| Locus | Gene model | Sequence | Description |
| AT1G02330 | AT1G02330.1 | TAGGGCCCATAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink). |
| AT1G05850 | AT1G05850.1 | TAGGGCCCACA | Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants. |
| AT1G05860 | AT1G05860.1 | TGTGGGCCCTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31600.1); Has 51 Blast hits to 50 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
| AT1G07830 | AT1G07830.1 | TATTGGGCCCTA | ribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
| AT1G07840 | AT1G07840.1 | CTTATTGGGCCCTA | leucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT1G07840.2 | CTTATTGGGCCCTA | leucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT1G07840.3 | CTTATTGGGCCCTA | leucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). |
| AT1G09350 | AT1G09350.1 | TAGGGCCC | Arabidopsis thaliana galactinol synthase 3 (AtGolS3); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, hypocotyl; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G56600.1); Has 871 Blast hits to 870 proteins in 198 species: Archae - 0; Bacteria - 55; Metazoa - 224; Fungi - 186; Plants - 285; Viruses - 70; Other Eukaryotes - 51 (source: NCBI BLink). |
| AT1G12730 | AT1G12730.1 | GGGCCCTAAGCCC | cell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT1G12730.2 | GGGCCCTAAGCCC | cell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). |
| AT1G14320 | AT1G14320.1 | GATGGGCCCTA | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. |
| AT1G14320.2 | GATGGGCCCTA | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. |
| AT1G16810 | AT1G16810.1 | ATATTGGGCCCTATTGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT1G16810.2 | ATATTGGGCCCTATTGGGCTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). |
| AT1G21680 | AT1G21680.1 | GGGCCCTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21670.1); Has 6869 Blast hits to 3873 proteins in 790 species: Archae - 41; Bacteria - 3697; Metazoa - 41; Fungi - 39; Plants - 64; Viruses - 0; Other Eukaryotes - 2987 (source: NCBI BLink). |
| AT1G23400 | AT1G23400.1 | TTATGGGCCTGGCCTTAGGGCCCAATT | Promotes the splicing of chloroplast group II introns. |
| AT1G23890 | AT1G23890.1 | TAAATGGGCCCTACTTGGGCCGTTTT | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT1G23890.2 | TAAATGGGCCCTACTTGGGCCGTTTT | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). |
| AT1G23900 | AT1G23900.1 | AAAACGGCCCAAGTAGGGCCCATTTA | Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane |
| AT1G23900.2 | AAAACGGCCCAAGTAGGGCCCATTTA | Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane |
| AT1G52670 | AT1G52670.1 | TAATGGGCCCTA | biotin/lipoyl attachment domain-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin carboxyl carrier protein of acetyl-CoA carboxylase-related (TAIR:AT3G15690.2); Has 1945 Blast hits to 1945 proteins in 695 species: Archae - 0; Bacteria - 1300; Metazoa - 2; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 568 (source: NCBI BLink). |
| AT1G55630 | AT1G55630.1 | TAGGGCCCATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G60050.1); Has 18827 Blast hits to 5565 proteins in 174 species: Archae - 4; Bacteria - 21; Metazoa - 383; Fungi - 322; Plants - 17397; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink). |
| AT1G66930 | AT1G66930.1 | CTTGGGCCCTA | serine/threonine protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G67000.1); Has 85221 Blast hits to 83970 proteins in 3159 species: Archae - 75; Bacteria - 7164; Metazoa - 37987; Fungi - 6777; Plants - 18536; Viruses - 358; Other Eukaryotes - 14324 (source: NCBI BLink). |
| AT1G72320 | AT1G72320.1 | TAATTGGGCCCTA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.2 | TAATTGGGCCCTA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72320.3 | TAATTGGGCCCTA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
| AT1G72330 | AT1G72330.1 | TAGGGCCCAATTA | Encodes for alanine aminotransferase ALAAT2. |
| AT1G72330.2 | TAGGGCCCAATTA | Encodes for alanine aminotransferase ALAAT2. |
| AT1G73230 | AT1G73230.1 | TAGGGCCCATGG | nascent polypeptide-associated complex (NAC) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative (TAIR:AT1G17880.1); Has 618 Blast hits to 618 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 331; Fungi - 126; Plants - 89; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
| AT1G79810 | AT1G79810.1 | GGGCCCTA | Dominant suppressor of det1 phenotypes. Encodes a peroxisomal protein essential for Arabidopsis growth. Inserted directly from the cytosol into peroxisomes. |
| AT1G79810.2 | GGGCCCTA | Dominant suppressor of det1 phenotypes. Encodes a peroxisomal protein essential for Arabidopsis growth. Inserted directly from the cytosol into peroxisomes. |
| AT1G80080 | AT1G80080.1 | TAGGGCCCAACA | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. |
| AT2G16500 | AT2G16500.1 | TAGGGCCCAAGCCCAAAA | encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
| AT2G32480 | AT2G32480.1 | ATTTGGGCCCTA | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink). |
| AT2G32480.2 | ATTTGGGCCCTA | membrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink). |
| AT2G42210 | AT2G42210.1 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.2 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.3 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT2G42210.4 | ATAATGGGCCCTAAGAGGCCCACA | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. |
| AT3G09150 | AT3G09150.1 | TGTGGGCCCTA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT3G09150.2 | TGTGGGCCCTA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT3G09150.3 | TGTGGGCCCTA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT3G09250 | AT3G09250.1 | CTTGGGCCCTA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10925.2); Has 169 Blast hits to 169 proteins in 54 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). |
| AT3G13300 | AT3G13300.1 | TAGGGCCCAATAA | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT3G13300.2 | TAGGGCCCAATAA | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT3G13930 | AT3G13930.1 | TAGGGCCCAATAT | dihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae - 43; Bacteria - 6315; Metazoa - 646; Fungi - 315; Plants - 198; Viruses - 0; Other Eukaryotes - 7611 (source: NCBI BLink). |
| AT3G15280 | AT3G15280.1 | ACTGGGCCCTA | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT3G15290 | AT3G15290.1 | TAGGGCCCAGT | 3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink). |
| AT3G16140 | AT3G16140.1 | GGGCCCTA | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT3G18165 | AT3G18165.1 | TAGGGCCCTAGAAGCCCAAGGCCCAATAAAACCGGGTCGG | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT3G18790 | AT3G18790.1 | CTTGGGCCCTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isy1-like splicing (InterPro:IPR009360); Has 1075 Blast hits to 879 proteins in 176 species: Archae - 8; Bacteria - 11; Metazoa - 379; Fungi - 177; Plants - 27; Viruses - 9; Other Eukaryotes - 464 (source: NCBI BLink). |
| AT3G55620 | AT3G55620.1 | TAGGGCCCAAAC | embryo defective 1624 (emb1624); FUNCTIONS IN: ribosome binding, translation initiation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational initiation; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor IF6 (InterPro:IPR002769); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 6, putative / eIF-6, putative (TAIR:AT2G39820.1); Has 595 Blast hits to 595 proteins in 239 species: Archae - 161; Bacteria - 0; Metazoa - 147; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). |
| AT3G63370 | AT3G63370.1 | AACGGGCCCTA | pentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16480 Blast hits to 4859 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 46; Plants - 16142; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink). |
| AT4G01480 | AT4G01480.1 | TGGGCCCTA | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT4G08310 | AT4G08310.1 | TAGGGCCCAAAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink). |
| AT4G14230 | AT4G14230.1 | TAGGGCCCAAGGCCCAAAC | CBS domain-containing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14240.1); Has 6669 Blast hits to 6527 proteins in 1353 species: Archae - 64; Bacteria - 4331; Metazoa - 264; Fungi - 186; Plants - 121; Viruses - 0; Other Eukaryotes - 1703 (source: NCBI BLink). |
| AT4G31010 | AT4G31010.1 | CTAATGGGCCCTA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G31010.2 | CTAATGGGCCCTA | RNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G35580 | AT4G35580.1 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G35580.2 | TTTGGGCTTTAAGGCCTTTTTGGGCCCTA | NAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
| AT4G38840 | AT4G38840.1 | TAGGGCCC | auxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus, response to cold; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT2G21210.1); Has 674 Blast hits to 664 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 673; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
| AT5G04800 | AT5G04800.1 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G04800.2 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G04800.3 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G04800.4 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). |
| AT5G05230 | AT5G05230.1 | CCATGGGCCCTA | ubiquitin-protein ligase; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40640.1); Has 74 Blast hits to 74 proteins in 19 species: Archae - 0; Bacteria - 4; Metazoa - 14; Fungi - 8; Plants - 46; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
| AT5G39510 | AT5G39510.1 | GTTTGGGCCCTA | Encodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12. |
| AT5G57580 | AT5G57580.1 | TAGTGGGCCCTA | calmodulin-binding protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Calmodulin binding protein-like (InterPro:IPR012416); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT4G25800.2); Has 187 Blast hits to 178 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 187; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |