Organism | Arabidopsis thaliana | |
ID | AtREG394 | |
Sequence | GCCCATAA | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | ||
Total Entry Count | 403 |
Locus | Gene model | Sequence | Description |
AT1G02560 | AT1G02560.1 | CAAAGCCCATAA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  |
AT1G02560.1 | CAAAGCCCATAA | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  | |
AT1G02680 | AT1G02680.1 | TTATGGGCT | TBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G02770 | AT1G02770.1 | CAAGGCCCAACAAAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19060.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03106 | AT1G03106.1 | TTATGGGCCCATTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03110 | AT1G03110.1 | CAATGGGCCCATAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / katanin p80 subunit, putative (TAIR:AT1G61210.1); Has 10142 Blast hits to 5991 proteins in 342 species: Archae - 38; Bacteria - 2987; Metazoa - 3498; Fungi - 1909; Plants - 650; Viruses - 0; Other Eukaryotes - 1060 (source: NCBI BLink).  |
AT1G04130 | AT1G04130.1 | ATTTGGGCCCATAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink).  |
AT1G04810 | AT1G04810.1 | TTATGGGCCG | 26S proteasome regulatory subunit, putative; FUNCTIONS IN: enzyme regulator activity, binding; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, base subcomplex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Proteasome/cyclosome, regulatory subunit (InterPro:IPR002015), Armadillo-type fold (InterPro:IPR016024), 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit (InterPro:IPR016642); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (TAIR:AT2G32730.1); Has 813 Blast hits to 749 proteins in 190 species: Archae - 12; Bacteria - 25; Metazoa - 307; Fungi - 211; Plants - 86; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink).  |
AT1G06190 | AT1G06190.1 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  |
AT1G06190.2 | CAAAGCCCATAAAGCCCAATA | ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).  | |
AT1G06700 | AT1G06700.1 | GCCCATAA | serine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink).  |
AT1G06700.2 | GCCCATAA | serine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink).  | |
AT1G07000 | AT1G07000.1 | ATCGGCCCATAA | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.  |
AT1G07400 | AT1G07400.1 | AGCCCATTATAGCCCATAAAACGC | 17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink).  |
AT1G09760 | AT1G09760.1 | TTATGGGCCTAACCGACTGGGCCAAT | U2 small nuclear ribonucleoprotein A (U2A'); FUNCTIONS IN: protein binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U2A'/phosphoprotein 32 family A, C-terminal (InterPro:IPR003603); Has 5479 Blast hits to 4495 proteins in 302 species: Archae - 0; Bacteria - 1581; Metazoa - 2979; Fungi - 220; Plants - 106; Viruses - 2; Other Eukaryotes - 591 (source: NCBI BLink).  |
AT1G09770 | AT1G09770.1 | ATTGGCCCAGTCGGTTAGGCCCATAA | Member of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1.  |
AT1G10230 | AT1G10230.1 | TTTAGGCCCATAA | ARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink).  |
AT1G13090 | AT1G13090.1 | CATTGGGCCCATAA | putative cytochrome P450  |
AT1G13900 | AT1G13900.1 | GTAAGGCCCATAATATTGGGCTTAGATAGGCCCATATA | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).  |
AT1G13910 | AT1G13910.1 | TATATGGGCCTATCTAAGCCCAATATTATGGGCCTTAC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink).  |
AT1G14140 | AT1G14140.1 | CATGGGCCCATAA | mitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).  |
AT1G14990 | AT1G14990.1 | ATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G15720 | AT1G15720.1 | TTATGGGCCGAT | Arabidopsis thaliana myb family transcription factor (At1g15720)  |
AT1G17880 | AT1G17880.1 | TTTTGGGCCTTATGGGCCAAT | nascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).  |
AT1G19140 | AT1G19140.1 | TTATGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  |
AT1G19140.2 | TTATGGGCTTTG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  | |
AT1G19150 | AT1G19150.1 | CAAAGCCCATAA | PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA,  |
AT1G21350 | AT1G21350.1 | TTATGGGCTTG | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).  |
AT1G21350.2 | TTATGGGCTTG | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).  | |
AT1G21350.3 | TTATGGGCTTG | antioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).  | |
AT1G21560 | AT1G21560.1 | TTATGGGCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G21580 | AT1G21580.1 | TACGGCCCATAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 5883 Blast hits to 3865 proteins in 351 species: Archae - 2; Bacteria - 340; Metazoa - 2117; Fungi - 809; Plants - 1304; Viruses - 149; Other Eukaryotes - 1162 (source: NCBI BLink).  |
AT1G21651 | AT1G21651.1 | CCGGCCCATAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G24530.1); Has 24082 Blast hits to 13732 proteins in 513 species: Archae - 28; Bacteria - 3626; Metazoa - 10644; Fungi - 4830; Plants - 1984; Viruses - 3; Other Eukaryotes - 2967 (source: NCBI BLink).  |
AT1G23360 | AT1G23360.1 | GCCCATAA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).  |
AT1G23360.2 | GCCCATAA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).  | |
AT1G23360.3 | GCCCATAA | UbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).  | |
AT1G23400 | AT1G23400.1 | TTATGGGCCTGGCCTTAGGGCCCAATT | Promotes the splicing of chloroplast group II introns.  |
AT1G23740 | AT1G23740.1 | TTATGGGCCAC | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae - 321; Bacteria - 14032; Metazoa - 1331; Fungi - 2499; Plants - 781; Viruses - 3; Other Eukaryotes - 6768 (source: NCBI BLink).  |
AT1G23780 | AT1G23780.1 | TATAGGCCCAAATACGGCCCATAA | F-box family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G23770.1); Has 177 Blast hits to 177 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G23970 | AT1G23970.1 | AAAAAGCCCAACTGAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23950.2); Has 75 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G23970.2 | AAAAAGCCCAACTGAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23950.2); Has 75 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G24290 | AT1G24290.1 | TTATGGGC | AAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), ATPase, AAA-type, core (InterPro:IPR003959), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: replication factor C 36 kDA, putative (TAIR:AT1G77470.1); Has 14020 Blast hits to 13994 proteins in 1675 species: Archae - 392; Bacteria - 8113; Metazoa - 478; Fungi - 462; Plants - 133; Viruses - 43; Other Eukaryotes - 4399 (source: NCBI BLink).  |
AT1G26300 | AT1G26300.1 | TAAGCCCATAA | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  |
AT1G26300.2 | TAAGCCCATAA | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  | |
AT1G27450 | AT1G27450.1 | TTATGGGCTGA | Adenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP.  |
AT1G27450.2 | TTATGGGCTGA | Adenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP.  | |
AT1G28060 | AT1G28060.1 | AAATGGGCTTCAGCCCATAA | small nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink).  |
AT1G29060 | AT1G29060.1 | ATCGGCCCGTTAAAAAAGCCCATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT1G29070 | AT1G29070.1 | TTATGGGCTGA | ribosomal protein L34 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271); Has 389 Blast hits to 389 proteins in 164 species: Archae - 0; Bacteria - 342; Metazoa - 0; Fungi - 9; Plants - 23; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT1G29390 | AT1G29390.1 | TTATGGGCCC | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.  |
AT1G29390.2 | TTATGGGCCC | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.  | |
AT1G31812 | AT1G31812.1 | TTATGGGCCTGA | Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases.  |
AT1G32530 | AT1G32530.1 | TAATGGGCTCAAAGCCCATAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink).  |
AT1G32990 | AT1G32990.1 | TTTAGGCCCATTAAGCCCATAA | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11  |
AT1G33120 | AT1G33120.1 | TTATGGGC | 60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).  |
AT1G33290 | AT1G33290.1 | TAAAAGCCCATAGGCCCAAAGGCCCATAA | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 615 Blast hits to 609 proteins in 245 species: Archae - 8; Bacteria - 419; Metazoa - 33; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  |
AT1G33290.2 | TAAAAGCCCATAGGCCCAAAGGCCCATAA | sporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 615 Blast hits to 609 proteins in 245 species: Archae - 8; Bacteria - 419; Metazoa - 33; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).  | |
AT1G33780 | AT1G33780.1 | TTATGGGCTTAGCCCACTA | unknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink).  |
AT1G34630 | AT1G34630.1 | CAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51150.1); Has 221 Blast hits to 214 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT1G34630.2 | CAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51150.1); Has 221 Blast hits to 214 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).  | |
AT1G36990 | AT1G36990.1 | TTATGGGCCCATCT | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08510.1); Has 4597 Blast hits to 1552 proteins in 255 species: Archae - 0; Bacteria - 986; Metazoa - 1160; Fungi - 777; Plants - 63; Viruses - 27; Other Eukaryotes - 1584 (source: NCBI BLink).  |
AT1G48420 | AT1G48420.1 | GAATGGGCCGAGGCCCATAA | Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. Unlike homologous bacterial enzymes, it does not have 1-aminocyclopropane-1-carboxylate deaminase activity.  |
AT1G51980 | AT1G51980.1 | ATTGGGCCAAGCCCATAA | mitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink).  |
AT1G51980.1 | TTATGGGCCTAT | mitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink).  | |
AT1G51980.2 | ATTGGGCCAAGCCCATAA | mitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink).  | |
AT1G51980.2 | TTATGGGCCTAT | mitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink).  | |
AT1G52340 | AT1G52340.1 | TTAAGGCCCATAA | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose.  |
AT1G55630 | AT1G55630.1 | TAGGGCCCATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G60050.1); Has 18827 Blast hits to 5565 proteins in 174 species: Archae - 4; Bacteria - 21; Metazoa - 383; Fungi - 322; Plants - 17397; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink).  |
AT1G61430 | AT1G61430.1 | TACTGGGCCTTATGGGCTTAT | S-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), PAN-like, type 2 (InterPro:IPR013227), Apple-like (InterPro:IPR003609), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61440.1); Has 87173 Blast hits to 85910 proteins in 3093 species: Archae - 55; Bacteria - 7595; Metazoa - 38320; Fungi - 6601; Plants - 19577; Viruses - 379; Other Eukaryotes - 14646 (source: NCBI BLink).  |
AT1G61450 | AT1G61450.1 | GCCCATAAAGGCCC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61415.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G65000 | AT1G65000.1 | CCCAATAAGCCCATTAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, pollen tube, stamen; EXPRESSED DURING: 4 anthesis; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38060.1); Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G68590 | AT1G68590.1 | CAAAGCCCATAA | plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT5G15760.1); Has 334 Blast hits to 334 proteins in 87 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink).  |
AT1G68590.2 | CAAAGCCCATAA | plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT5G15760.1); Has 334 Blast hits to 334 proteins in 87 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink).  | |
AT1G69620 | AT1G69620.1 | CAAGCCCATAA | putative 60S ribosomal protein L34  |
AT1G70570 | AT1G70570.1 | AGCCCATAA | anthranilate phosphoribosyltransferase, putative; FUNCTIONS IN: anthranilate phosphoribosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: tryptophan biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 3, N-terminal (InterPro:IPR017459), Glycosyl transferase, family 3 (InterPro:IPR000312); Has 991 Blast hits to 991 proteins in 393 species: Archae - 46; Bacteria - 770; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).  |
AT1G70720 | AT1G70720.1 | TTATGGGCTAA | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G23205.1); Has 428 Blast hits to 423 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 428; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G73350 | AT1G73350.1 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT1G73350.2 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G73350.3 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 4; Plants - 19; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  | |
AT1G74270 | AT1G74270.1 | TTAAGGCCCATAAGCCCATA | 60S ribosomal protein L35a (RPL35aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aA) (TAIR:AT1G07070.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT1G74280 | AT1G74280.1 | AAGCCCTAATATGGGCTTATGGGCCTTAA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT1G74290.1); Has 506 Blast hits to 505 proteins in 118 species: Archae - 4; Bacteria - 217; Metazoa - 4; Fungi - 28; Plants - 184; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  |
AT1G74470 | AT1G74470.1 | TGAGCCCATAA | Encodes for a multifunctional protein with geranylgeranyl reductase activity shown to catalyze the reduction of prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a (chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl pyrophosphate.  |
AT1G75420 | AT1G75420.1 | AGCCCATAA | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G19710.1); Has 4771 Blast hits to 4769 proteins in 831 species: Archae - 149; Bacteria - 2715; Metazoa - 84; Fungi - 37; Plants - 75; Viruses - 0; Other Eukaryotes - 1711 (source: NCBI BLink).  |
AT1G76860 | AT1G76860.1 | TTATGGGCCTAAT | small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G21190.1); Has 944 Blast hits to 944 proteins in 205 species: Archae - 232; Bacteria - 0; Metazoa - 303; Fungi - 144; Plants - 105; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).  |
AT1G77490 | AT1G77490.1 | TCGGCCCATAA | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.  |
AT1G77690 | AT1G77690.1 | TATGGCCCATAAGCCCAACA | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia.  |
AT1G78190 | AT1G78190.1 | TTATGGGCCTTAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22270.1); Has 285 Blast hits to 285 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT1G79610 | AT1G79610.1 | ATTAGGCCCATAAAAGCCCAAAA | sodium proton exchanger, putative (NHX6); FUNCTIONS IN: solute:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: cation transport, sodium ion transport, regulation of pH; LOCATED IN: integral to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: NHX5; sodium ion transmembrane transporter/ sodium:hydrogen antiporter (TAIR:AT1G54370.1); Has 4010 Blast hits to 4005 proteins in 1041 species: Archae - 71; Bacteria - 2418; Metazoa - 735; Fungi - 95; Plants - 280; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink).  |
AT1G79870 | AT1G79870.1 | GTGGCCCATAA | oxidoreductase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19936 Blast hits to 19933 proteins in 1515 species: Archae - 283; Bacteria - 9447; Metazoa - 662; Fungi - 752; Plants - 323; Viruses - 5; Other Eukaryotes - 8464 (source: NCBI BLink).  |
AT1G79870.1 | TTATGGGCCCAAAAATAGGCCCATCT | oxidoreductase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19936 Blast hits to 19933 proteins in 1515 species: Archae - 283; Bacteria - 9447; Metazoa - 662; Fungi - 752; Plants - 323; Viruses - 5; Other Eukaryotes - 8464 (source: NCBI BLink).  | |
AT1G80550 | AT1G80550.1 | GGGCTTTGGGCCCATAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).  |
AT1G80750 | AT1G80750.1 | GTAAGGCCTTACATAAGCCCATAAATATTGGGCTTTTTTAGCCCAATAG | 60S ribosomal protein L7 (RPL7A); FUNCTIONS IN: structural constituent of ribosome, transcription regulator activity; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30, N-terminal (InterPro:IPR012988), Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L7, eukaryotic (InterPro:IPR005998), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L7 (RPL7D) (TAIR:AT3G13580.3); Has 856 Blast hits to 856 proteins in 248 species: Archae - 76; Bacteria - 0; Metazoa - 354; Fungi - 146; Plants - 114; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).  |
AT2G01180 | AT2G01180.1 | AAGGCCCATAATAAGGCCTAAT | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  |
AT2G01180.2 | AAGGCCCATAATAAGGCCTAAT | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.  | |
AT2G02000 | AT2G02000.1 | TAGCCCATAA | glutamate decarboxylase 3 (GAD3); FUNCTIONS IN: calmodulin binding; INVOLVED IN: carboxylic acid metabolic process, glutamate metabolic process, glutamate decarboxylation to succinate; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent decarboxylase (InterPro:IPR002129), Glutamate decarboxylase (InterPro:IPR010107), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GAD4 (glutamate decarboxylase 4); calmodulin binding (TAIR:AT2G02010.1); Has 1647 Blast hits to 1645 proteins in 499 species: Archae - 126; Bacteria - 839; Metazoa - 130; Fungi - 220; Plants - 174; Viruses - 7; Other Eukaryotes - 151 (source: NCBI BLink).  |
AT2G02000.1 | TAGCCCATAA | glutamate decarboxylase 3 (GAD3); FUNCTIONS IN: calmodulin binding; INVOLVED IN: carboxylic acid metabolic process, glutamate metabolic process, glutamate decarboxylation to succinate; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent decarboxylase (InterPro:IPR002129), Glutamate decarboxylase (InterPro:IPR010107), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GAD4 (glutamate decarboxylase 4); calmodulin binding (TAIR:AT2G02010.1); Has 1647 Blast hits to 1645 proteins in 499 species: Archae - 126; Bacteria - 839; Metazoa - 130; Fungi - 220; Plants - 174; Viruses - 7; Other Eukaryotes - 151 (source: NCBI BLink).  | |
AT2G02500 | AT2G02500.1 | TTATGGGCCTTATTAAAAGCCCATTAG | Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity).  |
AT2G02510 | AT2G02510.1 | CTAATGGGCTTTTAATAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G03430 | AT2G03430.1 | AAAAGGCCCATAAACGGGCCCAATAT | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink).  |
AT2G03690 | AT2G03690.1 | TTATGGGCCAA | Ubiquinone biosynthesis protein COQ4 homolog.  |
AT2G16740 | AT2G16740.1 | TTATGGGC | ubiquitin-conjugating enzyme 29 (UBC29); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC10 (ubiquitin-conjugating enzyme 10); ubiquitin-protein ligase (TAIR:AT5G53300.2); Has 7805 Blast hits to 7784 proteins in 311 species: Archae - 0; Bacteria - 0; Metazoa - 3745; Fungi - 1529; Plants - 1137; Viruses - 19; Other Eukaryotes - 1375 (source: NCBI BLink).  |
AT2G16780 | AT2G16780.1 | GAATGGGCTTTACAGGCCCATAA | Encodes a WD-40 repeat protein similar to yeast MSI1.  |
AT2G16950 | AT2G16950.1 | AAAAAGCCCATAA | Nuclear import receptor for AtGRP7.  |
AT2G16950.2 | AAAAAGCCCATAA | Nuclear import receptor for AtGRP7.  | |
AT2G17240 | AT2G17240.1 | TTATGGGCCACCCAATAAAAGCCTTTAAAAGCCCACTATCAAAACGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24506.1); Has 3052 Blast hits to 987 proteins in 134 species: Archae - 0; Bacteria - 363; Metazoa - 1137; Fungi - 63; Plants - 119; Viruses - 54; Other Eukaryotes - 1316 (source: NCBI BLink).  |
AT2G17390 | AT2G17390.1 | TTATGGGCTTGGGCTCA | Highly homologous to AKR2A. Involved in chloroplast biogenesis. Double mutants of AKR2A and AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes.  |
AT2G18740 | AT2G18740.1 | TTATGGGCTGA | small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative (TAIR:AT4G30330.1); Has 513 Blast hits to 513 proteins in 151 species: Archae - 78; Bacteria - 0; Metazoa - 173; Fungi - 106; Plants - 69; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).  |
AT2G18740.2 | TTATGGGCTGA | small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative (TAIR:AT4G30330.1); Has 513 Blast hits to 513 proteins in 151 species: Archae - 78; Bacteria - 0; Metazoa - 173; Fungi - 106; Plants - 69; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).  | |
AT2G20060 | AT2G20060.1 | TTATGGGCTTTTT | ribosomal protein L4 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4 (InterPro:IPR015498), Ribosomal protein L4/L1e, bacterial-type (InterPro:IPR013005), Ribosomal protein L4/L1e (InterPro:IPR002136); BEST Arabidopsis thaliana protein match is: RPL4; poly(U) binding / structural constituent of ribosome (TAIR:AT1G07320.4); Has 5451 Blast hits to 5451 proteins in 1497 species: Archae - 63; Bacteria - 2944; Metazoa - 100; Fungi - 82; Plants - 60; Viruses - 0; Other Eukaryotes - 2202 (source: NCBI BLink).  |
AT2G20890 | AT2G20890.1 | TTATGGGCTTTTA | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membranedelimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex.  |
AT2G21150 | AT2G21150.1 | AAAGGCCCATAA | XAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. Nuclear localized.  |
AT2G22570 | AT2G22570.1 | TTAGCCCATAA | encodes a nicotinamidase that converts nicotinamide into nicotinic acid. As such the encoded enzyme is involved in the pyridine nucleotide salvage pathway which may be connected to the de novo NAD biosynthesis through the ABA signaling pathway.  |
AT2G22570.2 | TTAGCCCATAA | encodes a nicotinamidase that converts nicotinamide into nicotinic acid. As such the encoded enzyme is involved in the pyridine nucleotide salvage pathway which may be connected to the de novo NAD biosynthesis through the ABA signaling pathway.  | |
AT2G23120 | AT2G23120.1 | AAAAGGCCCATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein 18 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23110.1); Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G24060 | AT2G24060.1 | TTAAAGCCCATAAGCCCATTAA | translation initiation factor 3 (IF-3) family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 3 (InterPro:IPR001288); BEST Arabidopsis thaliana protein match is: translation initiation factor 3 (IF-3) family protein (TAIR:AT4G30690.1); Has 17514 Blast hits to 8661 proteins in 1545 species: Archae - 56; Bacteria - 6187; Metazoa - 2053; Fungi - 689; Plants - 758; Viruses - 336; Other Eukaryotes - 7435 (source: NCBI BLink).  |
AT2G24960 | AT2G24960.1 | AAAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 838 Blast hits to 293 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 21; Plants - 817; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G24960.2 | AAAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 838 Blast hits to 293 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 21; Plants - 817; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G26240 | AT2G26240.1 | TTATGGGCCTAC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43520.1); Has 306 Blast hits to 306 proteins in 93 species: Archae - 0; Bacteria - 30; Metazoa - 172; Fungi - 29; Plants - 67; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT2G27680 | AT2G27680.1 | AGAGGCCCATAA | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G06690.1); Has 7113 Blast hits to 7107 proteins in 1067 species: Archae - 127; Bacteria - 5110; Metazoa - 109; Fungi - 309; Plants - 217; Viruses - 0; Other Eukaryotes - 1241 (source: NCBI BLink).  |
AT2G29210 | AT2G29210.1 | TGGCCCATAA | splicing factor PWI domain-containing protein; INVOLVED IN: RNA splicing; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Splicing factor PWI (InterPro:IPR002483); Has 142243 Blast hits to 70953 proteins in 1843 species: Archae - 141; Bacteria - 12024; Metazoa - 66362; Fungi - 19459; Plants - 11660; Viruses - 2650; Other Eukaryotes - 29947 (source: NCBI BLink).  |
AT2G31370 | AT2G31370.1 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  |
AT2G31370.1 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.2 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.2 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.3 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.3 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.4 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.4 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.5 | GTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.5 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31490 | AT2G31490.1 | TAAATGGGCTTATGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G31610 | AT2G31610.1 | TTAAAGCCCATAA | 40S ribosomal protein S3 (RPS3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation, response to abiotic stimulus; LOCATED IN: in 6 components; EXPRESSED IN: root, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3B) (TAIR:AT3G53870.1); Has 3946 Blast hits to 3943 proteins in 1195 species: Archae - 174; Bacteria - 1992; Metazoa - 298; Fungi - 94; Plants - 101; Viruses - 0; Other Eukaryotes - 1287 (source: NCBI BLink).  |
AT2G32380 | AT2G32380.1 | TTATGGGCCTAAGGCCC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 102 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 9; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G33180 | AT2G33180.1 | ATGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT2G33180.1 | GGCTTTATGGGCTTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT2G36900 | AT2G36900.1 | TCAGGCCCATAA | member of Membrin Gene Family  |
AT2G36900.2 | TCAGGCCCATAA | member of Membrin Gene Family  | |
AT2G37190 | AT2G37190.1 | GAAGCCCATAAGGGTA | 60S ribosomal protein L12 (RPL12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cold, ribosome biogenesis; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12B) (TAIR:AT3G53430.1); Has 1152 Blast hits to 1152 proteins in 433 species: Archae - 208; Bacteria - 278; Metazoa - 292; Fungi - 109; Plants - 81; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
AT2G39390 | AT2G39390.1 | TGGCCCATAA | 60S ribosomal protein L35 (RPL35B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 796 Blast hits to 796 proteins in 298 species: Archae - 108; Bacteria - 128; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).  |
AT2G40380 | AT2G40380.1 | TATAGGCCCATAA | PRENYLATED RAB ACCEPTOR 1.B2 (PRA1.B2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B1 (PRENYLATED RAB ACCEPTOR 1.B1) (TAIR:AT3G56110.1); Has 382 Blast hits to 382 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 64; Plants - 187; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).  |
AT2G40600 | AT2G40600.1 | TCAGGCCCATAA | appr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT1G69340.1); Has 2324 Blast hits to 2216 proteins in 788 species: Archae - 117; Bacteria - 1020; Metazoa - 576; Fungi - 86; Plants - 56; Viruses - 292; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT2G40830 | AT2G40830.1 | CAAGGCCCATAA | Encodes a putative RING-H2 finger protein RHC1a.  |
AT2G40830.2 | CAAGGCCCATAA | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G40830.3 | CAAGGCCCATAA | Encodes a putative RING-H2 finger protein RHC1a.  | |
AT2G41945 | AT2G41945.1 | AAAGCCCATAAGGCCCAGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1).  |
AT2G41945.2 | AAAGCCCATAAGGCCCAGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1).  | |
AT2G41945.3 | AAAGCCCATAAGGCCCAGTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1).  | |
AT2G42610 | AT2G42610.1 | AGGGCCCATAA | LIGHT SENSITIVE HYPOCOTYLS 10 (LSH10); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH6 (LIGHT SENSITIVE HYPOCOTYLS 6) (TAIR:AT1G07090.1); Has 183 Blast hits to 183 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G42610.2 | AGGGCCCATAA | LIGHT SENSITIVE HYPOCOTYLS 10 (LSH10); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH6 (LIGHT SENSITIVE HYPOCOTYLS 6) (TAIR:AT1G07090.1); Has 183 Blast hits to 183 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G44610 | AT2G44610.1 | GCCCATAA | Encodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant.  |
AT2G46090 | AT2G46090.1 | AAAACGGCCCATAA | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs.  |
AT2G46090.1 | TTATGGGCCAT | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs.  | |
AT2G46230 | AT2G46230.1 | TTATGGGCCATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT2G46230.2 | TTATGGGCCATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT2G46390 | AT2G46390.1 | TTATGGGCCATGAGCCCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G46520 | AT2G46520.1 | TTATGGGCTTAT | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative; FUNCTIONS IN: protein transporter activity, importin-alpha export receptor activity, binding; INVOLVED IN: intracellular protein transport, cell proliferation, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), CAS/CSE, C-terminal (InterPro:IPR005043), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Exportin, Cse1-like (InterPro:IPR013713); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT3G59020.2); Has 841 Blast hits to 834 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 412; Fungi - 251; Plants - 70; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).  |
AT2G47960 | AT2G47960.1 | TTATGGGCCAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF974 (InterPro:IPR010378); Has 215 Blast hits to 214 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 46; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT3G02050 | AT3G02050.1 | AGCCCATAATGGGCCTGA | potassium transporter KUP3p (KUP3)  |
AT3G02540 | AT3G02540.1 | TTATGGGCCTAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  |
AT3G02540.2 | TTATGGGCCTAT | PUTATIVE DNA REPAIR PROTEIN RAD23-3 (RAD23-3); FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: DNA repair protein RAD23, putative (TAIR:AT5G38470.1); Has 36702 Blast hits to 20290 proteins in 1352 species: Archae - 153; Bacteria - 8192; Metazoa - 9251; Fungi - 4074; Plants - 5824; Viruses - 1459; Other Eukaryotes - 7749 (source: NCBI BLink).  | |
AT3G02630 | AT3G02630.1 | TTATGGGCCTTAC | acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT5G16240.1); Has 567 Blast hits to 564 proteins in 126 species: Archae - 0; Bacteria - 200; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).  |
AT3G04230 | AT3G04230.1 | TTATGGGCCTT | 40S ribosomal protein S16 (RPS16B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16C) (TAIR:AT5G18380.1); Has 4667 Blast hits to 4667 proteins in 1442 species: Archae - 152; Bacteria - 2454; Metazoa - 279; Fungi - 125; Plants - 110; Viruses - 0; Other Eukaryotes - 1547 (source: NCBI BLink).  |
AT3G04400 | AT3G04400.1 | TTCGGCCCATAA | embryo defective 2171 (emb2171); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14b/L23e (InterPro:IPR000218); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L23 (RPL23B) (TAIR:AT2G33370.1); Has 6297 Blast hits to 6297 proteins in 1833 species: Archae - 236; Bacteria - 2977; Metazoa - 280; Fungi - 176; Plants - 586; Viruses - 0; Other Eukaryotes - 2042 (source: NCBI BLink).  |
AT3G06300 | AT3G06300.1 | TTATGGGCTTTG | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins.  |
AT3G07100 | AT3G07100.1 | TGGCCCATAA | protein transport protein Sec24, putative; FUNCTIONS IN: protein binding, transporter activity, zinc ion binding; INVOLVED IN: intracellular protein transport, transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 74720 Blast hits to 37673 proteins in 1279 species: Archae - 56; Bacteria - 8492; Metazoa - 38339; Fungi - 10824; Plants - 6948; Viruses - 1820; Other Eukaryotes - 8241 (source: NCBI BLink).  |
AT3G07590 | AT3G07590.1 | TTATGGGCCTTAC | small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).  |
AT3G07630 | AT3G07630.1 | TTATGGGCCTTAG | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  |
AT3G07630.2 | TTATGGGCCTTAG | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].  | |
AT3G08640 | AT3G08640.1 | TTATGGGCACGTGGG | alphavirus core protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08630.1); Has 10912 Blast hits to 4701 proteins in 450 species: Archae - 4; Bacteria - 2405; Metazoa - 4145; Fungi - 556; Plants - 2369; Viruses - 93; Other Eukaryotes - 1340 (source: NCBI BLink).  |
AT3G09080 | AT3G09080.1 | TTATGGGCCCATTT | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 11046 Blast hits to 7089 proteins in 331 species: Archae - 36; Bacteria - 2713; Metazoa - 3924; Fungi - 1952; Plants - 817; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink).  |
AT3G09085 | AT3G09085.1 | AAATGGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2253, membrane (InterPro:IPR018722); Has 550 Blast hits to 550 proteins in 186 species: Archae - 0; Bacteria - 294; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G10840 | AT3G10840.1 | CGGCCCATAA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G15490.1); Has 4701 Blast hits to 4652 proteins in 739 species: Archae - 42; Bacteria - 3042; Metazoa - 265; Fungi - 67; Plants - 169; Viruses - 4; Other Eukaryotes - 1112 (source: NCBI BLink).  |
AT3G10915 | AT3G10915.1 | TTATGGGCCGTA | reticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1).  |
AT3G10915.2 | TTATGGGCCGTA | reticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1).  | |
AT3G10915.3 | TTATGGGCCGTA | reticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1).  | |
AT3G10915.4 | TTATGGGCCGTA | reticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1).  | |
AT3G10915.5 | TTATGGGCCGTA | reticulon family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB11) (TAIR:AT3G19460.1).  | |
AT3G10920 | AT3G10920.1 | TACGGCCCATAA | manganese superoxide dismutase (MSD1)  |
AT3G10920.2 | TACGGCCCATAA | manganese superoxide dismutase (MSD1)  | |
AT3G12010 | AT3G12010.1 | TTATGGGCCATAATGGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, cultured cell; CONTAINS InterPro DOMAIN/s: Colon cancer-associated Mic1-like (InterPro:IPR009755); Has 126 Blast hits to 120 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT3G12012 | AT3G12012.1 | TTATGGGCCATAATGGG | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF20 represents a conserved upstream opening reading frame relative to major ORF AT3G12010.1  |
AT3G12260 | AT3G12260.1 | CTTAGGCCCATAAAAAGCCCATTAG | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT3G13230 | AT3G13230.1 | TTATGGGCTTTAT | RNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087); Has 526 Blast hits to 526 proteins in 226 species: Archae - 118; Bacteria - 0; Metazoa - 138; Fungi - 131; Plants - 49; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT3G13700 | AT3G13700.1 | TCAGCCCATAA | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT3G13700.2 | TCAGCCCATAA | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  | |
AT3G13970 | AT3G13970.1 | TTATGGGCTT | AUTOPHAGY 12 B (APG12B); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: autophagy, autophagic vacuole formation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Autophagy protein 12 (InterPro:IPR007242); BEST Arabidopsis thaliana protein match is: ATG12A (AUTOPHAGY 12 A); protein binding (TAIR:AT1G54210.1); Has 228 Blast hits to 228 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 96; Plants - 30; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT3G14410 | AT3G14410.1 | AAAAGCCCATAA | transporter-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT1G53660.1); Has 1496 Blast hits to 1495 proteins in 199 species: Archae - 4; Bacteria - 38; Metazoa - 438; Fungi - 259; Plants - 598; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT3G14415 | AT3G14415.1 | TTATGGGCTTTT | (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: cotyledon, fruit, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14420.2); Has 8872 Blast hits to 8856 proteins in 1094 species: Archae - 112; Bacteria - 3084; Metazoa - 295; Fungi - 423; Plants - 161; Viruses - 0; Other Eukaryotes - 4797 (source: NCBI BLink).  |
AT3G14860 | AT3G14860.1 | CTTAATGGGCCTATTATAAGGCCCATAA | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink).  |
AT3G14860.2 | CTTAATGGGCCTATTATAAGGCCCATAA | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink).  | |
AT3G15260 | AT3G15260.1 | TAAGCCCATAA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink).  |
AT3G15260.2 | TAAGCCCATAA | protein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink).  | |
AT3G15351 | AT3G15351.1 | TAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G15351.2 | TAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G15351.3 | TAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G15380 | AT3G15380.1 | CAAAGCCCATAA | choline transporter-related; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF580 (InterPro:IPR007603); BEST Arabidopsis thaliana protein match is: choline transporter-related (TAIR:AT4G38640.1); Has 687 Blast hits to 679 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 406; Fungi - 83; Plants - 66; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
AT3G16080 | AT3G16080.1 | ATGGCCCATAA | 60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT3G17160 | AT3G17160.1 | TAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47970.1); Has 52518 Blast hits to 22905 proteins in 895 species: Archae - 191; Bacteria - 9602; Metazoa - 17412; Fungi - 7793; Plants - 2829; Viruses - 960; Other Eukaryotes - 13731 (source: NCBI BLink).  |
AT3G17430 | AT3G17430.1 | TATAGGCCCATAAAGCCCAAT | phosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT1G48230.1); Has 1446 Blast hits to 1445 proteins in 173 species: Archae - 0; Bacteria - 5; Metazoa - 374; Fungi - 259; Plants - 650; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).  |
AT3G17626 | AT3G17626.1 | TTATGGGCTTTATTATTGGGCTTTTAGCCCAACT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: ribosomal protein L18 family protein (TAIR:AT1G48350.1); Has 336 Blast hits to 336 proteins in 121 species: Archae - 0; Bacteria - 241; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT3G18420 | AT3G18420.1 | TTAAAGGCCCATAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 2006 Blast hits to 1561 proteins in 415 species: Archae - 271; Bacteria - 982; Metazoa - 160; Fungi - 19; Plants - 64; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink).  |
AT3G18430 | AT3G18430.1 | TTATGGGCCTTTAA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: CAM9 (CALMODULIN 9); calcium ion binding (TAIR:AT3G51920.1); Has 3772 Blast hits to 3771 proteins in 389 species: Archae - 0; Bacteria - 11; Metazoa - 2178; Fungi - 257; Plants - 701; Viruses - 0; Other Eukaryotes - 625 (source: NCBI BLink).  |
AT3G20050 | AT3G20050.1 | CAAGCCCATAA | Encodes a putative cytoplasmic chaperonin that is similar to mouse Tcp-1 (t complex polypeptide 1).  |
AT3G20330 | AT3G20330.1 | TTATGGGCTTTAGAAGCCCAAAT | encodes aspartate carbamoyltransferase catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis  |
AT3G22150 | AT3G22150.1 | AGAGGCCCATAA | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink).  |
AT3G22150.1 | TTATGGGC | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink).  | |
AT3G23290 | AT3G23290.2 | GCCCATAA | LIGHT SENSITIVE HYPOCOTYLS 4 (LSH4); EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH3 (LIGHT SENSITIVE HYPOCOTYLS 3) (TAIR:AT2G31160.1); Has 185 Blast hits to 185 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G24515 | AT3G24515.1 | AGGGCCCATAA | ubiquitin-conjugating enzyme 37 (UBC37); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC11 (UBIQUITIN-CONJUGATING ENZYME 11); ubiquitin-protein ligase (TAIR:AT3G08690.1); Has 7488 Blast hits to 7480 proteins in 304 species: Archae - 0; Bacteria - 0; Metazoa - 3738; Fungi - 1409; Plants - 1069; Viruses - 22; Other Eukaryotes - 1250 (source: NCBI BLink).  |
AT3G24515.1 | AGGGCCCATAA | ubiquitin-conjugating enzyme 37 (UBC37); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC11 (UBIQUITIN-CONJUGATING ENZYME 11); ubiquitin-protein ligase (TAIR:AT3G08690.1); Has 7488 Blast hits to 7480 proteins in 304 species: Archae - 0; Bacteria - 0; Metazoa - 3738; Fungi - 1409; Plants - 1069; Viruses - 22; Other Eukaryotes - 1250 (source: NCBI BLink).  | |
AT3G24515.1 | TTTTGGGCCCATAA | ubiquitin-conjugating enzyme 37 (UBC37); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC11 (UBIQUITIN-CONJUGATING ENZYME 11); ubiquitin-protein ligase (TAIR:AT3G08690.1); Has 7488 Blast hits to 7480 proteins in 304 species: Archae - 0; Bacteria - 0; Metazoa - 3738; Fungi - 1409; Plants - 1069; Viruses - 22; Other Eukaryotes - 1250 (source: NCBI BLink).  | |
AT3G25040 | AT3G25040.1 | AGCCCAAAACTAGGCCCATAA | ER lumen protein retaining receptor, putative / HDEL receptor, putative; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ERD2 (ENDOPLASMIC RETICULUM RETENTION DEFECTIVE 2); KDEL sequence binding / receptor (TAIR:AT1G29330.1); Has 642 Blast hits to 641 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 271; Fungi - 121; Plants - 119; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  |
AT3G26511 | AT3G26511.1 | TTATGGGCTA | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).  |
AT3G26618 | AT3G26618.1 | TTAAAGCCAAGCCCATAA | eukaryotic release factor 1-3 (ERF1-3); FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube, leaf; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: eRF1 domain 2 (InterPro:IPR005141), eRF1 domain 3 (InterPro:IPR005142), eRF1 domain 1 (InterPro:IPR005140), Peptide chain release factor eRF/aRF subunit 1 (InterPro:IPR004403); BEST Arabidopsis thaliana protein match is: ERF1-2 (EUKARYOTIC RELEASE FACTOR 1-2); translation release factor (TAIR:AT1G12920.1); Has 801 Blast hits to 799 proteins in 274 species: Archae - 191; Bacteria - 2; Metazoa - 164; Fungi - 97; Plants - 79; Viruses - 1; Other Eukaryotes - 267 (source: NCBI BLink).  |
AT3G27520 | AT3G27520.1 | ATCGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G46060 | AT3G46060.1 | AAAAGGCCCATAA | small GTP-binding protein (ara-3)  |
AT3G46060.2 | AAAAGGCCCATAA | small GTP-binding protein (ara-3)  | |
AT3G46060.3 | AAAAGGCCCATAA | small GTP-binding protein (ara-3)  | |
AT3G46430 | AT3G46430.1 | AAAAAGCCCATTATGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59613.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G46960 | AT3G46960.1 | TGAGCCCATAA | ATP binding / ATP-dependent helicase/ helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides, helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DSH, C-terminal (InterPro:IPR012961), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), RNA helicase, ATP-dependent, SK12/DOB1 (InterPro:IPR016438), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: HEN2 (hua enhancer 2); ATP-dependent helicase/ RNA helicase (TAIR:AT2G06990.1); Has 7311 Blast hits to 5276 proteins in 657 species: Archae - 463; Bacteria - 1480; Metazoa - 1237; Fungi - 1015; Plants - 265; Viruses - 46; Other Eukaryotes - 2805 (source: NCBI BLink).  |
AT3G48680 | AT3G48680.1 | TTAGCCCATAAGGCCCAATAA | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex.  |
AT3G49800 | AT3G49800.1 | TTATGGGCTATT | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 131 Blast hits to 121 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 1; Plants - 111; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G49800.1 | TTATGGGCTTTA | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 131 Blast hits to 121 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 1; Plants - 111; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT3G50360 | AT3G50360.1 | TTATGGGCCTT | CENTRIN2 (ATCEN2); FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: caltractin, putative / centrin, putative (TAIR:AT4G37010.2); Has 25773 Blast hits to 16030 proteins in 1342 species: Archae - 0; Bacteria - 125; Metazoa - 11739; Fungi - 5407; Plants - 4427; Viruses - 2; Other Eukaryotes - 4073 (source: NCBI BLink).  |
AT3G50590 | AT3G50590.1 | CCCATTTAGGCCCATAA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G51010 | AT3G51010.1 | TATAGGCCCATAAGGCCCATTAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G51440 | AT3G51440.1 | TTAAAGCCCATAA | strictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 1156 Blast hits to 1151 proteins in 269 species: Archae - 13; Bacteria - 456; Metazoa - 195; Fungi - 19; Plants - 279; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).  |
AT3G51880 | AT3G51880.1 | TGGCCCATAA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  |
AT3G51880.2 | TGGCCCATAA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  | |
AT3G51880.3 | TGGCCCATAA | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.  | |
AT3G52220 | AT3G52220.1 | TTGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 9607 Blast hits to 4937 proteins in 278 species: Archae - 10; Bacteria - 152; Metazoa - 4787; Fungi - 1223; Plants - 656; Viruses - 23; Other Eukaryotes - 2756 (source: NCBI BLink).  |
AT3G52230 | AT3G52230.1 | TTATGGGCCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G52580 | AT3G52580.1 | TTATGGGCCGTA | 40S ribosomal protein S14 (RPS14C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971), Ribosomal S11, conserved site (InterPro:IPR018102); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S14 (RPS14B) (TAIR:AT3G11510.1); Has 6258 Blast hits to 6258 proteins in 1752 species: Archae - 169; Bacteria - 2837; Metazoa - 489; Fungi - 109; Plants - 512; Viruses - 0; Other Eukaryotes - 2142 (source: NCBI BLink).  |
AT3G53020 | AT3G53020.1 | TTATGGGCCTATT | RPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20.  |
AT3G53030 | AT3G53030.1 | AATAGGCCCATAA | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31.  |
AT3G53320 | AT3G53320.1 | TTATGGGCTTTAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37070.1); Has 10077 Blast hits to 5050 proteins in 411 species: Archae - 0; Bacteria - 1106; Metazoa - 4046; Fungi - 1512; Plants - 226; Viruses - 108; Other Eukaryotes - 3079 (source: NCBI BLink).  |
AT3G54190 | AT3G54190.1 | AGCCCATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT3G54540 | AT3G54540.1 | ATAAGCCCATAATGAGGCCCAATAAG | member of GCN subfamily  |
AT3G54920 | AT3G54920.1 | GATGGGCCTGGTTATGGGCCTAAC | Powdery mildew resistant mutant encodes a pectate lyase-like protein  |
AT3G59280 | AT3G59280.1 | CAAGCCCATAA | mutant exhibited resistance to growth on media containing thaxtomin due to a difference in the rate of uptake of the toxin.We proposed that TXR1 is a component of, or regulator of, a dispensable transport mechanism.  |
AT3G59340 | AT3G59340.1 | TATAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF914, eukaryotic (InterPro:IPR009262); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59310.1); Has 715 Blast hits to 712 proteins in 169 species: Archae - 7; Bacteria - 146; Metazoa - 153; Fungi - 87; Plants - 74; Viruses - 0; Other Eukaryotes - 248 (source: NCBI BLink).  |
AT3G60640 | AT3G60640.1 | TTATGGGCCTTAG | AUTOPHAGY 8G (ATG8G); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: ATG8F (autophagy 8f); microtubule binding (TAIR:AT4G16520.2); Has 1156 Blast hits to 1154 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 574; Fungi - 125; Plants - 171; Viruses - 3; Other Eukaryotes - 283 (source: NCBI BLink).  |
AT3G62790 | AT3G62790.1 | TTAAAGCCCATAA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT2G47690.1); Has 85 Blast hits to 85 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 43; Plants - 36; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).  |
AT4G00860 | AT4G00860.1 | AAATGGGCCCATAATGGCCCAATAT | putative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains.  |
AT4G02210 | AT4G02210.1 | ATAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G02220 | AT4G02220.1 | TTATGGGCTTAT | zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytoplasm; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Programmed cell death protein 2, C-terminal (InterPro:IPR007320), Zinc finger, MYND-type (InterPro:IPR002893); BEST Arabidopsis thaliana protein match is: programmed cell death 2 C-terminal domain-containing protein (TAIR:AT5G64830.1); Has 702 Blast hits to 666 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 368; Fungi - 111; Plants - 110; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink).  |
AT4G02880 | AT4G02880.1 | TTATGGGCTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03290.1); Has 3704 Blast hits to 3126 proteins in 384 species: Archae - 40; Bacteria - 363; Metazoa - 1661; Fungi - 338; Plants - 170; Viruses - 7; Other Eukaryotes - 1125 (source: NCBI BLink).  |
AT4G10010 | AT4G10010.1 | TTATGGGCT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G33770.1); Has 85368 Blast hits to 84573 proteins in 3049 species: Archae - 36; Bacteria - 7343; Metazoa - 37754; Fungi - 8036; Plants - 16009; Viruses - 407; Other Eukaryotes - 15783 (source: NCBI BLink).  |
AT4G11150 | AT4G11150.1 | CTAAGGCCCATAA | Encodes a vacuolar H+-ATPase subunit E isoform 1 which is required for Golgi organization and vacuole function in embryogenesis.  |
AT4G12740 | AT4G12740.1 | TTATGGGC | adenine-DNA glycosylase-related / MYH-related; FUNCTIONS IN: hydrolase activity, 4 iron, 4 sulfur cluster binding, catalytic activity, endonuclease activity; INVOLVED IN: DNA repair, base-excision repair; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), DNA glycosylase (InterPro:IPR011257), Endonuclease III-like, iron-sulphur cluster loop (InterPro:IPR003651), HhH-GPD domain (InterPro:IPR003265), NUDIX hydrolase, core (InterPro:IPR000086); Has 55163 Blast hits to 25264 proteins in 1738 species: Archae - 282; Bacteria - 6884; Metazoa - 21116; Fungi - 4587; Plants - 1560; Viruses - 859; Other Eukaryotes - 19875 (source: NCBI BLink).  |
AT4G13540 | AT4G13540.1 | GCCCATAA | unknown protein; INVOLVED IN: N-terminal protein myristoylation; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23930.1); Has 4331 Blast hits to 3076 proteins in 297 species: Archae - 26; Bacteria - 235; Metazoa - 1804; Fungi - 392; Plants - 81; Viruses - 38; Other Eukaryotes - 1755 (source: NCBI BLink).  |
AT4G13660 | AT4G13660.1 | TAGCCCATAA | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows preference for pinoresinol and not lariciresinol.  |
AT4G14270 | AT4G14270.1 | CTTAATGGGCTTATGGGCTTC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.  |
AT4G14270.2 | CTTAATGGGCTTATGGGCTTC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.  | |
AT4G14300 | AT4G14300.1 | TAAGCCCATAA | heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT2G33410.1); Has 82956 Blast hits to 37358 proteins in 1472 species: Archae - 56; Bacteria - 18252; Metazoa - 33610; Fungi - 7047; Plants - 9752; Viruses - 546; Other Eukaryotes - 13693 (source: NCBI BLink).  |
AT4G14870 | AT4G14870.1 | ATTTGGGCTTTATAAGGCCCATAA | P-P-bond-hydrolysis-driven protein transmembrane transporter; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein secretion; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecE subunit of protein translocation complex (InterPro:IPR005807); Has 24 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT4G15240 | AT4G15240.1 | CAAGCCCATAA | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT1G05280.1); Has 368 Blast hits to 364 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 109; Plants - 125; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G16720 | AT4G16720.1 | TTATGGGCCTTTA | 60S ribosomal protein L15 (RPL15A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15B) (TAIR:AT4G17390.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).  |
AT4G16770 | AT4G16770.1 | TTATGGGCCTAAAGCCCAGTA | iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G16765.2); Has 6031 Blast hits to 6015 proteins in 680 species: Archae - 0; Bacteria - 734; Metazoa - 132; Fungi - 691; Plants - 2939; Viruses - 0; Other Eukaryotes - 1535 (source: NCBI BLink).  |
AT4G17040 | AT4G17040.1 | TGAGCCCATAA | ATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plastid stroma, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: ATP-dependent Clp protease proteolytic subunit, putative (TAIR:AT1G09130.2); Has 8307 Blast hits to 8303 proteins in 1647 species: Archae - 0; Bacteria - 4113; Metazoa - 115; Fungi - 50; Plants - 683; Viruses - 6; Other Eukaryotes - 3340 (source: NCBI BLink).  |
AT4G17050 | AT4G17050.1 | TTATGGGCTCA | UREIDOGLYCINE AMINOHYDROLASE (UGLYAH); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cupin 2, conserved barrel (InterPro:IPR013096), Cupin, RmlC-type (InterPro:IPR011051), RmlC-like jelly roll fold (InterPro:IPR014710); Has 513 Blast hits to 513 proteins in 229 species: Archae - 4; Bacteria - 414; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).  |
AT4G17560 | AT4G17560.1 | AACGGCCCATAA | ribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink).  |
AT4G18040 | AT4G18040.1 | TTAAAGCCCATAA | eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein.  |
AT4G20440 | AT4G20440.1 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  |
AT4G20440.1 | TAAGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.2 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.2 | TAAGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.3 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.3 | TAAGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.4 | GTTTGGGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G20440.4 | TAAGCCCATAA | small nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink).  | |
AT4G23250 | AT4G23250.1 | TTATGGGCCATA | EMBRYO DEFECTIVE 1290 (EMB1290); FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: embryonic development ending in seed dormancy, protein amino acid autophosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Protein of unknown function DUF26 (InterPro:IPR002902), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: ATP binding / protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G23260.1); Has 87813 Blast hits to 85985 proteins in 3092 species: Archae - 45; Bacteria - 7629; Metazoa - 37890; Fungi - 6855; Plants - 20068; Viruses - 386; Other Eukaryotes - 14940 (source: NCBI BLink).  |
AT4G23620 | AT4G23620.1 | TTAAAGCCCATAA | 50S ribosomal protein-related; FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L25 (InterPro:IPR001021), Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding (InterPro:IPR011035); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66860.1); Has 2862 Blast hits to 2862 proteins in 613 species: Archae - 0; Bacteria - 1307; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1515 (source: NCBI BLink).  |
AT4G23710 | AT4G23710.1 | ATTAGGCCCATAA | VAG2; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances; INVOLVED IN: proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar (H+)-ATPase G subunit (InterPro:IPR005124); BEST Arabidopsis thaliana protein match is: VMA10 (VACUOLAR MEMBRANE ATPASE 10); hydrogen ion transporting ATP synthase, rotational mechanism (TAIR:AT3G01390.2); Has 470 Blast hits to 470 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 268; Fungi - 80; Plants - 75; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
AT4G24570 | AT4G24570.1 | ATAAGCCCATAA | mitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: UCP5 (UNCOUPLING PROTEIN 5); binding (TAIR:AT2G22500.1); Has 15369 Blast hits to 9513 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 7655; Fungi - 4171; Plants - 2183; Viruses - 0; Other Eukaryotes - 1360 (source: NCBI BLink).  |
AT4G24750 | AT4G24750.1 | TTATGGGCTTTTA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT3G08920.1); Has 222 Blast hits to 222 proteins in 59 species: Archae - 8; Bacteria - 82; Metazoa - 0; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).  |
AT4G25550 | AT4G25550.1 | GCCCATAA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 53; Plants - 42; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT4G25550.1 | TTATGGGCCGGG | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 53; Plants - 42; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  | |
AT4G26230 | AT4G26230.1 | AAAGGCCCATAA | 60S ribosomal protein L31 (RPL31B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31C) (TAIR:AT5G56710.1); Has 865 Blast hits to 865 proteins in 270 species: Archae - 110; Bacteria - 2; Metazoa - 389; Fungi - 91; Plants - 124; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink).  |
AT4G28360 | AT4G28360.1 | ATAGGCCCATAA | ribosomal protein L22 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22, bacterial-type (InterPro:IPR005727); BEST Arabidopsis thaliana protein match is: ribosomal protein L22 family protein (TAIR:AT1G52370.3); Has 5503 Blast hits to 5503 proteins in 1687 species: Archae - 0; Bacteria - 3089; Metazoa - 109; Fungi - 48; Plants - 431; Viruses - 0; Other Eukaryotes - 1826 (source: NCBI BLink).  |
AT4G28470 | AT4G28470.1 | TTATGGGCTGAGCCCA | encoding the RPN subunits of the 26S proteasome  |
AT4G28660 | AT4G28660.1 | TAAAAGCCCATAA | Similar to PsbW subunit of photosystem II.  |
AT4G29735 | AT4G29735.1 | TGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0197 (InterPro:IPR007915).  |
AT4G29735.2 | TGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0197 (InterPro:IPR007915).  | |
AT4G30500 | AT4G30500.1 | TTATGGGCCTTTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23940.1); Has 218 Blast hits to 218 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 72; Plants - 29; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT4G31700 | AT4G31700.1 | GGGCCCATAA | Encodes a putative ribosomal protein S6 (rps6).  |
AT4G31700.2 | GGGCCCATAA | Encodes a putative ribosomal protein S6 (rps6).  | |
AT4G31810 | AT4G31810.1 | CTTGGGCCTTATGGGCTCA | enoyl-CoA hydratase/isomerase family protein; FUNCTIONS IN: 3-hydroxyisobutyryl-CoA hydrolase activity, catalytic activity; INVOLVED IN: fatty acid beta-oxidation, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: enoyl-CoA hydratase/isomerase family protein (TAIR:AT3G60510.1); Has 15447 Blast hits to 15442 proteins in 1087 species: Archae - 153; Bacteria - 9368; Metazoa - 927; Fungi - 405; Plants - 335; Viruses - 0; Other Eukaryotes - 4259 (source: NCBI BLink).  |
AT4G31810.1 | TTATGGGCTAA | enoyl-CoA hydratase/isomerase family protein; FUNCTIONS IN: 3-hydroxyisobutyryl-CoA hydrolase activity, catalytic activity; INVOLVED IN: fatty acid beta-oxidation, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: enoyl-CoA hydratase/isomerase family protein (TAIR:AT3G60510.1); Has 15447 Blast hits to 15442 proteins in 1087 species: Archae - 153; Bacteria - 9368; Metazoa - 927; Fungi - 405; Plants - 335; Viruses - 0; Other Eukaryotes - 4259 (source: NCBI BLink).  | |
AT4G32280 | AT4G32280.1 | TTATGGGCCAA | Auxin inducible protein.  |
AT4G34900 | AT4G34900.1 | TTATGGGCTTA | XXANTHINE DEHYDROGENASE 2 (XDH2); FUNCTIONS IN: in 8 functions; INVOLVED IN: allantoin biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Aldehyde oxidase/xanthine dehydrogenase (InterPro:IPR016208), Ferredoxin (InterPro:IPR001041), Molybdopterin dehydrogenase, FAD-binding (InterPro:IPR002346), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675), [2Fe-2S]-binding (InterPro:IPR002888), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167), FAD-binding, type 2 (InterPro:IPR016166), CO dehydrogenase flavoprotein, C-terminal (InterPro:IPR005107), 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (InterPro:IPR016169), Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead (InterPro:IPR000674), Aldehyde oxidase and xanthine dehydrogenase, molybdopterin binding (InterPro:IPR008274); BEST Arabidopsis thaliana protein match is: XDH1 (XANTHINE DEHYDROGENASE 1); xanthine dehydrogenase (TAIR:AT4G34890.1); Has 15600 Blast hits to 15136 proteins in 810 species: Archae - 184; Bacteria - 7544; Metazoa - 1009; Fungi - 62; Plants - 139; Viruses - 0; Other Eukaryotes - 6662 (source: NCBI BLink).  |
AT4G34910 | AT4G34910.1 | TAAGCCCATAA | DEAD/DEAH box helicase, putative (RH16); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 23736 Blast hits to 23298 proteins in 1666 species: Archae - 321; Bacteria - 8811; Metazoa - 4714; Fungi - 2993; Plants - 1279; Viruses - 4; Other Eukaryotes - 5614 (source: NCBI BLink).  |
AT4G35220 | AT4G35220.1 | TCAGGCCCATAA | cyclase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Putative cyclase (InterPro:IPR007325); BEST Arabidopsis thaliana protein match is: cyclase family protein (TAIR:AT4G34180.1); Has 778 Blast hits to 778 proteins in 304 species: Archae - 55; Bacteria - 578; Metazoa - 30; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  |
AT4G35250 | AT4G35250.1 | AGCCCATAA | vestitone reductase-related; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: flavin reductase-related (TAIR:AT2G34460.1); Has 2853 Blast hits to 2853 proteins in 675 species: Archae - 20; Bacteria - 1994; Metazoa - 46; Fungi - 85; Plants - 272; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink).  |
AT4G36420 | AT4G36420.1 | ATAGGCCCATAAAGGCCCATTT | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5784 Blast hits to 5784 proteins in 1564 species: Archae - 0; Bacteria - 3201; Metazoa - 134; Fungi - 85; Plants - 177; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink).  |
AT4G37110 | AT4G37110.1 | TTATGGGCCGTT | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Cell division cycle-associated protein (InterPro:IPR018866); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23530.1); Has 269 Blast hits to 266 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 26; Plants - 106; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT4G37120 | AT4G37120.1 | AACGGCCCATAA | Encodes a zinc finger containing protein similar to step II splicing factors that is similar to SMP1. SMP2 is also reduced in SMP1 epigenetic alleles; plants make smaller organs having reduced cell numbers but increased cell size.  |
AT4G37660 | AT4G37660.1 | TTATGGGCCTTAT | ribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5731 Blast hits to 5731 proteins in 1563 species: Archae - 0; Bacteria - 3202; Metazoa - 131; Fungi - 85; Plants - 177; Viruses - 0; Other Eukaryotes - 2136 (source: NCBI BLink).  |
AT4G37830 | AT4G37830.1 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT4G37830.2 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT4G38210 | AT4G38210.1 | TTATGGGCTTC | expansin -like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.  |
AT4G38790 | AT4G38790.1 | TTATGGGCCTAAT | ER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT2G21190.1); Has 626 Blast hits to 626 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 114; Plants - 120; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  |
AT4G38890 | AT4G38890.1 | TTATGGGCCGGTTTTTGGCCCATTAA | dihydrouridine synthase family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: oxidation reduction, tRNA processing, metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7322 Blast hits to 7247 proteins in 1396 species: Archae - 11; Bacteria - 4174; Metazoa - 431; Fungi - 362; Plants - 91; Viruses - 0; Other Eukaryotes - 2253 (source: NCBI BLink).  |
AT4G39420 | AT4G39420.1 | TTATGGGCCAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible.  |
AT4G39420.2 | TTATGGGCCAT | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible.  | |
AT5G01960 | AT5G01960.1 | ATAAGGCCCATAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G65040.3); Has 3886 Blast hits to 3874 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 2090; Fungi - 415; Plants - 660; Viruses - 46; Other Eukaryotes - 675 (source: NCBI BLink).  |
AT5G02240 | AT5G02240.1 | TATGGCCCATAA | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.  |
AT5G02250 | AT5G02250.1 | AGCCCATAA | Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis.  |
AT5G02740 | AT5G02740.1 | TTATGGGCTTTGGCCTTTT | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G02740.2 | TTATGGGCTTTGGCCTTTT | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G02770 | AT5G02770.1 | CCGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 367 Blast hits to 255 proteins in 95 species: Archae - 0; Bacteria - 48; Metazoa - 197; Fungi - 19; Plants - 22; Viruses - 0; Other Eukaryotes - 81 (source: NCBI BLink).  |
AT5G05110 | AT5G05110.1 | ATGGCCCATAA | cysteine protease inhibitor, putative / cystatin, putative; FUNCTIONS IN: cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT3G12490.2); Has 445 Blast hits to 422 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 436; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G05320 | AT5G05320.1 | TTATGGGCTTTTT | monooxygenase, putative (MO3); FUNCTIONS IN: monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: monooxygenase, putative (MO2) (TAIR:AT4G38540.1); Has 3563 Blast hits to 3548 proteins in 650 species: Archae - 42; Bacteria - 1804; Metazoa - 7; Fungi - 839; Plants - 277; Viruses - 0; Other Eukaryotes - 594 (source: NCBI BLink).  |
AT5G05540 | AT5G05540.1 | CAAGGCCCATAA | SMALL RNA DEGRADING NUCLEASE 2 (SDN2); FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding (TAIR:AT5G67240.1); Has 1287 Blast hits to 1276 proteins in 177 species: Archae - 0; Bacteria - 12; Metazoa - 608; Fungi - 388; Plants - 159; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  |
AT5G05540.2 | CAAGGCCCATAA | SMALL RNA DEGRADING NUCLEASE 2 (SDN2); FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding (TAIR:AT5G67240.1); Has 1287 Blast hits to 1276 proteins in 177 species: Archae - 0; Bacteria - 12; Metazoa - 608; Fungi - 388; Plants - 159; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).  | |
AT5G08530 | AT5G08530.1 | AGAGGCCCATAA | 51 kDa subunit of complex I (CI51); FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, NAD or NADH binding, FMN binding, NADH dehydrogenase (ubiquinone) activity, oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NADH-ubiquinone oxidoreductase, 51 kDa subunit, conserved site (InterPro:IPR001949), NADH-ubiquinone oxidoreductase, 51 kDa subunit (InterPro:IPR011538), NADH-ubiquinone oxidoreductase, F subunit (InterPro:IPR011537); Has 6830 Blast hits to 6821 proteins in 987 species: Archae - 16; Bacteria - 2579; Metazoa - 179; Fungi - 80; Plants - 67; Viruses - 0; Other Eukaryotes - 3909 (source: NCBI BLink).  |
AT5G08535 | AT5G08535.1 | TTATGGGCCTCT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 689 Blast hits to 689 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 494; Fungi - 66; Plants - 91; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT5G08535.2 | TTATGGGCCTCT | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT3G52350.1); Has 689 Blast hits to 689 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 494; Fungi - 66; Plants - 91; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  | |
AT5G09740 | AT5G09740.1 | TTTAACGGCCCATAA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.  |
AT5G09740.2 | TTTAACGGCCCATAA | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.  | |
AT5G10360 | AT5G10360.1 | TTATGGGCCCATAA | embryo defective 3010 (EMB3010); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S6e (InterPro:IPR001377), Ribosomal protein S6, eukaryotic (InterPro:IPR014401), Ribosomal protein S6e, conserved site (InterPro:IPR018282); BEST Arabidopsis thaliana protein match is: RPS6 (RIBOSOMAL PROTEIN S6); structural constituent of ribosome (TAIR:AT4G31700.1); Has 832 Blast hits to 830 proteins in 304 species: Archae - 152; Bacteria - 0; Metazoa - 342; Fungi - 112; Plants - 80; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT5G10560 | AT5G10560.1 | TAAAGGCCCATAA | glycosyl hydrolase family 3 protein; FUNCTIONS IN: xylan 1,4-beta-xylosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT1G78060.1); Has 5112 Blast hits to 4512 proteins in 661 species: Archae - 16; Bacteria - 2460; Metazoa - 12; Fungi - 920; Plants - 292; Viruses - 0; Other Eukaryotes - 1412 (source: NCBI BLink).  |
AT5G10870 | AT5G10870.1 | TTATGGGCCA | Encodes chorismate mutase AtCM2.  |
AT5G11380 | AT5G11380.1 | TTATGGGCTTTAA | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity.  |
AT5G11380.2 | TTATGGGCTTTAA | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity.  | |
AT5G11900 | AT5G11900.1 | AATAGCCCATAA | eukaryotic translation initiation factor SUI1 family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Density-regulated protein DRP1 (InterPro:IPR005873); Has 351 Blast hits to 351 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 157; Fungi - 113; Plants - 29; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT5G15520 | AT5G15520.1 | ATGGCCCATAATGGG | 40S ribosomal protein S19 (RPS19B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19A) (TAIR:AT3G02080.1); Has 879 Blast hits to 879 proteins in 288 species: Archae - 134; Bacteria - 1; Metazoa - 345; Fungi - 97; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT5G15750 | AT5G15750.1 | ATGGGCTTCTCAGGCCCATAA | RNA-binding S4 domain-containing protein; FUNCTIONS IN: RNA binding, rRNA binding; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), RNA-binding S4 (InterPro:IPR002942); Has 877 Blast hits to 877 proteins in 267 species: Archae - 114; Bacteria - 0; Metazoa - 268; Fungi - 193; Plants - 105; Viruses - 0; Other Eukaryotes - 197 (source: NCBI BLink).  |
AT5G16750 | AT5G16750.1 | TTATGGGCCAAT | Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development.  |
AT5G16760 | AT5G16760.1 | ATTGGCCCATAA | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase.  |
AT5G17610 | AT5G17610.1 | TATAGGCCCATGTAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 44 Blast hits to 44 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G17790 | AT5G17790.1 | TTATGGGCCTAT | Encodes a 85.9 kDa protein containing novel repeats and zinc fingers described as protein interaction domains. VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development. Mutants display a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells.  |
AT5G17840 | AT5G17840.1 | TTATGGGCTCGGTTTAG | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G17840.1 | TTGGCCCATAA | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  | |
AT5G18140 | AT5G18140.1 | TAAAGGCCCATAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G22360.1); Has 15420 Blast hits to 15415 proteins in 1898 species: Archae - 116; Bacteria - 5110; Metazoa - 3216; Fungi - 1289; Plants - 1204; Viruses - 8; Other Eukaryotes - 4477 (source: NCBI BLink).  |
AT5G18810 | AT5G18810.1 | AAAGCCCATAA | encodes an SC35-like splicing factor of 28 kD localized to the nuclear specks.  |
AT5G19510 | AT5G19510.1 | AAGGCCCATAAATAAGCCCAAAT | elongation factor 1B alpha-subunit 2 (eEF1Balpha2); FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation, defense response to bacterium; LOCATED IN: apoplast, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1B alpha-subunit 1 (eEF1Balpha1) (TAIR:AT5G12110.1); Has 715 Blast hits to 715 proteins in 199 species: Archae - 0; Bacteria - 2; Metazoa - 371; Fungi - 103; Plants - 110; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).  |
AT5G19790 | AT5G19790.1 | AAAAGCCCATAA | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family (RAP2.11). The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.  |
AT5G21050 | AT5G21050.1 | ATTTGGGCTTCTAGCCCATAA | LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Hyccin (InterPro:IPR018619); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64090.1); Has 170 Blast hits to 170 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 133; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT5G21050.1 | CAAGCCCATAA | LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Hyccin (InterPro:IPR018619); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64090.1); Has 170 Blast hits to 170 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 133; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  | |
AT5G23740 | AT5G23740.1 | ACGGCCCATAA | Encodes a putative ribosomal protein S11 (RPS11-beta).  |
AT5G24650 | AT5G24650.1 | TTATGGGCCGAA | mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G24810 | AT5G24810.1 | TTGGGCTTATTGGGCCCATAA | ABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink).  |
AT5G25475 | AT5G25475.1 | TTATGGGCCA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G25475.2 | TTATGGGCCA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G25475.3 | TTATGGGCCA | DNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G26760 | AT5G26760.2 | ATTGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF408 (InterPro:IPR007308); Has 247 Blast hits to 205 proteins in 87 species: Archae - 0; Bacteria - 73; Metazoa - 105; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT5G27950 | AT5G27950.1 | TAAGCCCATAA | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT1G55550.1); Has 7669 Blast hits to 7281 proteins in 238 species: Archae - 0; Bacteria - 8; Metazoa - 3877; Fungi - 919; Plants - 883; Viruses - 0; Other Eukaryotes - 1982 (source: NCBI BLink).  |
AT5G35732 | AT5G35732.1 | CAAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G04795.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G37510 | AT5G37510.1 | TAAAAGCCCATAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte.  |
AT5G37510.2 | TAAAAGCCCATAAAGCCCAAAA | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte.  | |
AT5G38480 | AT5G38480.1 | TAAAGGCCCATAA | general regulatory factor, a 14-3-3 gene  |
AT5G38480.2 | TAAAGGCCCATAA | general regulatory factor, a 14-3-3 gene  | |
AT5G38650 | AT5G38650.1 | TTATGGGCTTA | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT1G67250.1); Has 161 Blast hits to 161 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT5G40930 | AT5G40930.1 | AAAAGCCCATAAGGCCTTTTAAGCCCACT | Form of TOM20, which is a component of the TOM complex involved in transport of nuclear-encoded mitochondrial proteins  |
AT5G41560 | AT5G41560.1 | GTAGGCCCAATGGGCCCATAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 59 Blast hits to 59 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 46; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G41760 | AT5G41760.1 | CAAGGCCCATAA | nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  |
AT5G41760.2 | CAAGGCCCATAA | nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  | |
AT5G41810 | AT5G41810.1 | GAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64340.1); Has 862 Blast hits to 673 proteins in 114 species: Archae - 0; Bacteria - 35; Metazoa - 196; Fungi - 97; Plants - 45; Viruses - 2; Other Eukaryotes - 487 (source: NCBI BLink).  |
AT5G41810.2 | GAAGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64340.1); Has 862 Blast hits to 673 proteins in 114 species: Archae - 0; Bacteria - 35; Metazoa - 196; Fungi - 97; Plants - 45; Viruses - 2; Other Eukaryotes - 487 (source: NCBI BLink).  | |
AT5G45040 | AT5G45040.1 | TTATGGGCTCA | cytochrome c6 (ATC6); FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c, class I (InterPro:IPR003088), Cytochrome c, monohaem (InterPro:IPR009056); Has 411 Blast hits to 411 proteins in 105 species: Archae - 0; Bacteria - 225; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).  |
AT5G45360 | AT5G45360.1 | TTATGGGCTTAT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 132 Blast hits to 132 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 76; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT5G45775 | AT5G45775.1 | TTATGGGCTTTAT | 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).  |
AT5G45775.2 | TTATGGGCTTTAT | 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).  | |
AT5G46630 | AT5G46630.1 | ACAGGCCCATAA | clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family; similar to micro-adaptins of clathrin coated vesicle adaptor complexes  |
AT5G46630.2 | ACAGGCCCATAA | clathrin adaptor complexes medium subunit family protein, contains Pfam profile: PF00928 adaptor complexes medium subunit family; similar to micro-adaptins of clathrin coated vesicle adaptor complexes  | |
AT5G47380 | AT5G47380.1 | TTATGGGCTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF547 (InterPro:IPR006869); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66600.3); Has 342 Blast hits to 332 proteins in 54 species: Archae - 0; Bacteria - 34; Metazoa - 39; Fungi - 0; Plants - 253; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT5G47430 | AT5G47430.1 | TGGGCCCATAA | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DWNN domain (InterPro:IPR014891), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G17410.1); Has 12501 Blast hits to 8536 proteins in 350 species: Archae - 0; Bacteria - 308; Metazoa - 7733; Fungi - 1802; Plants - 953; Viruses - 24; Other Eukaryotes - 1681 (source: NCBI BLink).  |
AT5G53420 | AT5G53420.1 | GGCTTTATGGGCTTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27900.2); Has 863 Blast hits to 863 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 840; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT5G53420.3 | GGCTTTATGGGCTTTTT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27900.2); Has 863 Blast hits to 863 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 840; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  | |
AT5G53450 | AT5G53450.1 | GAAGCCCATAA | OBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  |
AT5G53450.2 | GAAGCCCATAA | OBP3-responsive gene 1 (ORG1); FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); Has 437 Blast hits to 437 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 146; Fungi - 39; Plants - 194; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).  | |
AT5G54080 | AT5G54080.1 | TTATGGGCCTAAT | homogentisate 1,2-dioxygenase  |
AT5G54080.2 | TTATGGGCCTAAT | homogentisate 1,2-dioxygenase  | |
AT5G54640 | AT5G54640.1 | CAAGCCCATAA | Isolated from T-DNA insertion line, the rat5 mutant is deficient in T-DNA integration. Encodes histone2A protein.  |
AT5G55510 | AT5G55510.1 | TGAGGCCCATAA | P-P-bond-hydrolysis-driven protein transmembrane transporter/ protein transporter; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT4G26670.1); Has 385 Blast hits to 385 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 135; Plants - 78; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT5G55730 | AT5G55730.1 | AAAAGCCCATAA | fasciclin-like arabinogalactan-protein 1 (Fla1)  |
AT5G56670 | AT5G56670.1 | TATGGGCCCATAAAGCCCAATAT | 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT5G57160 | AT5G57160.1 | TAGCCCATAA | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4.  |
AT5G57860 | AT5G57860.1 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT5G57860.2 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G57860.3 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G57860.4 | TTCGGCCCATAAGCCCAATAT | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT5G58420 | AT5G58420.1 | ATAAGCCCATAATACCCT | 40S ribosomal protein S4 (RPS4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 941 Blast hits to 941 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).  |
AT5G59140 | AT5G59140.1 | TGAGCCCATAA | SKP1 family protein; FUNCTIONS IN: protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); Has 313 Blast hits to 313 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 77; Plants - 28; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT5G61150 | AT5G61150.1 | AAAAAGCCCATAA | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold.  |
AT5G61150.2 | AAAAAGCCCATAA | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold.  | |
AT5G61450 | AT5G61450.1 | TTATGGGCTGGCCCAAAT | 2-phosphoglycerate kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; Has 393 Blast hits to 372 proteins in 106 species: Archae - 58; Bacteria - 24; Metazoa - 63; Fungi - 40; Plants - 52; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).  |
AT5G63890 | AT5G63890.1 | ATTAGGCCCATAA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  |
AT5G63890.2 | ATTAGGCCCATAA | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.  | |
AT5G64270 | AT5G64270.1 | TAATTGGGCTTATGGGCTTTG | splicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink).  |
AT5G65400 | AT5G65400.1 | TTATGGGCCTATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24380.1); Has 479 Blast hits to 479 proteins in 121 species: Archae - 0; Bacteria - 2; Metazoa - 88; Fungi - 285; Plants - 66; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).  |
AT5G66030 | AT5G66030.1 | TTATGGGCTAA | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization.  |
AT5G66030.2 | TTATGGGCTAA | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization.  | |
AT5G66040 | AT5G66040.2 | TTAGCCCATAA | SULFURTRANSFERASE PROTEIN 16 (STR16); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: SEN1 (SENESCENCE 1) (TAIR:AT4G35770.1); Has 2229 Blast hits to 2226 proteins in 583 species: Archae - 32; Bacteria - 1489; Metazoa - 53; Fungi - 31; Plants - 139; Viruses - 0; Other Eukaryotes - 485 (source: NCBI BLink).  |
AT5G66450 | AT5G66450.1 | TTATGGGC | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
AT5G66450.2 | TTATGGGC | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  | |
AT5G66910 | AT5G66910.1 | TTATGGGCCCATATA | disease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae - 22; Bacteria - 1182; Metazoa - 2936; Fungi - 103; Plants - 14487; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink).  |
AT5G67060 | AT5G67060.1 | GCCCATAA | HECATE 1 (HEC1); FUNCTIONS IN: transcription factor activity; INVOLVED IN: transmitting tissue development, carpel formation, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: HEC2 (HECATE 2); DNA binding / transcription factor (TAIR:AT3G50330.1); Has 2134 Blast hits to 2010 proteins in 139 species: Archae - 2; Bacteria - 175; Metazoa - 184; Fungi - 22; Plants - 1708; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT5G67370 | AT5G67370.1 | TTATGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1230 (InterPro:IPR009631); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11840.1); Has 264 Blast hits to 264 proteins in 69 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  |
AT5G67400 | AT5G67400.1 | GGGCCTGAAAGCCCATAAAAGTCAA | peroxidase 73 (PER73) (P73) (PRXR11); FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G49960.1); Has 2886 Blast hits to 2873 proteins in 211 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 2764; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).  |
AT5G67560 | AT5G67560.1 | GAAGCCCATAA | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases.  |
ATCG00340 | ATCG00340.1 | TTATGGGC | Encodes the D1 subunit of photosystem I and II reaction centers.  |
ATMG01370 | ATMG01370.1 | GCCCTTATGGGCTGGGCCACACACGTG | hypothetical protein  |