3); transcription factor (TAIR:AT1G02220.1); Has 1450 Blast hits to 1439 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1449; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT3G05200 | AT3G05200.1 | TTGCCACGTGGAA | Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6).  |
AT3G05260 | AT3G05260.1 | ACGTGGCACGTCAC | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: binding / catalytic/ oxidoreductase (TAIR:AT1G54870.1); Has 80754 Blast hits to 80610 proteins in 2221 species: Archae - 465; Bacteria - 44840; Metazoa - 4442; Fungi - 3990; Plants - 1473; Viruses - 7; Other Eukaryotes - 25537 (source: NCBI BLink).  |
AT3G05520 | AT3G05520.1 | GCCACGTGGCAC | F-actin capping protein alpha subunit family protein; FUNCTIONS IN: actin binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: F-actin capping protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: F-actin capping protein, alpha subunit, actin binding (InterPro:IPR018315), F-actin capping protein, alpha subunit (InterPro:IPR002189), F-actin capping protein, alpha subunit, conserved site (InterPro:IPR017865).  |
AT3G05520.2 | GCCACGTGGCAC | F-actin capping protein alpha subunit family protein; FUNCTIONS IN: actin binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: F-actin capping protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: F-actin capping protein, alpha subunit, actin binding (InterPro:IPR018315), F-actin capping protein, alpha subunit (InterPro:IPR002189), F-actin capping protein, alpha subunit, conserved site (InterPro:IPR017865).  | |
AT3G06570 | AT3G06570.1 | CTGCCACGTA | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT5G51250.1); Has 541 Blast hits to 526 proteins in 21 species: Archae - 0; Bacteria - 5; Metazoa - 6; Fungi - 0; Plants - 528; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G07090 | AT3G07090.1 | GACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25170.1); Has 596 Blast hits to 596 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 84; Plants - 173; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).  |
AT3G07360 | AT3G07360.1 | ATGACGTGGCAA | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.  |
AT3G07360.2 | ATGACGTGGCAA | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.  | |
AT3G07360.3 | ATGACGTGGCAA | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.  | |
AT3G07680 | AT3G07680.1 | ATGACGTGGCAAT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 protein-related (TAIR:AT3G22845.1); Has 672 Blast hits to 672 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink).  |
AT3G08960 | AT3G08960.1 | TACGTGGCAA | binding / protein transporter; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT1G26170.1); Has 1034 Blast hits to 933 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 468; Fungi - 402; Plants - 81; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).  |
AT3G10110 | AT3G10110.1 | ACGTGGCAC | maternal effect embryo arrest 67 (MEE67); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: embryonic development ending in seed dormancy, protein transport; LOCATED IN: mitochondrial inner membrane, chloroplast, mitochondrial inner membrane presequence translocase complex; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT1G18320.1); Has 509 Blast hits to 509 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 226; Fungi - 159; Plants - 86; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT3G10410 | AT3G10410.1 | CTGCCACGTGTAC | serine carboxypeptidase-like 49 (scpl49); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2453 Blast hits to 2354 proteins in 260 species: Archae - 0; Bacteria - 98; Metazoa - 602; Fungi - 570; Plants - 872; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink).  |
AT3G11397 | AT3G11397.1 | CTGCCACGTCATC | PRENYLATED RAB ACCEPTOR 1.A3 (PRA1.A3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum, membrane; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 234 Blast hits to 234 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G11670 | AT3G11670.1 | ATGCCACGT | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE).  |
AT3G11670.2 | ATGCCACGT | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE).  | |
AT3G11900 | AT3G11900.1 | GTGCCACGTCAC | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters.  |
AT3G12210 | AT3G12210.1 | CTGCCACGTGGCTTTAT | sequence-specific DNA binding; FUNCTIONS IN: sequence-specific DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583); Has 163 Blast hits to 163 proteins in 72 species: Archae - 1; Bacteria - 0; Metazoa - 86; Fungi - 51; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT3G12210.2 | CTGCCACGTGGCTTTAT | sequence-specific DNA binding; FUNCTIONS IN: sequence-specific DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583); Has 163 Blast hits to 163 proteins in 72 species: Archae - 1; Bacteria - 0; Metazoa - 86; Fungi - 51; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT3G12300 | AT3G12300.1 | AGACACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
AT3G13040 | AT3G13040.1 | CTACGTGGCAA | myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 1402 Blast hits to 1356 proteins in 112 species: Archae - 2; Bacteria - 14; Metazoa - 251; Fungi - 38; Plants - 910; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).  |
AT3G13040.2 | CTACGTGGCAA | myb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 1402 Blast hits to 1356 proteins in 112 species: Archae - 2; Bacteria - 14; Metazoa - 251; Fungi - 38; Plants - 910; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).  | |
AT3G13670 | AT3G13670.1 | CTGACGTGGCAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G25760.1); Has 12090 Blast hits to 12038 proteins in 826 species: Archae - 10; Bacteria - 3127; Metazoa - 4213; Fungi - 955; Plants - 1425; Viruses - 207; Other Eukaryotes - 2153 (source: NCBI BLink).  |
AT3G13700 | AT3G13700.1 | GACGTGGCAG | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT3G13700.2 | GACGTGGCAG | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  | |
AT3G13710 | AT3G13710.1 | GACGTGGCAG | PRENYLATED RAB ACCEPTOR 1.F4 (PRA1.F4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA8 (TAIR:AT3G13720.1); Has 294 Blast hits to 294 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 30; Plants - 172; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT3G13980 | AT3G13980.1 | AGACACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G54200.1); Has 1723 Blast hits to 368 proteins in 83 species: Archae - 0; Bacteria - 6; Metazoa - 456; Fungi - 56; Plants - 60; Viruses - 6; Other Eukaryotes - 1139 (source: NCBI BLink).  |
AT3G14067 | AT3G14067.1 | GACGTGGCAT | subtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast, plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4847 Blast hits to 4214 proteins in 722 species: Archae - 147; Bacteria - 2629; Metazoa - 66; Fungi - 489; Plants - 902; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink).  |
AT3G14070 | AT3G14070.1 | ATGCCACGTC | Involved in cation (K, Na and Mn) homeostasis and transport  |
AT3G14595 | AT3G14595.1 | AAAAAGCCACGTGGCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G17080.1); Has 81 Blast hits to 81 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT3G14930 | AT3G14930.1 | TACGTGGCAT | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).  |
AT3G14930.2 | TACGTGGCAT | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).  | |
AT3G14930.3 | TACGTGGCAT | HEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).  | |
AT3G15090 | AT3G15090.1 | CTGCCACGTC | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink).  |
AT3G15210 | AT3G15210.1 | AACACGTGGCAA | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation.  |
AT3G15250 | AT3G15250.1 | TTGCCACGTGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53163.1); Has 475 Blast hits to 212 proteins in 55 species: Archae - 0; Bacteria - 19; Metazoa - 271; Fungi - 73; Plants - 18; Viruses - 1; Other Eukaryotes - 93 (source: NCBI BLink).  |
AT3G15670 | AT3G15670.1 | TTGCCACGTAG | late embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleus; EXPRESSED DURING: dry seed stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT1G52690.2); Has 9791 Blast hits to 5043 proteins in 926 species: Archae - 24; Bacteria - 3928; Metazoa - 1452; Fungi - 554; Plants - 1082; Viruses - 109; Other Eukaryotes - 2642 (source: NCBI BLink).  |
AT3G16140 | AT3G16140.1 | TTCCACGTGGCAT | Encodes subunit H of photosystem I reaction center subunit VI.  |
AT3G16140.1 | TTGCCACGTGTCA | Encodes subunit H of photosystem I reaction center subunit VI.  | |
AT3G16990 | AT3G16990.1 | GTGCCACGTAATTA | TENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT3G17000 | AT3G17000.1 | TAATTACGTGGCAC | ubiquitin-conjugating enzyme 32 (UBC32); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5810 Blast hits to 5810 proteins in 294 species: Archae - 0; Bacteria - 0; Metazoa - 2855; Fungi - 1053; Plants - 896; Viruses - 16; Other Eukaryotes - 990 (source: NCBI BLink).  |
AT3G17810 | AT3G17810.1 | CACGTGGCAT | dihydroorotate dehydrogenase family protein / dihydroorotate oxidase family protein; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, catalytic activity, dihydroorotate oxidase activity, dihydroorotate dehydrogenase activity; INVOLVED IN: 'de novo' pyrimidine base biosynthetic process, UMP biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Dihydroorotate dehydrogenase, classes 1 and 2 (InterPro:IPR012135), Dihydroorotate dehydrogenase, class 1, core (InterPro:IPR005720); Has 3539 Blast hits to 3539 proteins in 1009 species: Archae - 112; Bacteria - 2115; Metazoa - 241; Fungi - 79; Plants - 25; Viruses - 0; Other Eukaryotes - 967 (source: NCBI BLink).  |
AT3G18750 | AT3G18750.1 | ATGCCACGTGTA | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.  |
AT3G18750.2 | ATGCCACGTGTA | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.  | |
AT3G19000 | AT3G19000.1 | TACGTGGCAT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G19010.1); Has 6199 Blast hits to 6163 proteins in 694 species: Archae - 0; Bacteria - 740; Metazoa - 132; Fungi - 658; Plants - 3109; Viruses - 0; Other Eukaryotes - 1560 (source: NCBI BLink).  |
AT3G19000.2 | TACGTGGCAT | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G19010.1); Has 6199 Blast hits to 6163 proteins in 694 species: Archae - 0; Bacteria - 740; Metazoa - 132; Fungi - 658; Plants - 3109; Viruses - 0; Other Eukaryotes - 1560 (source: NCBI BLink).  | |
AT3G19100 | AT3G19100.1 | GACGTGGCAA | calcium-dependent protein kinase, putative / CDPK, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: calcium-dependent protein kinase, putative / CDPK, putative (TAIR:AT1G49580.1); Has 88782 Blast hits to 87368 proteins in 2426 species: Archae - 71; Bacteria - 8151; Metazoa - 38639; Fungi - 8417; Plants - 15332; Viruses - 469; Other Eukaryotes - 17703 (source: NCBI BLink).  |
AT3G19590 | AT3G19590.1 | ACGTCACGTGGCAAT | WD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink).  |
AT3G20910 | AT3G20910.1 | CACGTGGCAG | NUCLEAR FACTOR Y, SUBUNIT A9 (NF-YA9); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); BEST Arabidopsis thaliana protein match is: NF-YA1 (NUCLEAR FACTOR Y, SUBUNIT A1); transcription factor (TAIR:AT5G12840.4); Has 452 Blast hits to 452 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 97; Plants - 214; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT3G22880 | AT3G22880.1 | ATGACGTGGCAT | Expression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. Similar to meiosis-specific yeast DMC gene.  |
AT3G22968 | AT3G22968.1 | CGACGTGGCAT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF59 represents a conserved upstream opening reading frame relative to major ORF AT3G22970.1  |
AT3G22970 | AT3G22970.1 | CGACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G22970.2 | CGACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT3G23700 | AT3G23700.1 | ATGCCACGTCAC | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: response to cold; LOCATED IN: chloroplast stroma, nucleus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: RPS1 (RIBOSOMAL PROTEIN S1); RNA binding / structural constituent of ribosome (TAIR:AT5G30510.1); Has 19049 Blast hits to 12627 proteins in 1560 species: Archae - 136; Bacteria - 11493; Metazoa - 155; Fungi - 150; Plants - 198; Viruses - 0; Other Eukaryotes - 6917 (source: NCBI BLink).  |
AT3G24190 | AT3G24190.1 | TTGCCACGTGGAC | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Aminoglycoside phosphotransferase (InterPro:IPR002575), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7527 Blast hits to 7489 proteins in 1103 species: Archae - 67; Bacteria - 2650; Metazoa - 374; Fungi - 312; Plants - 357; Viruses - 14; Other Eukaryotes - 3753 (source: NCBI BLink).  |
AT3G24503 | AT3G24503.1 | ACGTGGCAA | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively  |
AT3G24929 | AT3G24929.1 | TTGCCACGTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown.  |
AT3G25840 | AT3G25840.1 | ATGCCACGT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G13350.1); Has 132242 Blast hits to 94068 proteins in 2209 species: Archae - 141; Bacteria - 10146; Metazoa - 64521; Fungi - 15048; Plants - 10889; Viruses - 745; Other Eukaryotes - 30752 (source: NCBI BLink).  |
AT3G27210 | AT3G27210.1 | GTGCCACGTGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40860.1); Has 132 Blast hits to 70 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 65; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT3G27260 | AT3G27260.1 | ATTGCCACGTAG | Kinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain  |
AT3G46780 | AT3G46780.1 | ATGACGTGGCAT | PLASTID TRANSCRIPTIONALLY ACTIVE 16 (PTAC16); FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT3G18890.1); Has 939 Blast hits to 790 proteins in 244 species: Archae - 1; Bacteria - 344; Metazoa - 68; Fungi - 66; Plants - 99; Viruses - 22; Other Eukaryotes - 339 (source: NCBI BLink).  |
AT3G48260 | AT3G48260.1 | TTGCCACGTGGT | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases.  |
AT3G48990 | AT3G48990.1 | AACACGTGGCAT | AMP-dependent synthetase and ligase family protein; FUNCTIONS IN: catalytic activity, AMP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: apoplast, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate--CoA ligase, putative / 4-coumaroyl-CoA synthase, putative (TAIR:AT4G05160.1); Has 56117 Blast hits to 51778 proteins in 2278 species: Archae - 561; Bacteria - 29860; Metazoa - 2967; Fungi - 3087; Plants - 1292; Viruses - 1; Other Eukaryotes - 18349 (source: NCBI BLink).  |
AT3G50920 | AT3G50920.1 | ATGCCACGTGGAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT3G50920.2 | ATGCCACGTGGAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  | |
AT3G52880 | AT3G52880.1 | ACGTGGCAC | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2  |
AT3G52880.1 | ATTGCCACGTGTA | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2  | |
AT3G52880.2 | ACGTGGCAC | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2  | |
AT3G52880.2 | ATTGCCACGTGTA | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2  | |
AT3G54440 | AT3G54440.1 | ACGACACCACGTGGCAT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  |
AT3G54440.2 | ACGACACCACGTGGCAT | glycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).  | |
AT3G54500 | AT3G54500.1 | CTGACGTGGCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G54500.2 | CTGACGTGGCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT3G55660 | AT3G55660.1 | CTGACGTGGCAG | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.  |
AT3G55800 | AT3G55800.1 | CTGCCACGTGTCAC | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type.  |
AT3G56580 | AT3G56580.1 | AGACACGTGGCACGTGGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink).  |
AT3G56580.2 | AGACACGTGGCACGTGGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink).  | |
AT3G56580.3 | AGACACGTGGCACGTGGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: RHC1A; protein binding / zinc ion binding (TAIR:AT2G40830.3); Has 7019 Blast hits to 6954 proteins in 216 species: Archae - 0; Bacteria - 6; Metazoa - 2420; Fungi - 600; Plants - 2628; Viruses - 11; Other Eukaryotes - 1354 (source: NCBI BLink).  | |
AT3G57010 | AT3G57010.1 | TACGTGGCAC | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT3G57020.1); Has 704 Blast hits to 697 proteins in 135 species: Archae - 1; Bacteria - 128; Metazoa - 196; Fungi - 0; Plants - 299; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).  |
AT3G57520 | AT3G57520.1 | ATGACACGTGGCAA | Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT3G57520.2 | ATGACACGTGGCAA | Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT3G57520.3 | ATGACACGTGGCAA | Arabidopsis thaliana seed imbibition 2 (AtSIP2); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Raffinose synthase (InterPro:IPR008811); BEST Arabidopsis thaliana protein match is: AtSIP1 (Arabidopsis thaliana seed imbibition 1); hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G55740.1); Has 272 Blast hits to 257 proteins in 79 species: Archae - 9; Bacteria - 35; Metazoa - 0; Fungi - 51; Plants - 171; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT3G58980 | AT3G58980.1 | TTGCCACGTGGAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58920.1); Has 1321 Blast hits to 1026 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 1320; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G61260 | AT3G61260.1 | TACGTGGCAT | DNA-binding family protein / remorin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G45820.1); Has 7363 Blast hits to 4653 proteins in 692 species: Archae - 12; Bacteria - 1846; Metazoa - 1409; Fungi - 602; Plants - 495; Viruses - 172; Other Eukaryotes - 2827 (source: NCBI BLink).  |
AT3G61470 | AT3G61470.1 | TTGCCACGTG | Encodes a component of the light harvesting antenna complex of photosystem I.  |
AT3G63340 | AT3G63340.1 | CTGCCACGTAG | protein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C, N-terminal (InterPro:IPR014045), Protein phosphatase 2C (InterPro:IPR015655); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C-related / PP2C-related (TAIR:AT3G63320.1); Has 3271 Blast hits to 3269 proteins in 215 species: Archae - 0; Bacteria - 0; Metazoa - 1075; Fungi - 380; Plants - 1004; Viruses - 5; Other Eukaryotes - 807 (source: NCBI BLink).  |
AT3G63520 | AT3G63520.1 | CGACGTGGCAGCGTTT | Encodes a protein with 9-<i>cis</i>-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-<i>trans</i>-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-<i>cis</i>-double or allenic bonds.  |
AT4G00170 | AT4G00170.1 | TACGTGGCAT | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 758 Blast hits to 742 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 363; Fungi - 101; Plants - 232; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT4G00370 | AT4G00370.1 | GTGCCACGTGTCAC | Encodes an inorganic phosphate transporter (PHT4;4).  |
AT4G00840 | AT4G00840.1 | GTACACGTGGCAC | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G60800.1); Has 3992 Blast hits to 3990 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1955; Fungi - 533; Plants - 396; Viruses - 0; Other Eukaryotes - 1108 (source: NCBI BLink).  |
AT4G00850 | AT4G00850.1 | GTGCCACGTGTAC | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA  |
AT4G00970 | AT4G00970.1 | TGACACGTGGCAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G21410.1); Has 85932 Blast hits to 84886 proteins in 3199 species: Archae - 45; Bacteria - 7229; Metazoa - 37779; Fungi - 6763; Plants - 18977; Viruses - 382; Other Eukaryotes - 14757 (source: NCBI BLink).  |
AT4G01550 | AT4G01550.1 | CTGCCACGTGTT | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G01550.2 | CTGCCACGTGTT | Arabidopsis NAC domain containing protein 69 (anac069); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NTM1 (NAC WITH TRANSMEMBRANE MOTIF1); transcription activator/ transcription factor (TAIR:AT4G01540.1); Has 1433 Blast hits to 1425 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1431; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G01590 | AT4G01590.1 | ATGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink).  |
AT4G01590.2 | ATGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink).  | |
AT4G01610 | AT4G01610.1 | ACGTGGCAAT | cathepsin B-like cysteine protease, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis, regulation of catalytic activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Peptidase C1A, cathepsin B (InterPro:IPR015643), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169), Peptidase C1A, propeptide (InterPro:IPR012599); BEST Arabidopsis thaliana protein match is: cathepsin B-like cysteine protease, putative (TAIR:AT1G02305.1); Has 5937 Blast hits to 5913 proteins in 579 species: Archae - 35; Bacteria - 71; Metazoa - 2792; Fungi - 4; Plants - 1131; Viruses - 129; Other Eukaryotes - 1775 (source: NCBI BLink).  |
AT4G01610.2 | ACGTGGCAAT | cathepsin B-like cysteine protease, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis, regulation of catalytic activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Peptidase C1A, cathepsin B (InterPro:IPR015643), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169), Peptidase C1A, propeptide (InterPro:IPR012599); BEST Arabidopsis thaliana protein match is: cathepsin B-like cysteine protease, putative (TAIR:AT1G02305.1); Has 5937 Blast hits to 5913 proteins in 579 species: Archae - 35; Bacteria - 71; Metazoa - 2792; Fungi - 4; Plants - 1131; Viruses - 129; Other Eukaryotes - 1775 (source: NCBI BLink).  | |
AT4G01800 | AT4G01800.1 | ATGACGTGGCAA | preprotein translocase secA subunit, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: intracellular protein transport, protein targeting, protein import; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecA Wing and Scaffold (InterPro:IPR011116), SecA preprotein cross-linking region (InterPro:IPR011130), SecA DEAD-like (InterPro:IPR011115), SecA motor DEAD (InterPro:IPR014018), SecA protein (InterPro:IPR000185); BEST Arabidopsis thaliana protein match is: ATP binding / protein binding (TAIR:AT1G21650.1); Has 15109 Blast hits to 10309 proteins in 1586 species: Archae - 2; Bacteria - 6696; Metazoa - 44; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 8307 (source: NCBI BLink).  |
AT4G02550 | AT4G02550.1 | ATGCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02550.2 | ATGCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G02550.3 | ATGCCACGTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G03020 | AT4G03020.1 | AAAGTCAAACGTGGCAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD repeat protein 23 (InterPro:IPR017399); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 27310 Blast hits to 15280 proteins in 497 species: Archae - 34; Bacteria - 3736; Metazoa - 12063; Fungi - 5373; Plants - 2263; Viruses - 0; Other Eukaryotes - 3841 (source: NCBI BLink).  |
AT4G03210 | AT4G03210.1 | CTACGTGGCAT | encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers.  |
AT4G03210.2 | CTACGTGGCAT | encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers.  | |
AT4G03560 | AT4G03560.1 | TTAAAGCCACGTGGCAA | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress.  |
AT4G04870 | AT4G04870.1 | TACACGTGGCAC | Encodes a protein with cardiolipin synthase activity that is localized to the mitochondiria.  |
AT4G05020 | AT4G05020.1 | ATGCCACGTGGT | NAD(P)H dehydrogenase B2 (NDB2); FUNCTIONS IN: disulfide oxidoreductase activity, oxidoreductase activity, FAD binding; LOCATED IN: extrinsic to mitochondrial inner membrane, mitochondrion; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), EF-HAND 1 (InterPro:IPR018247), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327), EF-HAND 2 (InterPro:IPR018249), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: NDB3; NADH dehydrogenase (TAIR:AT4G21490.1); Has 9447 Blast hits to 9170 proteins in 1455 species: Archae - 245; Bacteria - 6823; Metazoa - 105; Fungi - 514; Plants - 280; Viruses - 0; Other Eukaryotes - 1480 (source: NCBI BLink).  |
AT4G08230 | AT4G08230.1 | ATGCCACGTGACA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; Has 13979 Blast hits to 5534 proteins in 565 species: Archae - 19; Bacteria - 2070; Metazoa - 5921; Fungi - 772; Plants - 3540; Viruses - 122; Other Eukaryotes - 1535 (source: NCBI BLink).  |
AT4G09020 | AT4G09020.1 | CACGTGGCAAT | Encodes an isoamylase-like protein. Mutant studies show that the gene is strongly involved in starch breakdown. A GUS-protein fusion product was shown to localize to the surface of chloroplastic structures reminiscent of starch granules. In the mutants, the chloroplastic α-amylase AMY3 is upregulated.  |
AT4G09750 | AT4G09750.1 | CTACGTGGCAC | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G24050.1); Has 49720 Blast hits to 49652 proteins in 1938 species: Archae - 292; Bacteria - 27546; Metazoa - 4870; Fungi - 3259; Plants - 1240; Viruses - 0; Other Eukaryotes - 12513 (source: NCBI BLink).  |
AT4G10960 | AT4G10960.1 | ACCACGTGGCAT | Encodes a protein with UDP-D-glucose 4-epimerase activity.  |
AT4G10970 | AT4G10970.1 | GTGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).  |
AT4G10970.2 | GTGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).  | |
AT4G10970.3 | GTGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).  | |
AT4G10970.4 | GTGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).  | |
AT4G10970.5 | GTGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).  | |
AT4G10970.6 | GTGCCACGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).  | |
AT4G11570 | AT4G11570.1 | GACGTGGCAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  |
AT4G11570.2 | GACGTGGCAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).  | |
AT4G13010 | AT4G13010.1 | GTGACGTGGCAA | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink).  |
AT4G13010.1 | GTGACGTGGCAA | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink).  | |
AT4G13400 | AT4G13400.1 | CGACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G63290.1); Has 253 Blast hits to 253 proteins in 88 species: Archae - 0; Bacteria - 66; Metazoa - 16; Fungi - 72; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT4G14315 | AT4G14315.1 | AACACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G14620 | AT4G14620.1 | AAATGACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 217 Blast hits to 217 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G14622 | AT4G14622.1 | AAATGACGTGGCAT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF60 represents a conserved upstream opening reading frame relative to major ORF AT4G14620.1  |
AT4G14713 | AT4G14713.1 | TACGTGGCAG | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter.  |
AT4G14713.2 | TACGTGGCAG | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter.  | |
AT4G15470 | AT4G15470.1 | TTGCCACGTGTAC | EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: glutamate binding (TAIR:AT1G03070.1); Has 4000 Blast hits to 3999 proteins in 955 species: Archae - 0; Bacteria - 1775; Metazoa - 750; Fungi - 92; Plants - 143; Viruses - 77; Other Eukaryotes - 1163 (source: NCBI BLink).  |
AT4G16190 | AT4G16190.1 | ATGCCACGTGTT | cysteine proteinase, putative; FUNCTIONS IN: cysteine-type peptidase activity, cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: RD19 (RESPONSIVE TO DEHYDRATION 19); cysteine-type endopeptidase/ cysteine-type peptidase (TAIR:AT4G39090.1); Has 6049 Blast hits to 6013 proteins in 589 species: Archae - 27; Bacteria - 106; Metazoa - 2786; Fungi - 4; Plants - 1188; Viruses - 126; Other Eukaryotes - 1812 (source: NCBI BLink).  |
AT4G16330 | AT4G16330.1 | GTGCCACGTCAGC | oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G38240.1); Has 5424 Blast hits to 5410 proteins in 662 species: Archae - 0; Bacteria - 677; Metazoa - 111; Fungi - 490; Plants - 3015; Viruses - 0; Other Eukaryotes - 1131 (source: NCBI BLink).  |
AT4G19130 | AT4G19130.1 | TTGCCACGTCTTCCACGT | DNA binding / nucleic acid binding / zinc ion binding; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Replication factor-A, C-terminal (InterPro:IPR013955), Replication factor-a protein 1 Rpa1 (InterPro:IPR004591), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Zinc finger, CCHC-type (InterPro:IPR001878), Replication factor-A protein 1, N-terminal (InterPro:IPR007199); BEST Arabidopsis thaliana protein match is: replication protein, putative (TAIR:AT5G45400.1); Has 609 Blast hits to 584 proteins in 169 species: Archae - 16; Bacteria - 0; Metazoa - 189; Fungi - 98; Plants - 176; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).  |
AT4G19140 | AT4G19140.1 | ACGTGGAAGACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G19450 | AT4G19450.1 | TTGCCACGTA | nodulin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45275.1); Has 741 Blast hits to 716 proteins in 154 species: Archae - 15; Bacteria - 148; Metazoa - 7; Fungi - 113; Plants - 313; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).  |
AT4G19560 | AT4G19560.1 | TTGCCACGTA | CYCT1;2; FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: CYCT1;4; cyclin-dependent protein kinase (TAIR:AT4G19600.1); Has 1856 Blast hits to 1855 proteins in 191 species: Archae - 1; Bacteria - 2; Metazoa - 1187; Fungi - 285; Plants - 205; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).  |
AT4G19710 | AT4G19710.1 | AGACACGTGGCAG | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.  |
AT4G19710.2 | AGACACGTGGCAG | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.  | |
AT4G21280 | AT4G21280.1 | TTGCCACGTGGCTTTAA | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.  |
AT4G21280.2 | TTGCCACGTGGCTTTAA | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II.  | |
AT4G21320 | AT4G21320.1 | ATGACGTGGCAT | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment.  |
AT4G22240 | AT4G22240.1 | CACGTGGCAG | plastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: fruit, guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: FIB (FIBRILLIN); structural molecule (TAIR:AT4G04020.1); Has 296 Blast hits to 296 proteins in 63 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 219; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G22756 | AT4G22756.1 | ATGCCACGTCAC | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase.  |
AT4G22920 | AT4G22920.1 | AACACGTGGCAC | Similar to the tomato senescence-inducible chloroplast stay-green protein 1. It is upregulated during maximal senescence in the Arabidopsis life cycle, especially in senescent leaves.  |
AT4G23920 | AT4G23920.1 | CTGCCACGTAG | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis.  |
AT4G24800 | AT4G24800.1 | AACACGTGGCAA | MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT5G63190.2); Has 1429 Blast hits to 596 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 943; Fungi - 14; Plants - 365; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT4G24800.2 | AACACGTGGCAA | MA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT5G63190.2); Has 1429 Blast hits to 596 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 943; Fungi - 14; Plants - 365; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT4G25470 | AT4G25470.1 | ATCCACGTGGCAT | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway.  |
AT4G25580 | AT4G25580.1 | TACGTGGCATGACACGTGGT | stress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT4G25620 | AT4G25620.1 | GATGACGTGGCAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 844 Blast hits to 627 proteins in 148 species: Archae - 0; Bacteria - 72; Metazoa - 151; Fungi - 122; Plants - 173; Viruses - 60; Other Eukaryotes - 266 (source: NCBI BLink).  |
AT4G26630 | AT4G26630.1 | CTGACGTGGCAT | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink).  |
AT4G26630.2 | CTGACGTGGCAT | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink).  | |
AT4G27410 | AT4G27410.1 | GACGTGGCAG | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.  |
AT4G27410.2 | GACGTGGCAG | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.  | |
AT4G27410.3 | GACGTGGCAG | Encodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response.  | |
AT4G27440 | AT4G27440.1 | TAAACGACGACGTGGCAG | light-dependent NADPH:protochlorophyllide oxidoreductase B  |
AT4G27440.2 | TAAACGACGACGTGGCAG | light-dependent NADPH:protochlorophyllide oxidoreductase B  | |
AT4G27720 | AT4G27720.1 | ATGCCACGTA | LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64650.1); Has 496 Blast hits to 491 proteins in 183 species: Archae - 5; Bacteria - 234; Metazoa - 75; Fungi - 33; Plants - 96; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT4G28140 | AT4G28140.1 | ATGCCACGTA | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.  |
AT4G28660 | AT4G28660.1 | GTGCCACGTGTG | Similar to PsbW subunit of photosystem II.  |
AT4G28750 | AT4G28750.1 | GTACACGTGGCAG | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I  |
AT4G28860 | AT4G28860.1 | CTACGTGGCAA | Casein Kinase I-like 4 (ckl4); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl3 (Casein Kinase I-like 3); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28880.1); Has 49581 Blast hits to 49221 proteins in 1441 species: Archae - 25; Bacteria - 6110; Metazoa - 21777; Fungi - 5145; Plants - 5994; Viruses - 336; Other Eukaryotes - 10194 (source: NCBI BLink).  |
AT4G28860.2 | CTACGTGGCAA | Casein Kinase I-like 4 (ckl4); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl3 (Casein Kinase I-like 3); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28880.1); Has 49581 Blast hits to 49221 proteins in 1441 species: Archae - 25; Bacteria - 6110; Metazoa - 21777; Fungi - 5145; Plants - 5994; Viruses - 336; Other Eukaryotes - 10194 (source: NCBI BLink).  | |
AT4G29330 | AT4G29330.1 | CGACGTGGCAA | DERLIN-1 (DER1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 666 Blast hits to 665 proteins in 170 species: Archae - 0; Bacteria - 12; Metazoa - 290; Fungi - 127; Plants - 84; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink).  |
AT4G29330.1 | GTGCCACGTA | DERLIN-1 (DER1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 666 Blast hits to 665 proteins in 170 species: Archae - 0; Bacteria - 12; Metazoa - 290; Fungi - 127; Plants - 84; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink).  | |
AT4G29905 | AT4G29905.1 | TTGCCACGTCATC | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 41 Blast hits to 41 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30620 | AT4G30620.1 | TTCCACGTGGCAC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24020.1); Has 1303 Blast hits to 1303 proteins in 522 species: Archae - 0; Bacteria - 1050; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  |
AT4G30780 | AT4G30780.1 | AACACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24100.1); Has 52 Blast hits to 52 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT4G31330 | AT4G31330.1 | ATGCCACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10580.1); Has 252 Blast hits to 252 proteins in 85 species: Archae - 0; Bacteria - 139; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT4G32330 | AT4G32330.1 | ATGACGTGGCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink).  |
AT4G32330.2 | ATGACGTGGCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink).  | |
AT4G32330.3 | ATGACGTGGCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink).  | |
AT4G32410 | AT4G32410.1 | TTGCCACGTCAC | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis.  |
AT4G32760 | AT4G32760.1 | AACACGTGGCAAT | protein transporter; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT3G08790.1); Has 18386 Blast hits to 12933 proteins in 541 species: Archae - 4; Bacteria - 507; Metazoa - 7666; Fungi - 3474; Plants - 2212; Viruses - 64; Other Eukaryotes - 4459 (source: NCBI BLink).  |
AT4G32770 | AT4G32770.1 | TTGCCACGTA | Tocopherol cyclase involved in tocopherol (vitamin E)synthesis. VTE1 over-expressing plants have increased tocopherol indicating VTE1 is a major limiting factor in tocopherol synthesis. Mutants defective in this gene accumulate high amounts of zeaxanthin in conditions of high light or low temperature. Plays a role in the adaptation to low temperature stress, notably phloem loading.  |
AT4G33700 | AT4G33700.1 | ATTGCCACGT | CBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT2G14520.1); Has 8185 Blast hits to 8163 proteins in 1404 species: Archae - 64; Bacteria - 5471; Metazoa - 234; Fungi - 109; Plants - 119; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).  |
AT4G34630 | AT4G34630.1 | TACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT4G34830 | AT4G34830.1 | GCCGTTTATGCCACGTA | LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 19818 Blast hits to 5849 proteins in 171 species: Archae - 3; Bacteria - 16; Metazoa - 570; Fungi - 397; Plants - 17732; Viruses - 0; Other Eukaryotes - 1100 (source: NCBI BLink).  |
AT4G34840 | AT4G34840.1 | TACGTGGCATAAACGGC | ATMTN2; FUNCTIONS IN: methylthioadenosine nucleosidase activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: ATMTN1; catalytic/ methylthioadenosine nucleosidase (TAIR:AT4G38800.1); Has 1301 Blast hits to 1301 proteins in 595 species: Archae - 0; Bacteria - 1215; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).  |
AT4G35850 | AT4G35850.1 | GTACACGTGGCAGCCACGTG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink).  |
AT4G37240 | AT4G37240.1 | CTACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23690.1); Has 130 Blast hits to 130 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G37390 | AT4G37390.1 | ATGCCACGTA | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity.  |
AT4G37420 | AT4G37420.1 | GTGCCACGTGACA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27200.1); Has 141 Blast hits to 141 proteins in 46 species: Archae - 0; Bacteria - 74; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT4G38220 | AT4G38220.1 | CTGCCACGTGGC | aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative; FUNCTIONS IN: hydrolase activity, metallopeptidase activity, aminoacylase activity, protein dimerization activity; INVOLVED IN: amino acid metabolic process, proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ArgE/DapE/ACY1/CPG2/YscS, conserved site (InterPro:IPR001261), Peptidase M20 (InterPro:IPR002933), N-acyl-L-amino-acid amidohydrolase (InterPro:IPR010159), Peptidase M20, dimerisation (InterPro:IPR011650); BEST Arabidopsis thaliana protein match is: aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative (TAIR:AT1G44820.1); Has 4312 Blast hits to 4309 proteins in 975 species: Archae - 99; Bacteria - 2604; Metazoa - 360; Fungi - 186; Plants - 40; Viruses - 2; Other Eukaryotes - 1021 (source: NCBI BLink).  |
AT4G38220.2 | CTGCCACGTGGC | aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative; FUNCTIONS IN: hydrolase activity, metallopeptidase activity, aminoacylase activity, protein dimerization activity; INVOLVED IN: amino acid metabolic process, proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ArgE/DapE/ACY1/CPG2/YscS, conserved site (InterPro:IPR001261), Peptidase M20 (InterPro:IPR002933), N-acyl-L-amino-acid amidohydrolase (InterPro:IPR010159), Peptidase M20, dimerisation (InterPro:IPR011650); BEST Arabidopsis thaliana protein match is: aminoacylase, putative / N-acyl-L-amino-acid amidohydrolase, putative (TAIR:AT1G44820.1); Has 4312 Blast hits to 4309 proteins in 975 species: Archae - 99; Bacteria - 2604; Metazoa - 360; Fungi - 186; Plants - 40; Viruses - 2; Other Eukaryotes - 1021 (source: NCBI BLink).  | |
AT4G38680 | AT4G38680.1 | GTGACGTGGCAG | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development.  |
AT5G01260 | AT5G01260.1 | ATTGCCACGTGGAC | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
AT5G01260.2 | ATTGCCACGTGGAC | glycoside hydrolase starch-binding domain-containing protein; FUNCTIONS IN: carbohydrate binding, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin-like fold (InterPro:IPR013783), Carbohydrate-binding-like fold (InterPro:IPR013784), Glycoside hydrolase, carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis thaliana protein match is: ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase (TAIR:AT5G26570.2); Has 380 Blast hits to 376 proteins in 110 species: Archae - 0; Bacteria - 123; Metazoa - 18; Fungi - 81; Plants - 84; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  | |
AT5G01420 | AT5G01420.1 | GACGTGGCAC | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT5G03870.1); Has 300 Blast hits to 300 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 0; Plants - 195; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT5G01760 | AT5G01760.1 | ACGTGGCAG | VHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT2G38410.1); Has 1339 Blast hits to 1327 proteins in 151 species: Archae - 0; Bacteria - 8; Metazoa - 746; Fungi - 331; Plants - 152; Viruses - 2; Other Eukaryotes - 100 (source: NCBI BLink).  |
AT5G01990 | AT5G01990.1 | CGCACGTGGCAG | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT1G71090.1); Has 303 Blast hits to 283 proteins in 69 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 152; Plants - 93; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  |
AT5G02090 | AT5G02090.1 | TACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G02790 | AT5G02790.1 | CTGCCACGTGTAC | In2-1 protein, putative; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: In2-1 protein, putative (TAIR:AT5G02780.1); Has 2811 Blast hits to 2774 proteins in 481 species: Archae - 2; Bacteria - 698; Metazoa - 592; Fungi - 122; Plants - 984; Viruses - 0; Other Eukaryotes - 413 (source: NCBI BLink).  |
AT5G03160 | AT5G03160.1 | TACGTGGCAG | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast.  |
AT5G04090 | AT5G04090.2 | ATCCACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10250.2); Has 131 Blast hits to 129 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 118; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT5G04270 | AT5G04270.1 | ATTGCCACGTA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G09320.1); Has 3947 Blast hits to 3944 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1934; Fungi - 520; Plants - 397; Viruses - 0; Other Eukaryotes - 1096 (source: NCBI BLink).  |
AT5G05200 | AT5G05200.1 | TTCCACGTGGCAT | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink).  |
AT5G05210 | AT5G05210.1 | ATGCCACGTGGAA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  |
AT5G05210.2 | ATGCCACGTGGAA | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  | |
AT5G05220 | AT5G05220.1 | AGACACGTGGCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: stamen; EXPRESSED DURING: 4 anthesis; Has 17 Blast hits to 10 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G05290 | AT5G05290.1 | GTCCACGTGGCAT | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)  |
AT5G07920 | AT5G07920.1 | CACGTGGCAA | diacylglycerol kinase  |
AT5G09440 | AT5G09440.1 | ATCCACGTGGCAT | EXORDIUM LIKE 4 (EXL4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 conserved region (InterPro:IPR006766); BEST Arabidopsis thaliana protein match is: EXL2 (EXORDIUM LIKE 2) (TAIR:AT5G64260.1); Has 233 Blast hits to 233 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 231; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G09590 | AT5G09590.1 | TTCCACGTGGCAAT | heat shock protein 70 (Hsc70-5); nuclear  |
AT5G10490 | AT5G10490.1 | TACGTGGCA | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE.  |
AT5G10490.2 | TACGTGGCA | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE.  | |
AT5G11090 | AT5G11090.1 | TGACACGTGGCAG | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G25280.2); Has 1617 Blast hits to 241 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 631; Fungi - 53; Plants - 88; Viruses - 0; Other Eukaryotes - 841 (source: NCBI BLink).  |
AT5G11520 | AT5G11520.1 | TACGTGGCAA | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves.  |
AT5G11560 | AT5G11560.1 | TACGTGGCAT | catalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1620 (InterPro:IPR011678), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); Has 361 Blast hits to 325 proteins in 153 species: Archae - 4; Bacteria - 34; Metazoa - 139; Fungi - 102; Plants - 18; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT5G12940 | AT5G12940.1 | GACGACGTGGCAA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G20820.1); Has 47045 Blast hits to 16978 proteins in 730 species: Archae - 15; Bacteria - 2431; Metazoa - 14572; Fungi - 447; Plants - 26641; Viruses - 0; Other Eukaryotes - 2939 (source: NCBI BLink).  |
AT5G14500 | AT5G14500.1 | CACACGTGGCAG | aldose 1-epimerase family protein; FUNCTIONS IN: carbohydrate binding, isomerase activity, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: aldose 1-epimerase family protein (TAIR:AT3G01590.2); Has 1231 Blast hits to 1228 proteins in 482 species: Archae - 0; Bacteria - 792; Metazoa - 38; Fungi - 86; Plants - 139; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).  |
AT5G14780 | AT5G14780.1 | TACACGTGGCAC | Encodes a NAD-dependent formate dehydrogenase.  |
AT5G15500 | AT5G15500.1 | CTGCCACGTCAC | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink).  |
AT5G15500.2 | CTGCCACGTCAC | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink).  | |
AT5G15840 | AT5G15840.1 | GTGCCACGTGTA | Encodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1.  |
AT5G15840.2 | GTGCCACGTGTA | Encodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1.  | |
AT5G15970 | AT5G15970.1 | TACACGTGGCAC | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance.  |
AT5G16820 | AT5G16820.1 | ATGCCACGTA | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.  |
AT5G16820.2 | ATGCCACGTA | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.  | |
AT5G18620 | AT5G18620.1 | ACGTGGCAC | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).  |
AT5G18620.2 | ACGTGGCAC | CHROMATIN REMODELING FACTOR17 (CHR17); FUNCTIONS IN: in 7 functions; INVOLVED IN: ATP-dependent chromatin remodeling, chromatin remodeling; LOCATED IN: nucleus, chromatin remodeling complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, nucleosome remodelling ISWI, HAND domain (InterPro:IPR015194), SANT, eukarya (InterPro:IPR017884), SNF2-related (InterPro:IPR000330), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057), SLIDE (InterPro:IPR015195), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: CHR11 (CHROMATIN-REMODELING PROTEIN 11); ATP binding / DNA binding / DNA-dependent ATPase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / nucleosome binding (TAIR:AT3G06400.1); Has 19924 Blast hits to 15142 proteins in 1291 species: Archae - 93; Bacteria - 3277; Metazoa - 6471; Fungi - 3450; Plants - 1004; Viruses - 457; Other Eukaryotes - 5172 (source: NCBI BLink).  | |
AT5G19860 | AT5G19860.1 | GACGTGGCAAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55265.1); Has 347 Blast hits to 347 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 346; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G19930 | AT5G19930.1 | GTGCCACGTCAT | integral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink).  |
AT5G19940 | AT5G19940.1 | ATGACGTGGCAC | plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G19940.2 | ATGACGTGGCAC | plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  | |
AT5G21920 | AT5G21920.1 | ATGCCACGTGTCAT | YGGT family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); BEST Arabidopsis thaliana protein match is: YGGT family protein (TAIR:AT4G27990.1); Has 1060 Blast hits to 1060 proteins in 353 species: Archae - 0; Bacteria - 642; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 348 (source: NCBI BLink).  |
AT5G21930 | AT5G21930.1 | ATGACACGTGGCAT | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport  |
AT5G21930.2 | ATGACACGTGGCAT | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport  | |
AT5G22290 | AT5G22290.1 | GTGACGTGGCAT | Arabidopsis NAC domain containing protein 89 (anac089); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac060 (Arabidopsis NAC domain containing protein 60); transcription factor (TAIR:AT3G44290.1); Has 1506 Blast hits to 1504 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1506; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G23060 | AT5G23060.1 | ATGCCACGTAG | Calcium sensing receptor (CaS); LOCATED IN: thylakoid, mitochondrion, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59780.1); Has 141 Blast hits to 132 proteins in 46 species: Archae - 0; Bacteria - 51; Metazoa - 8; Fungi - 10; Plants - 56; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G23200 | AT5G23200.1 | GACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G23280 | AT5G23280.1 | ATGACGTGGCAA | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G08330.1); Has 679 Blast hits to 678 proteins in 154 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 0; Plants - 639; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT5G23890 | AT5G23890.1 | GCTGACGTGGCAT | LOCATED IN: mitochondrion, chloroplast thylakoid membrane, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: S-layer homology region (InterPro:IPR001119); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52410.2); Has 47782 Blast hits to 27307 proteins in 1672 species: Archae - 444; Bacteria - 6951; Metazoa - 22630; Fungi - 3561; Plants - 1682; Viruses - 252; Other Eukaryotes - 12262 (source: NCBI BLink).  |
AT5G24130 | AT5G24130.1 | CTGCCACGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G24970 | AT5G24970.1 | TTGCCACGTGTCAT | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink).  |
AT5G24980 | AT5G24980.1 | ATGACACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G25280 | AT5G25280.1 | TACGTGGCAG | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G11090.1); Has 1714 Blast hits to 295 proteins in 53 species: Archae - 0; Bacteria - 6; Metazoa - 724; Fungi - 65; Plants - 92; Viruses - 0; Other Eukaryotes - 827 (source: NCBI BLink).  |
AT5G25280.2 | TACGTGGCAG | serine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G11090.1); Has 1714 Blast hits to 295 proteins in 53 species: Archae - 0; Bacteria - 6; Metazoa - 724; Fungi - 65; Plants - 92; Viruses - 0; Other Eukaryotes - 827 (source: NCBI BLink).  | |
AT5G26200 | AT5G26200.1 | TTGCCACGTG | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT1G72820.1); Has 12703 Blast hits to 8492 proteins in 311 species: Archae - 0; Bacteria - 0; Metazoa - 6193; Fungi - 3428; Plants - 1980; Viruses - 0; Other Eukaryotes - 1102 (source: NCBI BLink).  |
AT5G27420 | AT5G27420.1 | GTCCACGTGGCAT | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin, response to abscisic acid stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ATL6; protein binding / zinc ion binding (TAIR:AT3G05200.1); Has 6369 Blast hits to 6350 proteins in 217 species: Archae - 0; Bacteria - 0; Metazoa - 2077; Fungi - 469; Plants - 2661; Viruses - 39; Other Eukaryotes - 1123 (source: NCBI BLink).  |
AT5G27670 | AT5G27670.1 | ACGTGGCAA | Encodes HTA7, a histone H2A protein.  |
AT5G38410 | AT5G38410.1 | CTGCCACGTGGCCTTAT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT5G38410.2 | CTGCCACGTGGCCTTAT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G38410.3 | CTGCCACGTGGCCTTAT | ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G38420 | AT5G38420.1 | CTGCCACGTG | ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 8 components; EXPRESSED IN: 10 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1722 Blast hits to 1701 proteins in 391 species: Archae - 0; Bacteria - 341; Metazoa - 0; Fungi - 0; Plants - 874; Viruses - 0; Other Eukaryotes - 507 (source: NCBI BLink).  |
AT5G39530 | AT5G39530.1 | ATGCCACGTGGAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39520.1); Has 172 Blast hits to 172 proteins in 54 species: Archae - 0; Bacteria - 88; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT5G39570 | AT5G39570.1 | CCCACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G41080 | AT5G41080.1 | ATGCCACGTA | glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SRG3 (senescence-related gene 3); glycerophosphodiester phosphodiesterase/ phosphoric diester hydrolase (TAIR:AT3G02040.1); Has 1314 Blast hits to 1286 proteins in 350 species: Archae - 22; Bacteria - 625; Metazoa - 237; Fungi - 103; Plants - 54; Viruses - 2; Other Eukaryotes - 271 (source: NCBI BLink).  |
AT5G41080.2 | ATGCCACGTA | glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SRG3 (senescence-related gene 3); glycerophosphodiester phosphodiesterase/ phosphoric diester hydrolase (TAIR:AT3G02040.1); Has 1314 Blast hits to 1286 proteins in 350 species: Archae - 22; Bacteria - 625; Metazoa - 237; Fungi - 103; Plants - 54; Viruses - 2; Other Eukaryotes - 271 (source: NCBI BLink).  | |
AT5G43100 | AT5G43100.1 | AGACACGTGGCAC | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT3G50050.1); Has 3332 Blast hits to 3311 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 1443; Fungi - 428; Plants - 1141; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink).  |
AT5G44110 | AT5G44110.1 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters.  |
AT5G44110.2 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters.  | |
AT5G44110.3 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters.  | |
AT5G47180 | AT5G47180.1 | CTGCCACGTCATC | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT5G47180.2 | CTGCCACGTCATC | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  | |
AT5G47550 | AT5G47550.1 | ACACGTCATGCCACGTGGCGG | cysteine protease inhibitor, putative / cystatin, putative; FUNCTIONS IN: cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor family protein / cystatin family protein (TAIR:AT4G16500.1); Has 507 Blast hits to 483 proteins in 88 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 0; Plants - 482; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G47590 | AT5G47590.1 | GTGCCACGTCAC | heat shock protein-related; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Small heat shock protein, predicted, plant (InterPro:IPR016952), Peptidase A1 (InterPro:IPR001461), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: heat shock protein-related (TAIR:AT4G16550.1); Has 51 Blast hits to 42 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G47640 | AT5G47640.1 | AACACGTGGCAA | NUCLEAR FACTOR Y, SUBUNIT B2 (NF-YB2); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB3 (NUCLEAR FACTOR Y, SUBUNIT B3); transcription factor (TAIR:AT4G14540.1); Has 995 Blast hits to 995 proteins in 188 species: Archae - 0; Bacteria - 0; Metazoa - 385; Fungi - 225; Plants - 295; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT5G47810 | AT5G47810.1 | TTGCCACGTC | PHOSPHOFRUCTOKINASE 2 (PFK2); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: cytosol, 6-phosphofructokinase complex; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4565 Blast hits to 4222 proteins in 1114 species: Archae - 20; Bacteria - 2500; Metazoa - 504; Fungi - 230; Plants - 224; Viruses - 2; Other Eukaryotes - 1085 (source: NCBI BLink).  |
AT5G50240 | AT5G50240.3 | GTCCACGTGGCAA | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced.  |
AT5G50375 | AT5G50375.1 | CTGCCACGTCAGC | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2  |
AT5G51020 | AT5G51020.1 | TACACGTGGCAA | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division.  |
AT5G51110 | AT5G51110.1 | TACGTGGCAC | 4-alpha-hydroxytetrahydrobiopterin dehydratase; FUNCTIONS IN: 4-alpha-hydroxytetrahydrobiopterin dehydratase activity; INVOLVED IN: tetrahydrobiopterin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional coactivator/pterin dehydratase (InterPro:IPR001533); BEST Arabidopsis thaliana protein match is: dehydratase family (TAIR:AT1G29810.1); Has 1563 Blast hits to 1563 proteins in 256 species: Archae - 17; Bacteria - 489; Metazoa - 0; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1013 (source: NCBI BLink).  |
AT5G51120 | AT5G51120.1 | GTGCCACGTA | Encodes a homolog of the protein PABN1, a polyadenylation factor subunit.  |
AT5G52300 | AT5G52300.1 | GACGTGGCAG | encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi.  |
AT5G52300.2 | GACGTGGCAG | encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi.  | |
AT5G52430 | AT5G52430.1 | GATGACGTGGCAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G25620.1); Has 849 Blast hits to 464 proteins in 107 species: Archae - 2; Bacteria - 43; Metazoa - 236; Fungi - 114; Plants - 84; Viruses - 9; Other Eukaryotes - 361 (source: NCBI BLink).  |
AT5G52660 | AT5G52660.1 | TACGTGGCAC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink).  |
AT5G52660.2 | TACGTGGCAC | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 8 processes; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT4G01280.1); Has 825 Blast hits to 821 proteins in 86 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 7; Plants - 646; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink).  | |
AT5G52960 | AT5G52960.1 | ATTGCCACGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).  |
AT5G52960.1 | GTGACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).  | |
AT5G52990 | AT5G52990.1 | CGACGTGGCAAT | vesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G52990.1 | TACGTGGCAT | vesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G53050 | AT5G53050.1 | CTACGTGGCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink).  |
AT5G53050.2 | CTACGTGGCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink).  | |
AT5G53050.3 | CTACGTGGCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: epoxide hydrolase, putative (TAIR:AT4G02340.1); Has 7115 Blast hits to 7115 proteins in 902 species: Archae - 42; Bacteria - 4693; Metazoa - 212; Fungi - 151; Plants - 164; Viruses - 5; Other Eukaryotes - 1848 (source: NCBI BLink).  | |
AT5G53140 | AT5G53140.1 | GTGCCACGT | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: WIN2 (HOPW1-1-INTERACTING 2); protein serine/threonine phosphatase (TAIR:AT4G31750.1); Has 11808 Blast hits to 6217 proteins in 692 species: Archae - 16; Bacteria - 2091; Metazoa - 2394; Fungi - 611; Plants - 1725; Viruses - 88; Other Eukaryotes - 4883 (source: NCBI BLink).  |
AT5G53490 | AT5G53490.1 | ATGCCACGTCAT | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein.  |
AT5G53490.2 | ATGCCACGTCAT | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein.  | |
AT5G54080 | AT5G54080.1 | ATGCCACGTCATC | homogentisate 1,2-dioxygenase  |
AT5G54080.2 | ATGCCACGTCATC | homogentisate 1,2-dioxygenase  | |
AT5G57110 | AT5G57110.1 | AGCGCGTGCCACGTAG | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane.  |
AT5G57110.2 | AGCGCGTGCCACGTAG | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane.  | |
AT5G58070 | AT5G58070.1 | TTCCACGTGGCAT | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane.  |
AT5G58650 | AT5G58650.1 | TACGTGGCAC | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK).  |
AT5G58800 | AT5G58800.1 | ATTGCCACGTCAT | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink).  |
AT5G58800.2 | ATTGCCACGTCAT | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink).  | |
AT5G59290 | AT5G59290.1 | ATTGCCACGTA | Encodes an isoform of UDP-glucuronic acid decarboxylase, which is predicted to be cytosolic by PSORT. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.  |
AT5G59290.2 | ATTGCCACGTA | Encodes an isoform of UDP-glucuronic acid decarboxylase, which is predicted to be cytosolic by PSORT. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.  | |
AT5G60790 | AT5G60790.1 | GTACACGTGGCAC | member of GCN subfamily  |
AT5G63160 | AT5G63160.1 | ATGCCACGT | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development.  |
AT5G64170 | AT5G64170.2 | TTGCCACGTGTT | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G54500.2); Has 117 Blast hits to 104 proteins in 33 species: Archae - 2; Bacteria - 18; Metazoa - 19; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT5G64180 | AT5G64180.1 | AACACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 61 species: Archae - 0; Bacteria - 5; Metazoa - 125; Fungi - 11; Plants - 24; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G64260 | AT5G64260.1 | TCCACGTGGCAAT | EXORDIUM LIKE 2 (EXL2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 conserved region (InterPro:IPR006766); BEST Arabidopsis thaliana protein match is: EXL4 (EXORDIUM LIKE 4) (TAIR:AT5G09440.1); Has 233 Blast hits to 233 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 231; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G64930 | AT5G64930.1 | GGACACGTGGCAT | Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR).  |
AT5G64940 | AT5G64940.1 | ATGCCACGTGTCC | Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins.  |
AT5G64940.2 | ATGCCACGTGTCC | Encodes a member of ATH subfamily of ATP-binding cassette (ABC) proteins.  | |
AT5G65300 | AT5G65300.1 | GAAGCCCACGTGGCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G65700 | AT5G65700.1 | CTGACGTGGCAC | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs.  |
AT5G66570 | AT5G66570.1 | CGACACGTGGCAA | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In <i>Arabidopsis thaliana</i> the PsbO proteins are encoded by two genes: <i>psbO1</i> and <i>psbO2</i>. PsbO1 is the major isoform in the wild-type.  |
AT5G66580 | AT5G66580.1 | CTGCCACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50800.1); Has 132 Blast hits to 132 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 132; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G67370 | AT5G67370.1 | GTGCCACGTGGCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1230 (InterPro:IPR009631); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11840.1); Has 264 Blast hits to 264 proteins in 69 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  |