| Locus | Gene model | Sequence | Description |
| AT1G02560 | AT1G02560.1 | AACCCGACCCGA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT1G05410 | AT1G05410.1 | CCGACCCGACCCGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G05410.2 | CCGACCCGACCCGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
| AT1G08250 | AT1G08250.1 | TTAAACCGGATCGGGTCGA | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT1G14850 | AT1G14850.1 | TCGACCCGAC | Encodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport |
| AT1G16740 | AT1G16740.1 | CGACCCGACCCGATCGACCCGG | ribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink). |
| AT1G21600 | AT1G21600.1 | TTCGGGTCGGGTCGGGTCGG | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. |
| AT1G21600.2 | TTCGGGTCGGGTCGGGTCGG | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. |
| AT1G23090 | AT1G23090.1 | CCGACCCGAA | Encodes AST91 mRNA for sulfate transporter. |
| AT1G27470 | AT1G27470.1 | TATGGCCCAATGGGTCGGGTCGACCCGACC | transducin-related / WD-40 repeat protein-related; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G07410.1); Has 6753 Blast hits to 4580 proteins in 346 species: Archae - 8; Bacteria - 2018; Metazoa - 1907; Fungi - 1463; Plants - 459; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink). |
| AT1G27480 | AT1G27480.1 | GGTCGGGTCGACCCGACCCATTGGGCCATA | lecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); Has 852 Blast hits to 847 proteins in 171 species: Archae - 0; Bacteria - 22; Metazoa - 582; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). |
| AT1G32870 | AT1G32870.1 | CCGACCCGAAAAAACGACGTC | Arabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT1G32870.2 | CCGACCCGAAAAAACGACGTC | Arabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
| AT1G48420 | AT1G48420.1 | CCAAACCGACCCGACCCGA | Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. Unlike homologous bacterial enzymes, it does not have 1-aminocyclopropane-1-carboxylate deaminase activity. |
| AT1G53165 | AT1G53165.1 | GGTCGGGTCGGGTCGGGTCG | ATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink). |
| AT1G53165.2 | GGTCGGGTCGGGTCGGGTCG | ATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink). |
| AT1G55630 | AT1G55630.1 | GTCGGGTCGG | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G60050.1); Has 18827 Blast hits to 5565 proteins in 174 species: Archae - 4; Bacteria - 21; Metazoa - 383; Fungi - 322; Plants - 17397; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink). |
| AT1G61430 | AT1G61430.1 | CGACCCGA | S-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), PAN-like, type 2 (InterPro:IPR013227), Apple-like (InterPro:IPR003609), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61440.1); Has 87173 Blast hits to 85910 proteins in 3093 species: Archae - 55; Bacteria - 7595; Metazoa - 38320; Fungi - 6601; Plants - 19577; Viruses - 379; Other Eukaryotes - 14646 (source: NCBI BLink). |
| AT1G65040 | AT1G65040.2 | TTCGGGTCG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink). |
| AT1G65040.3 | TTCGGGTCG | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink). |
| AT1G65540 | AT1G65540.1 | CGGACCCGACCCGA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), LETM1-like (InterPro:IPR011685); BEST Arabidopsis thaliana protein match is: calcium-binding mitochondrial protein-related (TAIR:AT3G59820.1); Has 5986 Blast hits to 5091 proteins in 515 species: Archae - 39; Bacteria - 659; Metazoa - 2946; Fungi - 435; Plants - 306; Viruses - 24; Other Eukaryotes - 1577 (source: NCBI BLink). |
| AT1G65540.1 | TCGACCCGACCCGAA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), LETM1-like (InterPro:IPR011685); BEST Arabidopsis thaliana protein match is: calcium-binding mitochondrial protein-related (TAIR:AT3G59820.1); Has 5986 Blast hits to 5091 proteins in 515 species: Archae - 39; Bacteria - 659; Metazoa - 2946; Fungi - 435; Plants - 306; Viruses - 24; Other Eukaryotes - 1577 (source: NCBI BLink). |
| AT1G72090 | AT1G72090.1 | TCGACCCGACCCAGGCCCATTA | radical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), Aldolase-type TIM barrel (InterPro:IPR013785), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792), MiaB-like tRNA modifying enzyme, archaeal-type (InterPro:IPR006466); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT4G36390.1); Has 10341 Blast hits to 10323 proteins in 1298 species: Archae - 269; Bacteria - 4639; Metazoa - 269; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5110 (source: NCBI BLink). |
| AT1G73885 | AT1G73885.1 | GGTCGGGTCGGGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT1G75020 | AT1G75020.1 | CCGACCCGAA | LYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink). |
| AT1G75020.1 | TCGGGTCG | LYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink). |
| AT1G75020.2 | CCGACCCGAA | LYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink). |
| AT1G75020.2 | TCGGGTCG | LYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink). |
| AT1G79200 | AT1G79200.1 | GACCCGACCCGACCCGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; Has 3292 Blast hits to 2186 proteins in 154 species: Archae - 0; Bacteria - 21; Metazoa - 1599; Fungi - 418; Plants - 200; Viruses - 0; Other Eukaryotes - 1054 (source: NCBI BLink). |
| AT1G80670 | AT1G80670.1 | ACCCGACCCGAACCGA | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT2G01860 | AT2G01860.1 | TTCGGGTCG | EMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink). |
| AT2G02390 | AT2G02390.1 | TCGGGTCGG | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. |
| AT2G02390.2 | TCGGGTCGG | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. |
| AT2G02390.3 | TCGGGTCGG | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. |
| AT2G04630 | AT2G04630.1 | CCGAACCGAACCCGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940. |
| AT2G04630.1 | CCGACCCGACCCTGACCCGAA | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940. |
| AT2G14260 | AT2G14260.1 | TCGACCCGA | encodes proline iminopeptidase |
| AT2G14260.2 | TCGACCCGA | encodes proline iminopeptidase |
| AT2G14460 | AT2G14460.1 | TCGGTTCGGGTCGGTTCGGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G16500 | AT2G16500.1 | TTCGGGTCGGGTCGGGTCG | encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
| AT2G21840 | AT2G21840.1 | TGACCCGACCCGAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21850.1); Has 2278 Blast hits to 530 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 2227; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). |
| AT2G24650 | AT2G24650.2 | GTAAACCGACCCGAA | DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: apoplast; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: MEE45 (maternal effect embryo arrest 45); DNA binding / transcription factor (TAIR:AT4G00260.1); Has 527 Blast hits to 125 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G28830 | AT2G28830.1 | CCGACCCGAA | binding / structural constituent of ribosome / ubiquitin-protein ligase; FUNCTIONS IN: ubiquitin-protein ligase activity, structural constituent of ribosome, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex, ribosome, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Ribosomal protein L10e/L16 (InterPro:IPR016180), Armadillo (InterPro:IPR000225), Ribosomal protein L16 (InterPro:IPR000114), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: PUB13 (PLANT U-BOX 13); ubiquitin-protein ligase (TAIR:AT3G46510.1); Has 4249 Blast hits to 3154 proteins in 216 species: Archae - 0; Bacteria - 22; Metazoa - 1271; Fungi - 546; Plants - 1890; Viruses - 3; Other Eukaryotes - 517 (source: NCBI BLink). |
| AT2G30590 | AT2G30590.1 | TAATTACGACCCGA | Encodes WRKY DNA-binding protein 21 (WRKY21). |
| AT2G34400 | AT2G34400.1 | TCGACCCGAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G22410.1); Has 14623 Blast hits to 5296 proteins in 169 species: Archae - 0; Bacteria - 4; Metazoa - 195; Fungi - 114; Plants - 13938; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink). |
| AT2G38000 | AT2G38000.1 | TGACCCGACCCGA | chaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink). |
| AT2G40800 | AT2G40800.1 | TGACCCGACCCGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT2G46540 | AT2G46540.1 | ATTTGGGCCCAGTAACCCGACCCGACC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G01370 | AT3G01370.1 | CCGACCCGACCCGAA | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
| AT3G01850 | AT3G01850.1 | TAAATGGGTCGGGTCG | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). |
| AT3G01850.2 | TAAATGGGTCGGGTCG | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). |
| AT3G03600 | AT3G03600.1 | CCGACCCGACCCGAC | Structural component of the mitochondrial ribosome small subunit |
| AT3G03610 | AT3G03610.1 | GTCGGGTCGGGTCGG | phagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). |
| AT3G06270 | AT3G06270.1 | ACCCGACCCGAA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae - 2; Bacteria - 83; Metazoa - 1132; Fungi - 383; Plants - 1219; Viruses - 4; Other Eukaryotes - 863 (source: NCBI BLink). |
| AT3G06270.1 | TCGGGTCGA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae - 2; Bacteria - 83; Metazoa - 1132; Fungi - 383; Plants - 1219; Viruses - 4; Other Eukaryotes - 863 (source: NCBI BLink). |
| AT3G07170 | AT3G07170.1 | TCGACCCGACCCGACCCG | sterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). |
| AT3G11130 | AT3G11130.1 | TCGACCCGAA | clathrin heavy chain, putative; FUNCTIONS IN: protein binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, guard cell, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Clathrin, heavy chain (InterPro:IPR016341), Clathrin, heavy chain, linker and propeller (InterPro:IPR016025), Tetratricopeptide-like helical (InterPro:IPR011990), Clathrin, heavy chain, propeller, N-terminal (InterPro:IPR001473), Clathrin, heavy chain, linker, core motif (InterPro:IPR015348), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); BEST Arabidopsis thaliana protein match is: clathrin heavy chain, putative (TAIR:AT3G08530.1); Has 1310 Blast hits to 1193 proteins in 365 species: Archae - 0; Bacteria - 34; Metazoa - 776; Fungi - 123; Plants - 60; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink). |
| AT3G14960 | AT3G14960.1 | CCGACCCGAA | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT1G53290.1); Has 932 Blast hits to 929 proteins in 77 species: Archae - 0; Bacteria - 2; Metazoa - 607; Fungi - 2; Plants - 303; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT3G16640 | AT3G16640.1 | CCGACCCGAA | Encodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well. |
| AT3G16650 | AT3G16650.1 | TTCGGGTCGG | PP1/PP2A phosphatases pleiotropic regulator 2 (PRL2); FUNCTIONS IN: nucleotide binding; INVOLVED IN: response to salt stress; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: PRL1 (PLEIOTROPIC REGULATORY LOCUS 1); basal transcription repressor/ nucleotide binding / protein binding (TAIR:AT4G15900.1); Has 58179 Blast hits to 24123 proteins in 639 species: Archae - 64; Bacteria - 6308; Metazoa - 27345; Fungi - 10914; Plants - 5200; Viruses - 0; Other Eukaryotes - 8348 (source: NCBI BLink). |
| AT3G19520 | AT3G19520.1 | CCGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G19520.2 | CCGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G20870 | AT3G20870.1 | ACCGGGTTAAACCGACCCGA | metal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G08650.2); Has 2198 Blast hits to 2183 proteins in 642 species: Archae - 78; Bacteria - 1120; Metazoa - 489; Fungi - 73; Plants - 72; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink). |
| AT3G21290 | AT3G21290.1 | TTCGGGTCGGGTT | dentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Occludin and RNA polymerase II elongation factor ELL domain (InterPro:IPR010844); Has 15416 Blast hits to 7392 proteins in 559 species: Archae - 48; Bacteria - 5567; Metazoa - 4037; Fungi - 1335; Plants - 339; Viruses - 108; Other Eukaryotes - 3982 (source: NCBI BLink). |
| AT3G22680 | AT3G22680.1 | CCGGGTCGGGTCGGTTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1950 (InterPro:IPR015270); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G42660 | AT3G42660.1 | TCGGGTCG | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08390.1); Has 30747 Blast hits to 15361 proteins in 528 species: Archae - 50; Bacteria - 5853; Metazoa - 12286; Fungi - 6007; Plants - 2368; Viruses - 3; Other Eukaryotes - 4180 (source: NCBI BLink). |
| AT3G42790 | AT3G42790.1 | TGACCCGACCCGAACCA | AL3 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. |
| AT3G47120 | AT3G47120.1 | AACCGAACCGACCCGAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae - 10; Bacteria - 1203; Metazoa - 11844; Fungi - 2178; Plants - 3009; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink). |
| AT3G47930 | AT3G47930.1 | TCGACCCGA | L-Galactono-1,4-lactone dehydrogenase, catalyzes the final step of ascorbate biosynthesis |
| AT3G47930.2 | TCGACCCGA | L-Galactono-1,4-lactone dehydrogenase, catalyzes the final step of ascorbate biosynthesis |
| AT3G50690 | AT3G50690.1 | AACCCGACCCGAACCGA | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink). |
| AT3G56440 | AT3G56440.1 | GGGCCGGGTCGGGTCGGGTCG | AtATG18d; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18c (TAIR:AT2G40810.2); Has 1093 Blast hits to 1046 proteins in 176 species: Archae - 0; Bacteria - 24; Metazoa - 508; Fungi - 305; Plants - 110; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). |
| AT3G57330 | AT3G57330.1 | TCGGGTCGG | autoinhibited Ca2+-ATPase 11 (ACA11); FUNCTIONS IN: calmodulin binding, calcium-transporting ATPase activity; INVOLVED IN: cation transport, calcium ion transport, metabolic process, ATP biosynthetic process; LOCATED IN: chloroplast, plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, calcium-transporting, PMCA-type (InterPro:IPR006408), ATPase, P-type, H+ transporting proton pump (InterPro:IPR000695), ATPase, P-type cation-transporter, N-terminal (InterPro:IPR004014), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type cation-transporter, C-terminal (InterPro:IPR006068), ATPase, P-type phosphorylation site (InterPro:IPR018303); BEST Arabidopsis thaliana protein match is: ACA4 (AUTO-INHIBITED CA(2+)-ATPASE, ISOFORM 4); calcium-transporting ATPase/ calmodulin binding (TAIR:AT2G41560.1); Has 25242 Blast hits to 19809 proteins in 1858 species: Archae - 502; Bacteria - 15238; Metazoa - 3407; Fungi - 1728; Plants - 1099; Viruses - 3; Other Eukaryotes - 3265 (source: NCBI BLink). |
| AT3G61060 | AT3G61060.1 | AACCCGACCCGACCCGA | Arabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G61060.2 | AACCCGACCCGACCCGA | Arabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G00090 | AT4G00090.1 | AACCCGACCCGACCCGGTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). |
| AT4G00500 | AT4G00500.1 | CCGACCCGACCCGACCCGACCCGACCCGAC | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G00500.2 | CCGACCCGACCCGACCCGACCCGACCCGAC | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink). |
| AT4G00520 | AT4G00520.2 | GTCGGGTCGGGTCGGGTCGGGTCGGGTCGG | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink). |
| AT4G00520.3 | GTCGGGTCGGGTCGGGTCGGGTCGGGTCGG | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink). |
| AT4G02550 | AT4G02550.1 | TCGGGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02550.2 | TCGGGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G02550.3 | TCGGGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G07410 | AT4G07410.1 | GGTCGGGTCGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin-related / WD-40 repeat protein-related (TAIR:AT1G27470.1); Has 7930 Blast hits to 5136 proteins in 341 species: Archae - 14; Bacteria - 2432; Metazoa - 2063; Fungi - 1810; Plants - 493; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink). |
| AT4G07410.2 | GGTCGGGTCGA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin-related / WD-40 repeat protein-related (TAIR:AT1G27470.1); Has 7930 Blast hits to 5136 proteins in 341 species: Archae - 14; Bacteria - 2432; Metazoa - 2063; Fungi - 1810; Plants - 493; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink). |
| AT4G10140 | AT4G10140.1 | TCGGGTCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33490.1); Has 39 Blast hits to 39 proteins in 13 species: Archae - 0; Bacteria - 14; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
| AT4G11010 | AT4G11010.1 | AACCCGACCCGAA | nucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria |
| AT4G18060 | AT4G18060.1 | TCGACCCGACCCG | clathrin binding; FUNCTIONS IN: clathrin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neutrophil cytosol factor 2 (InterPro:IPR000108), Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: SH3 domain-containing protein 2 (SH3P2) (TAIR:AT4G34660.1); Has 2031 Blast hits to 1692 proteins in 137 species: Archae - 0; Bacteria - 6; Metazoa - 1668; Fungi - 93; Plants - 91; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink). |
| AT4G18780 | AT4G18780.1 | AACCCGACCCGAATAAACCGGAT | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
| AT4G22380 | AT4G22380.1 | AACCCGACCCGA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7A/RS6 family (InterPro:IPR018492), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT5G20160.1); Has 1361 Blast hits to 1361 proteins in 295 species: Archae - 226; Bacteria - 7; Metazoa - 464; Fungi - 191; Plants - 162; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink). |
| AT4G22850 | AT4G22850.1 | AACCCGACCCGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink). |
| AT4G22850.2 | AACCCGACCCGACCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink). |
| AT4G23900 | AT4G23900.1 | CCGACCCGA | nucleoside diphosphate kinase 4 (NDK4); FUNCTIONS IN: nucleoside diphosphate kinase activity, ATP binding; INVOLVED IN: UTP biosynthetic process, GTP biosynthetic process, CTP biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside diphosphate kinase, core (InterPro:IPR001564); BEST Arabidopsis thaliana protein match is: NDPK3 (NUCLEOSIDE DIPHOSPHATE KINASE 3); ATP binding / nucleoside diphosphate kinase (TAIR:AT4G11010.1); Has 6327 Blast hits to 6229 proteins in 1550 species: Archae - 205; Bacteria - 2598; Metazoa - 838; Fungi - 116; Plants - 246; Viruses - 17; Other Eukaryotes - 2307 (source: NCBI BLink). |
| AT4G23930 | AT4G23930.1 | TCGACCCGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G23930.2 | TCGACCCGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G24470 | AT4G24470.1 | GTCGGGTCG | ZIM is a putative transcription factor containing an atypical GATA-type zinc-finger motif. |
| AT4G24470.2 | GTCGGGTCG | ZIM is a putative transcription factor containing an atypical GATA-type zinc-finger motif. |
| AT4G26690 | AT4G26690.1 | CCGACCCGACC | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT4G26965 | AT4G26965.1 | TCGGGTCGG | NADH:ubiquinone oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase 17.2 kD subunit (InterPro:IPR007763); Has 264 Blast hits to 264 proteins in 68 species: Archae - 0; Bacteria - 20; Metazoa - 74; Fungi - 41; Plants - 15; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT4G26965.2 | TCGGGTCGG | NADH:ubiquinone oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase 17.2 kD subunit (InterPro:IPR007763); Has 264 Blast hits to 264 proteins in 68 species: Archae - 0; Bacteria - 20; Metazoa - 74; Fungi - 41; Plants - 15; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). |
| AT4G29160 | AT4G29160.1 | TCGGGTCGA | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G29160.3 | TCGGGTCGA | SNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). |
| AT4G30010 | AT4G30010.1 | CCGACCCGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G30910 | AT4G30910.1 | TCGGGTCGG | cytosol aminopeptidase family protein; FUNCTIONS IN: manganese ion binding, metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Peptidase M17, leucyl aminopeptidase, C-terminal (InterPro:IPR000819), Peptidase M17, leucyl aminopeptidase, N-terminal (InterPro:IPR008283), Peptidase M17, leucyl aminopeptidase (InterPro:IPR011356); BEST Arabidopsis thaliana protein match is: cytosol aminopeptidase family protein (TAIR:AT4G30920.1); Has 7370 Blast hits to 7367 proteins in 1221 species: Archae - 15; Bacteria - 3183; Metazoa - 615; Fungi - 19; Plants - 77; Viruses - 0; Other Eukaryotes - 3461 (source: NCBI BLink). |
| AT4G30920 | AT4G30920.1 | TCGGGTCGGGT | cytosol aminopeptidase family protein; FUNCTIONS IN: manganese ion binding, metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, protein metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Peptidase M17, leucyl aminopeptidase, C-terminal (InterPro:IPR000819), Peptidase M17, leucyl aminopeptidase, N-terminal (InterPro:IPR008283), Peptidase M17, leucyl aminopeptidase (InterPro:IPR011356); BEST Arabidopsis thaliana protein match is: cytosol aminopeptidase family protein (TAIR:AT4G30910.1); Has 7361 Blast hits to 7357 proteins in 1222 species: Archae - 15; Bacteria - 3183; Metazoa - 618; Fungi - 19; Plants - 75; Viruses - 0; Other Eukaryotes - 3451 (source: NCBI BLink). |
| AT4G31200 | AT4G31200.1 | TCGGGTCGGGT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31200.1 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31200.2 | TCGGGTCGGGT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31200.2 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31200.3 | TCGGGTCGGGT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31200.3 | TTCGGGTCGGGTT | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink). |
| AT4G31210 | AT4G31210.1 | AACCCGACCCGAA | DNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink). |
| AT4G31210.1 | ACCCGACCCGA | DNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink). |
| AT4G31560 | AT4G31560.1 | TCGGGTCGGGTCA | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane. |
| AT4G34830 | AT4G34830.1 | CCGACCCGAA | LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 19818 Blast hits to 5849 proteins in 171 species: Archae - 3; Bacteria - 16; Metazoa - 570; Fungi - 397; Plants - 17732; Viruses - 0; Other Eukaryotes - 1100 (source: NCBI BLink). |
| AT4G34840 | AT4G34840.1 | TTCGGGTCGG | ATMTN2; FUNCTIONS IN: methylthioadenosine nucleosidase activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: ATMTN1; catalytic/ methylthioadenosine nucleosidase (TAIR:AT4G38800.1); Has 1301 Blast hits to 1301 proteins in 595 species: Archae - 0; Bacteria - 1215; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT4G36040 | AT4G36040.1 | CCGACCCGAC | DNAJ heat shock N-terminal domain-containing protein (J11); FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT2G17880.1); Has 12724 Blast hits to 12724 proteins in 1824 species: Archae - 85; Bacteria - 4544; Metazoa - 2505; Fungi - 1062; Plants - 954; Viruses - 5; Other Eukaryotes - 3569 (source: NCBI BLink). |
| AT5G06750 | AT5G06750.2 | CCGACCCGA | protein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: mitochondrion, protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT5G66080.1); Has 3459 Blast hits to 3458 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1097; Fungi - 381; Plants - 1276; Viruses - 5; Other Eukaryotes - 696 (source: NCBI BLink). |
| AT5G06755 | AT5G06755.1 | CCGACCCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown. |
| AT5G06850 | AT5G06850.1 | TTCGGGTCG | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: tryptophan biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT5G48060.1); Has 1175 Blast hits to 999 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 573; Fungi - 10; Plants - 560; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). |
| AT5G07890 | AT5G07890.1 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07890.2 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07890.3 | TTTGACCCGAACCGACCCGACC | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). |
| AT5G07900 | AT5G07900.1 | GGTCGGGTCGGTTCGGGTCAAA | mitochondrial transcription termination factor family protein / mTERF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G21150.1); Has 434 Blast hits to 369 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G08650 | AT5G08650.1 | TCGGGTCGGGT | GTP-binding protein LepA, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding protein LepA (InterPro:IPR006297), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein LepA, C-terminal (InterPro:IPR013842), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: GTP binding / GTPase/ translation elongation factor (TAIR:AT5G39900.1); Has 58694 Blast hits to 51359 proteins in 6862 species: Archae - 845; Bacteria - 29013; Metazoa - 5946; Fungi - 3236; Plants - 868; Viruses - 0; Other Eukaryotes - 18786 (source: NCBI BLink). |
| AT5G10330 | AT5G10330.1 | TCGACCCGA | Encodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. |
| AT5G10330.2 | TCGACCCGA | Encodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. |
| AT5G10330.3 | TCGACCCGA | Encodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. |
| AT5G11480 | AT5G11480.1 | CGACCCGA | GTP binding; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: EMB2001 (embryo defective 2001); GTP binding (TAIR:AT2G22870.1); Has 5119 Blast hits to 5076 proteins in 1347 species: Archae - 69; Bacteria - 3394; Metazoa - 92; Fungi - 98; Plants - 89; Viruses - 0; Other Eukaryotes - 1377 (source: NCBI BLink). |
| AT5G11490 | AT5G11490.1 | TCGGGTCG | adaptin family protein; FUNCTIONS IN: protein transporter activity, protein binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 1821 Blast hits to 1784 proteins in 168 species: Archae - 0; Bacteria - 0; Metazoa - 868; Fungi - 426; Plants - 151; Viruses - 0; Other Eukaryotes - 376 (source: NCBI BLink). |
| AT5G15760 | AT5G15760.1 | CCGACCCGACCCGACC | plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, plastid; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT1G68590.2); Has 330 Blast hits to 330 proteins in 86 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 175 (source: NCBI BLink). |
| AT5G17070 | AT5G17070.1 | GTCGGGTCGGGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; Has 156 Blast hits to 156 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 14; Plants - 18; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G17070.1 | TCGGGTCGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; Has 156 Blast hits to 156 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 14; Plants - 18; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). |
| AT5G19570 | AT5G19570.1 | TTCGGGTCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0546 (InterPro:IPR018908); Has 152 Blast hits to 152 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 35; Plants - 9; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
| AT5G20720 | AT5G20720.1 | CGACCCGACCCGACC | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
| AT5G20720.2 | CGACCCGACCCGACC | Encodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES. |
| AT5G22360 | AT5G22360.1 | TTCGGGTCGG | Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family. |
| AT5G25780 | AT5G25780.1 | TGACCCGACCCGACCCGTCCGA | member of eIF3b - eukaryotic initiation factor 3b |
| AT5G27830 | AT5G27830.1 | TCGGGTCGACCCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G27830.2 | TCGGGTCGACCCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G27830.3 | TCGGGTCGACCCG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folate receptor, conserved region (InterPro:IPR018143); Has 46 Blast hits to 46 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 16; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G42000 | AT5G42000.1 | CGGGTCGGGTCGGAAAACCGGT | ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G42000.2 | CGGGTCGGGTCGGAAAACCGGT | ORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). |
| AT5G43940 | AT5G43940.1 | CGACCCGACCCGACTCGACCCGG | Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility. |
| AT5G45010 | AT5G45010.1 | TTCGGGTCGG | Arabidopsis dss1 homolog on chromosome V (ATDSS1(V)); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); BEST Arabidopsis thaliana protein match is: ATDSS1(I) (ARABIDOPSIS THALIANA DELETION OF SUV3 SUPRESSOR 1(I)) (TAIR:AT1G64750.2); Has 233 Blast hits to 233 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 57; Plants - 43; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G45010.1 | TTCGGGTCGG | Arabidopsis dss1 homolog on chromosome V (ATDSS1(V)); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); BEST Arabidopsis thaliana protein match is: ATDSS1(I) (ARABIDOPSIS THALIANA DELETION OF SUV3 SUPRESSOR 1(I)) (TAIR:AT1G64750.2); Has 233 Blast hits to 233 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 57; Plants - 43; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
| AT5G45620 | AT5G45620.1 | CGGTTCGGGTCGGG | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G45620.2 | CGGTTCGGGTCGGG | 26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink). |
| AT5G45900 | AT5G45900.1 | ATAAAGCCGACCCGACCCGG | Component of autophagy conjugation pathway. Required for proper senescence. |
| AT5G46210 | AT5G46210.1 | TCGGGTCGGGTC | Arabidopsis CULLIN4 (CUL4) forms an E3 ubiquitin ligase with the CDD complex and a common catalytic subunit RBX1 in mediating light control of development. This CUL4-based E3 ligase is essential for the repression of photomorphogenesis. The partial loss of CUL4 function resulted in a constitutive photomorphogenic phenotype with respect to morphogenesis and light-regulated gene expression. CUL4 exhibits a synergistic genetic interaction with COP10 and DET1. |
| AT5G63570 | AT5G63570.1 | TTCGGGTCGG | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. |