Organism | Arabidopsis thaliana | |
ID | AtREG396 | |
Sequence | CCCATTAA | |
Annotation | ||
PPDB Motif | GCCCA | Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression |
PLACE Motif | TTAATGG | Target sequence of WUS in the intron of AGAMOUS gene in Arabidopsis; See Lohmann et al. Cell 105:793-803 (2003); |
Total Entry Count | 735 |
Locus | Gene model | Sequence | Description |
AT1G01320 | AT1G01320.1 | CTTAGGCCCATTAA | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G28080.1); Has 10077 Blast hits to 4062 proteins in 343 species: Archae - 100; Bacteria - 2124; Metazoa - 5307; Fungi - 1095; Plants - 343; Viruses - 76; Other Eukaryotes - 1032 (source: NCBI BLink).  |
AT1G01710 | AT1G01710.1 | TTAATGGGCCTTG | acyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).  |
AT1G01990 | AT1G01990.1 | TGAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03090 | AT1G03090.1 | ATAGGCCCATTAA | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  |
AT1G03090.2 | ATAGGCCCATTAA | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.  | |
AT1G03350 | AT1G03350.1 | TGGCCCATTAA | BSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT4G13110.1); Has 9675 Blast hits to 5119 proteins in 484 species: Archae - 40; Bacteria - 3294; Metazoa - 2852; Fungi - 1070; Plants - 279; Viruses - 71; Other Eukaryotes - 2069 (source: NCBI BLink).  |
AT1G03360 | AT1G03360.1 | TTAATGGGCCA | ARABIDOPSIS THALIANA RIBOSOMAL RNA PROCESSING 4 (ATRRP4); FUNCTIONS IN: RNA binding, exonuclease activity; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), S1, RNA binding (InterPro:IPR003029); Has 443 Blast hits to 443 proteins in 204 species: Archae - 97; Bacteria - 0; Metazoa - 111; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).  |
AT1G03680 | AT1G03680.1 | TTAATGGGCTTTAA | encodes a chloroplast thioredoxin similar to prokaryotic thioredoxins.  |
AT1G03687 | AT1G03687.1 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  |
AT1G03687.2 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).  | |
AT1G04070 | AT1G04070.1 | CTTAATGGGCCTAC | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.  |
AT1G04080 | AT1G04080.1 | GTAGGCCCATTAAG | PRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink).  |
AT1G04240 | AT1G04240.1 | TTAATGGG | SHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro.  |
AT1G04260 | AT1G04260.1 | TTAATGGGCCTTTAA | Encodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors.  |
AT1G04590 | AT1G04590.1 | CTTAATGGGCTA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT1G04590.1 | TTAATGGGCCAAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G04590.1 | TTAATGGGCCAAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G04590.1 | TTAATGGGCTAA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G04590.2 | CTTAATGGGCTA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G04590.2 | TTAATGGGCCAAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G04590.2 | TTAATGGGCCAAT | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G04590.2 | TTAATGGGCTAA | FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT1G04870 | AT1G04870.1 | TTAATGGG | Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.  |
AT1G04870.2 | TTAATGGG | Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.  | |
AT1G05840 | AT1G05840.1 | TTAATGGG | aspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT3G02740.1); Has 2039 Blast hits to 2022 proteins in 216 species: Archae - 0; Bacteria - 0; Metazoa - 414; Fungi - 414; Plants - 1048; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).  |
AT1G07070 | AT1G07070.1 | TATAGGCCCATTAA | 60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).  |
AT1G07420 | AT1G07420.1 | GGCTTTAATGGG | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA  |
AT1G07510 | AT1G07510.1 | GAAGCCCATTAAG | encodes an FtsH protease that is localized to the mitochondrion  |
AT1G08280 | AT1G08280.1 | TTAATGGGCTTA | glycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, integral to Golgi membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Sialyltransferase (InterPro:IPR012163), Glycosyl transferase, family 29 (InterPro:IPR001675); Has 1982 Blast hits to 1970 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 1819; Fungi - 0; Plants - 92; Viruses - 14; Other Eukaryotes - 57 (source: NCBI BLink).  |
AT1G09140 | AT1G09140.1 | ACAGGCCCATTAA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.  |
AT1G09140.2 | ACAGGCCCATTAA | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.  | |
AT1G09150 | AT1G09150.1 | TTAATGGGCCTGT | pseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).  |
AT1G09500 | AT1G09500.1 | TTAATGGG | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase  |
AT1G09500.2 | TTAATGGG | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase  | |
AT1G09500.3 | TTAATGGG | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase  | |
AT1G09660 | AT1G09660.1 | TAAGCCCATTAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT1G09660.2 | TAAGCCCATTAA | KH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  | |
AT1G10220 | AT1G10220.2 | TTAATGGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: ZCF37 (TAIR:AT1G59590.1); Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G13060 | AT1G13060.1 | ATCGGCCCATTAA | Encodes 20S proteasome beta subunit PBE1 (PBE1).  |
AT1G14010 | AT1G14010.1 | TTAATGGGCCTTAA | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
AT1G14270 | AT1G14270.1 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  |
AT1G14270.2 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14270.3 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14270.4 | TTAATGGGCTTTGGGCCTATA | CAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).  | |
AT1G14650 | AT1G14650.1 | GCCCGTTAAAGGCCCATTAA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).  |
AT1G14650.2 | GCCCGTTAAAGGCCCATTAA | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).  | |
AT1G14820 | AT1G14820.1 | GCCCATTAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  |
AT1G14820.2 | GCCCATTAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  | |
AT1G14820.3 | GCCCATTAA | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).  | |
AT1G14980 | AT1G14980.1 | TGAGGCCCATTAA | Encodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs.  |
AT1G15010 | AT1G15010.1 | TTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01300.1); Has 43 Blast hits to 42 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G15120 | AT1G15120.1 | TTAATGGGCTTTTA | ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT2G01090.1).  |
AT1G15215 | AT1G15215.1 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G15215.2 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G15215.3 | TTTAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G15250 | AT1G15250.1 | CCAGGCCCATGAAGCCCATTAAGAAGCCCATAT | 60S ribosomal protein L37 (RPL37A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).  |
AT1G15270 | AT1G15270.1 | GGCCTTTTAATGGGCCATA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  |
AT1G15280 | AT1G15280.1 | TATGGCCCATTAAAAGGCC | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).  |
AT1G15280.2 | TATGGCCCATTAAAAGGCC | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).  | |
AT1G15380 | AT1G15380.1 | CCCATTAA | lactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  |
AT1G15380.2 | CCCATTAA | lactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  | |
AT1G16390 | AT1G16390.1 | CCCATTAA | ARABIDOPSIS THALIANA ORGANIC CATION/CARNITINE TRANSPORTER 3 (ATOCT3); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ATOCT2 (ARABIDOPSIS THALIANA ORGANIC CATION/CARNITINE TRANSPORTER 2); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G79360.1); Has 14668 Blast hits to 14637 proteins in 1162 species: Archae - 220; Bacteria - 6088; Metazoa - 3985; Fungi - 2765; Plants - 929; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).  |
AT1G16870 | AT1G16870.1 | TTAATGGGCCTAAC | mitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT1G17620 | AT1G17620.1 | CCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11890.1); Has 539 Blast hits to 538 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 539; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G17760 | AT1G17760.1 | TTAATGGGCCAA | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit.  |
AT1G17820 | AT1G17820.1 | CCCATTAA | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G73200.1); Has 444 Blast hits to 309 proteins in 108 species: Archae - 0; Bacteria - 7; Metazoa - 132; Fungi - 162; Plants - 27; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).  |
AT1G18080 | AT1G18080.1 | ATAAGCCCATTAA | Encodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene.  |
AT1G18480 | AT1G18480.1 | TTAATGGGCCTAC | calcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G07010.1); Has 433 Blast hits to 431 proteins in 108 species: Archae - 12; Bacteria - 139; Metazoa - 0; Fungi - 17; Plants - 53; Viruses - 3; Other Eukaryotes - 209 (source: NCBI BLink).  |
AT1G20110 | AT1G20110.1 | TTAATGGG | zinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT3G14270.1); Has 25361 Blast hits to 16508 proteins in 676 species: Archae - 11; Bacteria - 1450; Metazoa - 10130; Fungi - 5149; Plants - 3412; Viruses - 575; Other Eukaryotes - 4634 (source: NCBI BLink).  |
AT1G20340 | AT1G20340.1 | CAAAGCCCATTAAGGCCCATTT | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis.  |
AT1G20350 | AT1G20350.1 | AAATGGGCCTTAATGGGCTTTG | mitochondrial inner membrane translocase  |
AT1G20540 | AT1G20540.1 | GTTAGGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G76260.1); Has 6759 Blast hits to 5575 proteins in 300 species: Archae - 0; Bacteria - 624; Metazoa - 3227; Fungi - 1427; Plants - 781; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink).  |
AT1G20770 | AT1G20770.1 | TTAATGGGCCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G20780 | AT1G20780.1 | TAAAGGCCCATTAA | Encodes a protein containing a U-box and an ARM domain.  |
AT1G21280 | AT1G21280.1 | CAAGGCCCATTAAGCCCAACT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G21280.1 | TTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G22520 | AT1G22520.1 | ATAAGGCCCATTAATCGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1).  |
AT1G22520.2 | ATAAGGCCCATTAATCGGCCCAATAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1).  | |
AT1G22840 | AT1G22840.1 | CCCATTAAGGGCCCATTAAG | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers.  |
AT1G22840.2 | CCCATTAAGGGCCCATTAAG | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers.  | |
AT1G23205 | AT1G23205.1 | TCAGGCCCAGATCGGCCCATTAA | invertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G70720.1); Has 417 Blast hits to 412 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 417; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G23460 | AT1G23460.1 | CCCATTAA | polygalacturonase; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Parallel beta-helix repeat (InterPro:IPR006626), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: polygalacturonase, putative / pectinase, putative (TAIR:AT1G70500.1); Has 2595 Blast hits to 2585 proteins in 348 species: Archae - 2; Bacteria - 471; Metazoa - 8; Fungi - 1135; Plants - 896; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).  |
AT1G23740 | AT1G23740.1 | TTTAGGCCCATTAA | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae - 321; Bacteria - 14032; Metazoa - 1331; Fungi - 2499; Plants - 781; Viruses - 3; Other Eukaryotes - 6768 (source: NCBI BLink).  |
AT1G23750 | AT1G23750.1 | TTAATGGGCCTAAA | DNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT1G24170 | AT1G24170.1 | CTTAATGGGCCAA | Encodes a protein with putative galacturonosyltransferase activity.  |
AT1G25420 | AT1G25420.1 | CCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 391 Blast hits to 384 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 89; Plants - 145; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT1G25420.2 | CCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 391 Blast hits to 384 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 89; Plants - 145; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  | |
AT1G25420.3 | CCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 391 Blast hits to 384 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 89; Plants - 145; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  | |
AT1G26460 | AT1G26460.1 | TTAATGGGCTGGGCTTTAT | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 4278 Blast hits to 2050 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 59; Plants - 4056; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).  |
AT1G26640 | AT1G26640.1 | CTTAATGGGCTTC | aspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).  |
AT1G26650 | AT1G26650.1 | GAAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G27990 | AT1G27990.1 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52420.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G29400 | AT1G29400.1 | TTAATGGG | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices.  |
AT1G29400.2 | TTAATGGG | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices.  | |
AT1G29850 | AT1G29850.1 | CTTAATGGG | double-stranded DNA-binding family protein; FUNCTIONS IN: double-stranded DNA binding, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding TFAR19-related protein (InterPro:IPR002836).  |
AT1G29850.2 | CTTAATGGG | double-stranded DNA-binding family protein; FUNCTIONS IN: double-stranded DNA binding, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding TFAR19-related protein (InterPro:IPR002836).  | |
AT1G29850.3 | CTTAATGGG | double-stranded DNA-binding family protein; FUNCTIONS IN: double-stranded DNA binding, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding TFAR19-related protein (InterPro:IPR002836).  | |
AT1G30680 | AT1G30680.1 | TTAATGGGCCTTTT | toprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink).  |
AT1G30845 | AT1G30845.1 | TTAATGGGCCATAAGCCCATA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 71 Blast hits to 71 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 19; Plants - 11; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).  |
AT1G31160 | AT1G31160.1 | CCCATTAA | zinc-binding protein, putative / protein kinase C inhibitor, putative; FUNCTIONS IN: protein kinase C binding, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine triad-like motif (InterPro:IPR011146), Histidine triad (HIT) protein (InterPro:IPR001310), Histidine triad motif (InterPro:IPR011151); BEST Arabidopsis thaliana protein match is: zinc-binding protein, putative / protein kinase C inhibitor, putative (TAIR:AT3G56490.1); Has 5594 Blast hits to 5592 proteins in 1456 species: Archae - 103; Bacteria - 2673; Metazoa - 341; Fungi - 103; Plants - 63; Viruses - 0; Other Eukaryotes - 2311 (source: NCBI BLink).  |
AT1G31220 | AT1G31220.1 | TCAGCCCATTAAG | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide  |
AT1G32580 | AT1G32580.1 | TTCGGCCCATTAA | plastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G32990 | AT1G32990.1 | TTTAGGCCCATTAAGCCCATAA | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11  |
AT1G34130 | AT1G34130.1 | TTAATGGGCTTTG | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase.  |
AT1G34190 | AT1G34190.1 | TTAATGGGCCTGA | Arabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 1564; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G34370 | AT1G34370.1 | TTAATGGGTTGACTTT | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity.  |
AT1G34370.2 | TTAATGGGTTGACTTT | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity.  | |
AT1G34370.3 | TTAATGGGTTGACTTT | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity.  | |
AT1G44750 | AT1G44750.1 | ATTGGCCCATTAA | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.  |
AT1G47250 | AT1G47250.1 | AGCCCATTAAG | Encodes 20S proteasome subunit PAF2 (PAF2).  |
AT1G47530 | AT1G47530.1 | CCCATTAA | ripening-responsive protein, putative; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport, ripening; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G12950.1); Has 5502 Blast hits to 5451 proteins in 1087 species: Archae - 111; Bacteria - 3572; Metazoa - 119; Fungi - 206; Plants - 709; Viruses - 0; Other Eukaryotes - 785 (source: NCBI BLink).  |
AT1G48430 | AT1G48430.1 | CTTAATGGGCT | dihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink).  |
AT1G48440 | AT1G48440.1 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G48450 | AT1G48450.1 | CTTAATGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT1G48450.2 | CTTAATGGGCTTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  | |
AT1G48460 | AT1G48460.1 | CAAAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G48900 | AT1G48900.1 | GTAAGGCCCATTAA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink).  |
AT1G48900.2 | GTAAGGCCCATTAA | signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink).  | |
AT1G49140 | AT1G49140.1 | TGAGGCCCATTAA | NADH-ubiquinone oxidoreductase-related; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT3G18410.2); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G50170 | AT1G50170.1 | ATGGCCCATTAA | encodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis  |
AT1G51360 | AT1G51360.1 | CCCATTAAGGCCCAATTA | Involved in defense against fungal pathogens and located in cytosol.  |
AT1G51650 | AT1G51650.1 | CTTAATGGGCCGTTAAA | ATP synthase epsilon chain, mitochondrial; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP biosynthetic process, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, epsilon subunit, mitochondrial (InterPro:IPR006721); Has 170 Blast hits to 170 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 3; Plants - 40; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT1G51770 | AT1G51770.1 | TTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21310.1); Has 336 Blast hits to 336 proteins in 13 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT1G51770.2 | TTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21310.1); Has 336 Blast hits to 336 proteins in 13 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  | |
AT1G51965 | AT1G51965.1 | GTAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 21191 Blast hits to 6126 proteins in 185 species: Archae - 5; Bacteria - 14; Metazoa - 565; Fungi - 542; Plants - 18830; Viruses - 0; Other Eukaryotes - 1235 (source: NCBI BLink).  |
AT1G52240 | AT1G52240.1 | CTTAATGGGCTTAT | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily .  |
AT1G52240.2 | CTTAATGGGCTTAT | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily .  | |
AT1G53140 | AT1G53140.1 | TGAGGCCCAATACGGCCCATTAA | Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis.  |
AT1G53670 | AT1G53670.1 | TTAATGGGCTTG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink).  |
AT1G53670.2 | TTAATGGGCTTG | methionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink).  | |
AT1G54100 | AT1G54100.1 | TTAATGGGCCTGGCCCATA | Aldehyde dehydrogenase  |
AT1G54100.2 | TTAATGGGCCTGGCCCATA | Aldehyde dehydrogenase  | |
AT1G54140 | AT1G54140.1 | TTAATGGGCCTAT | putative TATA binding protein associated factor 21kDa  |
AT1G54150 | AT1G54150.1 | ATAGGCCCATTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 1572 Blast hits to 1571 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1041; Fungi - 23; Plants - 178; Viruses - 133; Other Eukaryotes - 197 (source: NCBI BLink).  |
AT1G54970 | AT1G54970.1 | TTAATGGG | encodes a proline-rich protein that is specifically expressed in the root.  |
AT1G56070 | AT1G56070.1 | ATTGGCCCATTAAGGCCCATTAAG | encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive.  |
AT1G57540 | AT1G57540.1 | CCGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G57540.2 | CCGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G57540.3 | CCGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G57770 | AT1G57770.1 | TTAATGGGCTTG | amine oxidase family; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD dependent oxidoreductase (InterPro:IPR006076); BEST Arabidopsis thaliana protein match is: CRTISO (CAROTENOID ISOMERASE); carotenoid isomerase (TAIR:AT1G06820.1); Has 4784 Blast hits to 4705 proteins in 573 species: Archae - 90; Bacteria - 1781; Metazoa - 346; Fungi - 53; Plants - 173; Viruses - 0; Other Eukaryotes - 2341 (source: NCBI BLink).  |
AT1G60900 | AT1G60900.1 | ATAAGCCCATTAAG | U2 snRNP auxiliary factor large subunit, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: ATU2AF65A; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G36690.1); Has 85440 Blast hits to 35122 proteins in 1401 species: Archae - 56; Bacteria - 10121; Metazoa - 44645; Fungi - 7960; Plants - 5595; Viruses - 646; Other Eukaryotes - 16417 (source: NCBI BLink).  |
AT1G61570 | AT1G61570.1 | ACAGGCCCATTAA | Encodes a putative small zinc finger-like protein (TIM13); nucleus-encoded gene whose product is found in the mitochondrial inner membrane space.  |
AT1G63460 | AT1G63460.1 | GTGGCCCAATAGAAGCCCATTAAG | glutathione peroxidase, putative; FUNCTIONS IN: glutathione peroxidase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336), Glutathione peroxidase (InterPro:IPR000889); BEST Arabidopsis thaliana protein match is: ATGPX6 (GLUTATHIONE PEROXIDASE 6); glutathione peroxidase (TAIR:AT4G11600.1); Has 5286 Blast hits to 5285 proteins in 1007 species: Archae - 0; Bacteria - 1863; Metazoa - 687; Fungi - 136; Plants - 239; Viruses - 8; Other Eukaryotes - 2353 (source: NCBI BLink).  |
AT1G63600 | AT1G63600.1 | CCCATTAA | protein kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF26 (InterPro:IPR002902); BEST Arabidopsis thaliana protein match is: receptor-like protein kinase-related (TAIR:AT1G63570.1); Has 952 Blast hits to 922 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 2; Plants - 933; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT1G65000 | AT1G65000.1 | CCCAATAAGCCCATTAAGGCCCATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, pollen tube, stamen; EXPRESSED DURING: 4 anthesis; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G38060.1); Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G66500 | AT1G66500.1 | ACAGGCCCATTAA | zinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 85; Plants - 35; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).  |
AT1G67250 | AT1G67250.1 | TTAATGGGCCTTAG | proteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT5G38650.1); Has 170 Blast hits to 170 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 2; Plants - 63; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT1G67320 | AT1G67320.1 | ATATGGGCCCATTAATAGGCCCAACA | DNA primase, large subunit family; FUNCTIONS IN: DNA primase activity; INVOLVED IN: DNA replication, synthesis of RNA primer; LOCATED IN: alpha DNA polymerase:primase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA primase, large subunit, eukaryotic (InterPro:IPR016558), DNA primase, large subunit, eukaryotic/archaeal (InterPro:IPR007238); Has 329 Blast hits to 325 proteins in 153 species: Archae - 6; Bacteria - 0; Metazoa - 133; Fungi - 93; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  |
AT1G67430 | AT1G67430.1 | AAAGCCCATTAA | 60S ribosomal protein L17 (RPL17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17A) (TAIR:AT1G27400.1); Has 1644 Blast hits to 1644 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).  |
AT1G67680 | AT1G67680.1 | AAAGGCCCATATAAAAAGCCCATTAA | 7S RNA binding; FUNCTIONS IN: 7S RNA binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP72 subunit, RNA-binding (InterPro:IPR013699); BEST Arabidopsis thaliana protein match is: 7S RNA binding (TAIR:AT1G67650.1); Has 525 Blast hits to 512 proteins in 165 species: Archae - 12; Bacteria - 42; Metazoa - 217; Fungi - 108; Plants - 25; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT1G68830 | AT1G68830.1 | TTAATGGGCCTAAA | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation  |
AT1G69740 | AT1G69740.1 | ACAGGCCCATTAA | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.  |
AT1G69740.2 | ACAGGCCCATTAA | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.  | |
AT1G71090 | AT1G71090.1 | TTAATGGGCTTATAATTGGGCTTC | auxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G01990.1); Has 433 Blast hits to 370 proteins in 101 species: Archae - 9; Bacteria - 33; Metazoa - 0; Fungi - 220; Plants - 97; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).  |
AT1G72250 | AT1G72250.1 | CCCATTAA | kinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT2G22610.1); Has 9902 Blast hits to 9165 proteins in 333 species: Archae - 26; Bacteria - 186; Metazoa - 4851; Fungi - 1029; Plants - 929; Viruses - 28; Other Eukaryotes - 2853 (source: NCBI BLink).  |
AT1G74520 | AT1G74520.1 | TTAATGGG | Part of the AtHVA22a family. Protein expression is ABA- and stress-inducible.  |
AT1G74780 | AT1G74780.1 | AGCCCATTAAG | nodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink).  |
AT1G74970 | AT1G74970.1 | TTAATGGGCTCTAATGGGCCGAT | ribosomal protein S9, nuclear encoded component of the chloroplast ribosome  |
AT1G75510 | AT1G75510.1 | AACGGCCCATTAA | transcription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT1G77030 | AT1G77030.1 | TTAATGGGCCTTAATGG | ATP binding / ATP-dependent helicase/ RNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DBP10CT (InterPro:IPR012541), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 46457 Blast hits to 14119 proteins in 1029 species: Archae - 31; Bacteria - 19714; Metazoa - 12532; Fungi - 2798; Plants - 5760; Viruses - 615; Other Eukaryotes - 5007 (source: NCBI BLink).  |
AT1G77540 | AT1G77540.1 | AATAGGCCCATTAATAGGCCC | Encodes a H3/H4 histone acetyltransferase. Belongs to the GNAT family, whose many members are involved in histone acetylation and chromatin remodeling, and are important for the regulation of cell growth and development.  |
AT1G77690 | AT1G77690.1 | CAAGCCCATTAA | Encodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia.  |
AT1G77810 | AT1G77810.1 | CCCATTAA | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT1G77810.2 | CCCATTAA | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT1G78910 | AT1G78910.1 | CCCATTAA | pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G19440.1); Has 10350 Blast hits to 10341 proteins in 1426 species: Archae - 10; Bacteria - 6764; Metazoa - 215; Fungi - 81; Plants - 105; Viruses - 0; Other Eukaryotes - 3175 (source: NCBI BLink).  |
AT1G79550 | AT1G79550.1 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK).  |
AT1G79550.2 | TAATTGGGCTAGCCCATTAAG | Encodes cytosolic phosphoglycerate kinase (PGK).  | |
AT1G79560 | AT1G79560.1 | CTTAATGGGCTA | encodes an FtsH protease that is localized to the chloroplast  |
AT1G80770 | AT1G80770.1 | AAAAAGCCCATTAA | pigment defective 318 (PDE318); FUNCTIONS IN: GTP binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP1/OBG (InterPro:IPR006073), Nucleolar GTP-binding 1 (InterPro:IPR010674); BEST Arabidopsis thaliana protein match is: GTP-binding protein-related (TAIR:AT1G50920.1); Has 6754 Blast hits to 6749 proteins in 1535 species: Archae - 192; Bacteria - 3675; Metazoa - 331; Fungi - 218; Plants - 119; Viruses - 0; Other Eukaryotes - 2219 (source: NCBI BLink).  |
AT2G01400 | AT2G01400.1 | CTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 6 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G01470 | AT2G01470.1 | TTAGCCCATTAA | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER.  |
AT2G01650 | AT2G01650.1 | TTGGCCCAAAAGGCCCATTAA | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo.  |
AT2G01720 | AT2G01720.1 | ACGGCCCATTAA | ribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 87; Plants - 31; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
AT2G02480 | AT2G02480.1 | CCCATTAA | STICHEL mutant shows trichomes with fewer than normal branches.  |
AT2G02500 | AT2G02500.1 | TTAATGGGCCTGATGGGCTTAT | Encodes a protein with 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase activity. The enzyme has an absolute requirement for divalent cations (Mg2+ reaches the highest catalytic activity).  |
AT2G02510 | AT2G02510.1 | ATAAGCCCATCAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14450.1); Has 38 Blast hits to 38 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G03150 | AT2G03150.1 | ATAAGCCCATTAA | embryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink).  |
AT2G03340 | AT2G03340.1 | CCCATTAA | Encodes WRKY DNA-binding protein 3 (WRKY3).  |
AT2G03440 | AT2G03440.1 | CCCATTAA | Induced at the transcriptional level by Pseudomonas syringae pv. tomato infection.  |
AT2G04410 | AT2G04410.1 | TAACGGGCCCATTAAGGCCCAAAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G17190 | AT2G17190.1 | CCCATTAA | ubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17200.1); Has 8273 Blast hits to 4684 proteins in 635 species: Archae - 6; Bacteria - 189; Metazoa - 3590; Fungi - 1163; Plants - 1579; Viruses - 154; Other Eukaryotes - 1592 (source: NCBI BLink).  |
AT2G17972 | AT2G17972.1 | TAAAAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 19 Blast hits to 19 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G17975 | AT2G17975.1 | TTAATGGGCCTAATGGGCCTAG | zinc finger (Ran-binding) family protein; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: zinc finger (Ran-binding) family protein (TAIR:AT5G25490.1); Has 893 Blast hits to 535 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 304; Fungi - 62; Plants - 313; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink).  |
AT2G17980 | AT2G17980.1 | CTAGGCCCATTAGGCCCATTAA | member of SLY1 Gene Family  |
AT2G18510 | AT2G18510.1 | CTTAATGGGCTTATAGGCCCATTAG | embryo defective 2444 (emb2444); FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: PAB8 (POLY(A) BINDING PROTEIN 8); RNA binding / translation initiation factor (TAIR:AT1G49760.1); Has 56184 Blast hits to 33244 proteins in 1255 species: Archae - 48; Bacteria - 4095; Metazoa - 27429; Fungi - 7959; Plants - 8932; Viruses - 890; Other Eukaryotes - 6831 (source: NCBI BLink).  |
AT2G19080 | AT2G19080.1 | CTTAATGGG | metaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT2G19750 | AT2G19750.1 | TACGGCCCATTAA | 40S ribosomal protein S30 (RPS30A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT2G20410 | AT2G20410.1 | GAAGCCCATTAAG | activating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).  |
AT2G20450 | AT2G20450.1 | TTAATGGGCCTTTAA | 60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).  |
AT2G20580 | AT2G20580.1 | TTAATGGGCT | encoding the RPN subunits of the 26S proteasome  |
AT2G20860 | AT2G20860.1 | TTAATGGGCCTAC | LIP1,Lipoic acid synthase,  |
AT2G21580 | AT2G21580.1 | TTAATGGGCTTG | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT2G21580.1 | TTAATGGGCTTT | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT2G21580.2 | TTAATGGGCTTG | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT2G21580.2 | TTAATGGGCTTT | 40S ribosomal protein S25 (RPS25B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25E) (TAIR:AT4G39200.2); Has 502 Blast hits to 502 proteins in 179 species: Archae - 5; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  | |
AT2G22900 | AT2G22900.1 | TTAATGGG | galactosyl transferase GMA12/MNN10 family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Galactosyl transferase (InterPro:IPR008630); BEST Arabidopsis thaliana protein match is: galactosyl transferase GMA12/MNN10 family protein (TAIR:AT4G37690.1); Has 296 Blast hits to 296 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 102; Plants - 174; Viruses - 2; Other Eukaryotes - 18 (source: NCBI BLink).  |
AT2G23390 | AT2G23390.1 | TTAATGGGCCTAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF482 (InterPro:IPR007434), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 1806 Blast hits to 1806 proteins in 374 species: Archae - 0; Bacteria - 707; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 1084 (source: NCBI BLink).  |
AT2G24060 | AT2G24060.1 | TTAAAGCCCATAAGCCCATTAA | translation initiation factor 3 (IF-3) family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 3 (InterPro:IPR001288); BEST Arabidopsis thaliana protein match is: translation initiation factor 3 (IF-3) family protein (TAIR:AT4G30690.1); Has 17514 Blast hits to 8661 proteins in 1545 species: Archae - 56; Bacteria - 6187; Metazoa - 2053; Fungi - 689; Plants - 758; Viruses - 336; Other Eukaryotes - 7435 (source: NCBI BLink).  |
AT2G24090 | AT2G24090.1 | CCCATTAA | ribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink).  |
AT2G24395 | AT2G24395.1 | TTAATGGGCCTT | chaperone protein dnaJ-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT2G24860 | AT2G24860.1 | TTAATGGGCCCAG | chaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 65 Blast hits to 65 proteins in 20 species: Archae - 0; Bacteria - 8; Metazoa - 8; Fungi - 2; Plants - 40; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT2G28290 | AT2G28290.1 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  |
AT2G28290.2 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  | |
AT2G28290.3 | CAAGGCCCATTAAGGGGT | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.  | |
AT2G31370 | AT2G31370.1 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  |
AT2G31370.2 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.3 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.4 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G31370.5 | TTAATGGGCTTTAGGCCCATAA | bZIP transcription factor (POSF21); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), Basic leucine zipper (InterPro:IPR011700); BEST Arabidopsis thaliana protein match is: bZIP transcription factor, putative (bZIP69) (TAIR:AT1G06070.1); Has 54269 Blast hits to 19856 proteins in 831 species: Archae - 14; Bacteria - 2070; Metazoa - 21047; Fungi - 5854; Plants - 2899; Viruses - 481; Other Eukaryotes - 21904 (source: NCBI BLink).  | |
AT2G32060 | AT2G32060.1 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  |
AT2G32060.2 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  | |
AT2G32060.3 | ATGGCCCAGTAAAGCCCATTAA | 40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).  | |
AT2G32580 | AT2G32580.1 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05070.1); Has 54 Blast hits to 54 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT2G33430 | AT2G33430.1 | TTAATGGGCTTTGAGCCCAACT | DIFFERENTIATION AND GREENING-LIKE 1 (DAL1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: plastid organization, endonucleolytic cleavage of tetracistronic rRNA transcript (SSU-rRNA, LSU-rRNA, 4.5S-rRNA, 5S-rRNA); LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 147 Blast hits to 134 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G34940 | AT2G34940.1 | TTAATGGGCTAATGAGGCCCATTAAG | vacuolar sorting receptor, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: protein targeting to vacuole; LOCATED IN: integral to plasma membrane, Golgi transport complex; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), EGF-like calcium-binding, conserved site (InterPro:IPR018097), EGF-like calcium-binding (InterPro:IPR001881), Growth factor, receptor (InterPro:IPR009030); BEST Arabidopsis thaliana protein match is: vacuolar sorting receptor, putative (TAIR:AT1G30900.1); Has 9390 Blast hits to 4743 proteins in 196 species: Archae - 0; Bacteria - 100; Metazoa - 8560; Fungi - 5; Plants - 215; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink).  |
AT2G35480 | AT2G35480.1 | AAAAGCCCAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32260.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G35720 | AT2G35720.1 | TTAAGGCCCATTAA | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT3G47940.1); Has 15787 Blast hits to 15749 proteins in 1885 species: Archae - 105; Bacteria - 5397; Metazoa - 3297; Fungi - 1386; Plants - 1147; Viruses - 13; Other Eukaryotes - 4442 (source: NCBI BLink).  |
AT2G36070 | AT2G36070.1 | AAACCGAACCTTAATGGGC | One of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP.  |
AT2G36170 | AT2G36170.1 | TTAATGGGCTTTG | ubiquitin extension protein 2 (UBQ2) / 60S ribosomal protein L40 (RPL40A); FUNCTIONS IN: protein binding, structural constituent of ribosome; INVOLVED IN: protein modification process, translation; LOCATED IN: cytosolic large ribosomal subunit, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L40e (InterPro:IPR001975), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: UBQ1 (UBIQUITIN EXTENSION PROTEIN 1); protein binding / structural constituent of ribosome (TAIR:AT3G52590.1); Has 9155 Blast hits to 5428 proteins in 614 species: Archae - 0; Bacteria - 7; Metazoa - 4223; Fungi - 953; Plants - 1966; Viruses - 162; Other Eukaryotes - 1844 (source: NCBI BLink).  |
AT2G36620 | AT2G36620.1 | AAAAGGCCCATTAA | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020).  |
AT2G36680 | AT2G36680.1 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  |
AT2G36680.2 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  | |
AT2G36680.3 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  | |
AT2G36680.4 | TAAAGGCCCATTAA | LOCATED IN: ESCRT I complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Modifier of rudimentary, Modr (InterPro:IPR009851); BEST Arabidopsis thaliana protein match is: VPS37-1 (TAIR:AT3G53120.1); Has 348 Blast hits to 348 proteins in 85 species: Archae - 1; Bacteria - 4; Metazoa - 236; Fungi - 19; Plants - 37; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).  | |
AT2G36720 | AT2G36720.1 | AAATACCCATTAA | PHD finger transcription factor, putative; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G27980.1); Has 3291 Blast hits to 2704 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 2475; Fungi - 268; Plants - 355; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).  |
AT2G36930 | AT2G36930.1 | TTAATGGGCCTAT | zinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type (InterPro:IPR007087); Has 506 Blast hits to 289 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 257; Fungi - 153; Plants - 39; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).  |
AT2G40060 | AT2G40060.1 | AAAAAGCCCATTAAG | protein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 403 Blast hits to 391 proteins in 99 species: Archae - 2; Bacteria - 32; Metazoa - 184; Fungi - 36; Plants - 54; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink).  |
AT2G40113 | AT2G40113.1 | GAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47635.1); Has 27 Blast hits to 27 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G40650 | AT2G40650.1 | AGCCCATTAA | pre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae - 56; Bacteria - 20349; Metazoa - 26407; Fungi - 5687; Plants - 2913; Viruses - 323; Other Eukaryotes - 11922 (source: NCBI BLink).  |
AT2G40660 | AT2G40660.1 | TTAATGGGCT | tRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae - 158; Bacteria - 2173; Metazoa - 404; Fungi - 148; Plants - 87; Viruses - 1; Other Eukaryotes - 649 (source: NCBI BLink).  |
AT2G41480 | AT2G41480.1 | CCCATTAA | electron carrier/ heme binding / peroxidase; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G64120.1); Has 2602 Blast hits to 2587 proteins in 148 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 18; Plants - 2558; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT2G42160 | AT2G42160.1 | CTAAGGCCCATTAA | zinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae - 0; Bacteria - 7; Metazoa - 531; Fungi - 172; Plants - 57; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink).  |
AT2G42230 | AT2G42230.1 | CTTAATGGGCCGTTTAAAGCCCATTTA | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  |
AT2G42230.2 | CTTAATGGGCCGTTTAAAGCCCATTTA | tubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  | |
AT2G43350 | AT2G43350.1 | TAAGCCCATTAA | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1.  |
AT2G43940 | AT2G43940.1 | CCCATTAA | thiol methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, thiopurine S-methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Thiopurine S-methyltransferase (InterPro:IPR008854); BEST Arabidopsis thaliana protein match is: thiol methyltransferase, putative (TAIR:AT2G43910.1); Has 1178 Blast hits to 1174 proteins in 393 species: Archae - 23; Bacteria - 836; Metazoa - 23; Fungi - 64; Plants - 50; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink).  |
AT2G44640 | AT2G44640.1 | CAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT2G45040 | AT2G45040.1 | CCCATTAA | matrix metalloproteinase; FUNCTIONS IN: metallopeptidase activity, metalloendopeptidase activity; INVOLVED IN: proteolysis, metabolic process; LOCATED IN: anchored to membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Peptidase M10A and M12B, matrixin and adamalysin (InterPro:IPR001818), Peptidoglycan binding-like (InterPro:IPR002477), Peptidase, metallopeptidases (InterPro:IPR006026); BEST Arabidopsis thaliana protein match is: matrix metalloproteinase, putative (TAIR:AT4G16640.1); Has 2158 Blast hits to 1979 proteins in 152 species: Archae - 2; Bacteria - 47; Metazoa - 1902; Fungi - 3; Plants - 81; Viruses - 39; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT2G46060 | AT2G46060.1 | TAAAAGCCCATTAA | transmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT2G46060.2 | TAAAAGCCCATTAA | transmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  | |
AT2G46470 | AT2G46470.1 | TTAAGGCCCATTAAG | INNER MEMBRANE PROTEIN OXA1-LIKE (OXA1L); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein import into mitochondrial inner membrane; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 60 kDa inner membrane insertion protein (InterPro:IPR001708); BEST Arabidopsis thaliana protein match is: OXA1; P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT5G62050.1); Has 4383 Blast hits to 4383 proteins in 1328 species: Archae - 0; Bacteria - 2560; Metazoa - 212; Fungi - 138; Plants - 111; Viruses - 0; Other Eukaryotes - 1362 (source: NCBI BLink).  |
AT2G47120 | AT2G47120.1 | AGAGGCCCATTAA | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, flower; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G47130.1); Has 80311 Blast hits to 80158 proteins in 2201 species: Archae - 468; Bacteria - 43770; Metazoa - 4463; Fungi - 4181; Plants - 1494; Viruses - 4; Other Eukaryotes - 25931 (source: NCBI BLink).  |
AT2G47940 | AT2G47940.1 | AATAGGCCCATTAA | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.  |
AT2G47940.2 | AATAGGCCCATTAA | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product.  | |
AT3G01100 | AT3G01100.1 | TTAATGGGCCTTTT | unknown protein, has cDNAs and ESTs associated to it  |
AT3G01100.2 | TTAATGGGCCTTTT | unknown protein, has cDNAs and ESTs associated to it  | |
AT3G02555 | AT3G02555.1 | TAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G02560 | AT3G02560.1 | TTAATGGGCTA | 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  |
AT3G02560.2 | TTAATGGGCTA | 40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  | |
AT3G02820 | AT3G02820.1 | TTAATGGGCTTC | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink).  |
AT3G03130 | AT3G03130.1 | TTTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17160.1); Has 6511 Blast hits to 3260 proteins in 393 species: Archae - 10; Bacteria - 2333; Metazoa - 1613; Fungi - 601; Plants - 171; Viruses - 56; Other Eukaryotes - 1727 (source: NCBI BLink).  |
AT3G03450 | AT3G03450.1 | CCCATTAA | Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development.  |
AT3G05060 | AT3G05060.1 | TCAGGCCCATTAA | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein  |
AT3G05070 | AT3G05070.1 | TTAATGGGCCTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink).  |
AT3G05210 | AT3G05210.1 | TTAATGGGCTTTA | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10.  |
AT3G05810 | AT3G05810.1 | TTAATGGGCTAGGCCCATTC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G26800.1); Has 32 Blast hits to 32 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G05950 | AT3G05950.1 | CCCATTAA | germin-like protein, putative; FUNCTIONS IN: manganese ion binding, nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, apoplast; EXPRESSED IN: sperm cell, male gametophyte, flower, root, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), Germin (InterPro:IPR001929); BEST Arabidopsis thaliana protein match is: GER2 (GERMIN-LIKE PROTEIN 2); oxalate oxidase (TAIR:AT5G39190.1); Has 869 Blast hits to 867 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 24; Plants - 819; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  |
AT3G06030 | AT3G06030.1 | AAAAAGCCCAATAAGAAGGCCCATTAAG | NPK1-related protein kinase 3  |
AT3G06770 | AT3G06770.1 | CCCATTAA | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G49215.1); Has 1737 Blast hits to 1735 proteins in 255 species: Archae - 2; Bacteria - 483; Metazoa - 5; Fungi - 453; Plants - 700; Viruses - 2; Other Eukaryotes - 92 (source: NCBI BLink).  |
AT3G06770.2 | CCCATTAA | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G49215.1); Has 1737 Blast hits to 1735 proteins in 255 species: Archae - 2; Bacteria - 483; Metazoa - 5; Fungi - 453; Plants - 700; Viruses - 2; Other Eukaryotes - 92 (source: NCBI BLink).  | |
AT3G06770.3 | CCCATTAA | glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G49215.1); Has 1737 Blast hits to 1735 proteins in 255 species: Archae - 2; Bacteria - 483; Metazoa - 5; Fungi - 453; Plants - 700; Viruses - 2; Other Eukaryotes - 92 (source: NCBI BLink).  | |
AT3G07150 | AT3G07150.1 | TTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G07860 | AT3G07860.1 | TTAATGGGCTTG | unknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 107 Blast hits to 107 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 67; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT3G08510 | AT3G08510.1 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  |
AT3G08510.2 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  | |
AT3G08510.3 | CTTAATGGGCTTTAT | Phosphoinositide-specific phospholipase C (PI-PLC), catalyzes hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-trisphosphate and diacylglycerol.  | |
AT3G08520 | AT3G08520.1 | ATAAAGCCCATTAAG | 60S ribosomal protein L41 (RPL41D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT3G08590 | AT3G08590.1 | TAAAGCCCATTAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink).  |
AT3G08590.2 | TAAAGCCCATTAA | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink).  | |
AT3G08943 | AT3G08943.1 | TTAATGGG | binding / protein transporter; FUNCTIONS IN: protein transporter activity, binding; INVOLVED IN: intracellular protein transport, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, cytoplasm; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Importin-beta, N-terminal (InterPro:IPR001494), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT3G08947.1).  |
AT3G08950 | AT3G08950.1 | CTTAATGGGCTTTAA | electron transport SCO1/SenC family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: copper ion transport, respiratory chain complex IV assembly, cellular copper ion homeostasis, cell redox homeostasis; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synthesis of cytochrome c oxidase, Sco1/Sco2 (InterPro:IPR017276), Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT4G39740.1); Has 3037 Blast hits to 3037 proteins in 688 species: Archae - 11; Bacteria - 1550; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 1204 (source: NCBI BLink).  |
AT3G09250 | AT3G09250.1 | CAAAGCCCATTAA | DNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10925.2); Has 169 Blast hits to 169 proteins in 54 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
AT3G09500 | AT3G09500.1 | ATGGGCTAAGGCCCATTAAG | 60S ribosomal protein L35 (RPL35A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 829 Blast hits to 829 proteins in 305 species: Archae - 115; Bacteria - 131; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).  |
AT3G09770 | AT3G09770.1 | TTAATGGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G03200.1); Has 8637 Blast hits to 5803 proteins in 428 species: Archae - 8; Bacteria - 389; Metazoa - 3031; Fungi - 915; Plants - 2765; Viruses - 462; Other Eukaryotes - 1067 (source: NCBI BLink).  |
AT3G09770.2 | TTAATGGG | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G03200.1); Has 8637 Blast hits to 5803 proteins in 428 species: Archae - 8; Bacteria - 389; Metazoa - 3031; Fungi - 915; Plants - 2765; Viruses - 462; Other Eukaryotes - 1067 (source: NCBI BLink).  | |
AT3G10300 | AT3G10300.1 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink).  |
AT3G10300.2 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink).  | |
AT3G10300.3 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink).  | |
AT3G10300.4 | TTAATGGGCCTCA | calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink).  | |
AT3G10572 | AT3G10572.1 | ATGGCCCATTAA | 3-phosphoinositide-dependent protein kinase-1, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G10630 | AT3G10630.1 | CTTAATGGGCCTCT | glycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 2500 Blast hits to 2492 proteins in 519 species: Archae - 97; Bacteria - 1438; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 3; Other Eukaryotes - 935 (source: NCBI BLink).  |
AT3G10940 | AT3G10940.1 | TTAAAGCCCATTAA | protein phosphatase-related; FUNCTIONS IN: phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: SEX4 (STARCH-EXCESS 4); polysaccharide binding / protein tyrosine/serine/threonine phosphatase (TAIR:AT3G52180.2); Has 743 Blast hits to 742 proteins in 92 species: Archae - 5; Bacteria - 8; Metazoa - 545; Fungi - 12; Plants - 77; Viruses - 11; Other Eukaryotes - 85 (source: NCBI BLink).  |
AT3G10970 | AT3G10970.1 | TGGCCCATTAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  |
AT3G10970.2 | TGGCCCATTAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  | |
AT3G10970.3 | TGGCCCATTAA | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).  | |
AT3G11500 | AT3G11500.1 | CCCATTAACAATGGGCTTGAAACGACG | small nuclear ribonucleoprotein G, putative / snRNP-G, putative / Sm protein G, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SNRNP-G (PROBABLE SMALL NUCLEAR RIBONUCLEOPROTEIN G) (TAIR:AT2G23930.1); Has 921 Blast hits to 921 proteins in 197 species: Archae - 84; Bacteria - 0; Metazoa - 385; Fungi - 191; Plants - 117; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink).  |
AT3G12100 | AT3G12100.1 | CTTAATGGG | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink).  |
AT3G12100.1 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink).  | |
AT3G12100.1 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink).  | |
AT3G12100.2 | CTTAATGGG | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink).  | |
AT3G12100.2 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink).  | |
AT3G12100.2 | TTAATGGGCT | cation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink).  | |
AT3G12110 | AT3G12110.1 | AGCCCATTAA | Encodes an actin that is expressed predominantly during reproductive development.  |
AT3G12350 | AT3G12350.1 | CCCATTAA | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 33 Blast hits to 33 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G12600 | AT3G12600.1 | TGGGCCCATTAAACCGAA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT3G12600.2 | TGGGCCCATTAAACCGAA | Arabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  | |
AT3G12870 | AT3G12870.1 | TTAATGGGCCA | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56120.1); Has 45 Blast hits to 45 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G13120 | AT3G13120.1 | TTAATGGGCTTAG | 30S ribosomal protein S10, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, bacterial (InterPro:IPR005731), Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10 (InterPro:IPR001848); Has 5644 Blast hits to 5644 proteins in 1660 species: Archae - 168; Bacteria - 2943; Metazoa - 245; Fungi - 117; Plants - 130; Viruses - 0; Other Eukaryotes - 2041 (source: NCBI BLink).  |
AT3G13190 | AT3G13190.1 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink).  |
AT3G13190.2 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink).  | |
AT3G13190.3 | TTAATGGGCCTAAAAGCCCATA | myosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55860.1); Has 24248 Blast hits to 15265 proteins in 1064 species: Archae - 329; Bacteria - 2603; Metazoa - 12748; Fungi - 1596; Plants - 1122; Viruses - 98; Other Eukaryotes - 5752 (source: NCBI BLink).  | |
AT3G13275 | AT3G13275.1 | TTAATGGGCCTTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 13 Blast hits to 13 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G13360 | AT3G13360.1 | TTAATGGGCCTTAT | WPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae - 0; Bacteria - 7; Metazoa - 18; Fungi - 8; Plants - 43; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).  |
AT3G13930 | AT3G13930.1 | ATTAGGCCCATTAA | dihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae - 43; Bacteria - 6315; Metazoa - 646; Fungi - 315; Plants - 198; Viruses - 0; Other Eukaryotes - 7611 (source: NCBI BLink).  |
AT3G14010 | AT3G14010.1 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2.  |
AT3G14010.2 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2.  | |
AT3G14010.3 | TGAGCCCATTAAGGCCCAAAT | hydroxyproline-rich glycoprotein family protein, similar to Mrs16p (GI:2737884) (Saccharomyces cerevisiae); weak similarity to ataxin-2 related protein (GI:1679686) (Homo sapiens). Included in a family of CTC interacting domain proteins found to interact with PAB2.  | |
AT3G14290 | AT3G14290.1 | TTTAGGCCCATTAA | Encodes 20S proteasome subunit PAE2 (PAE2).  |
AT3G14860 | AT3G14860.1 | CTTAATGGGCCTATTATAAGGCCCATAA | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink).  |
AT3G14860.2 | CTTAATGGGCCTATTATAAGGCCCATAA | NHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink).  | |
AT3G15350 | AT3G15350.1 | TTAATGGG | glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: acetylglucosaminyltransferase (TAIR:AT1G53100.1); Has 693 Blast hits to 692 proteins in 87 species: Archae - 0; Bacteria - 18; Metazoa - 462; Fungi - 0; Plants - 188; Viruses - 14; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT3G15350.2 | TTAATGGG | glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: acetylglucosaminyltransferase (TAIR:AT1G53100.1); Has 693 Blast hits to 692 proteins in 87 species: Archae - 0; Bacteria - 18; Metazoa - 462; Fungi - 0; Plants - 188; Viruses - 14; Other Eukaryotes - 11 (source: NCBI BLink).  | |
AT3G16420 | AT3G16420.1 | TTAATGGGCCAA | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests.  |
AT3G16420.2 | TTAATGGGCCAA | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests.  | |
AT3G16420.3 | TTAATGGGCCAA | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests.  | |
AT3G16990 | AT3G16990.1 | AATAGGCCTTGGCCCATTAA | TENA/THI-4 family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Haem oxygenase-like, multi-helical (InterPro:IPR016084), TENA/THI-4 protein/Coenzyme PQQ biosynthesis protein C (InterPro:IPR004305); Has 201 Blast hits to 201 proteins in 61 species: Archae - 21; Bacteria - 69; Metazoa - 0; Fungi - 17; Plants - 26; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).  |
AT3G17000 | AT3G17000.1 | TTAATGGGCCAAGGCCTATT | ubiquitin-conjugating enzyme 32 (UBC32); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5810 Blast hits to 5810 proteins in 294 species: Archae - 0; Bacteria - 0; Metazoa - 2855; Fungi - 1053; Plants - 896; Viruses - 16; Other Eukaryotes - 990 (source: NCBI BLink).  |
AT3G18210 | AT3G18210.1 | TTAATGGGCCG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT3G18210.2 | TTAATGGGCCG | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink).  | |
AT3G18215 | AT3G18215.1 | CGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24600.1); Has 180 Blast hits to 180 proteins in 49 species: Archae - 0; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  |
AT3G18220 | AT3G18220.1 | CCCATTAA | phosphatidic acid phosphatase family protein / PAP2 family protein; FUNCTIONS IN: catalytic activity, phosphatidate phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (InterPro:IPR016118), Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: LPP2 (LIPID PHOSPHATE PHOSPHATASE 2); acid phosphatase/ phosphatidate phosphatase (TAIR:AT1G15080.1); Has 1568 Blast hits to 1566 proteins in 247 species: Archae - 2; Bacteria - 195; Metazoa - 790; Fungi - 260; Plants - 112; Viruses - 2; Other Eukaryotes - 207 (source: NCBI BLink).  |
AT3G18380 | AT3G18380.1 | AAATGGGCCTTTAATGGG | sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G18380.2 | AAATGGGCCTTTAATGGG | sequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G18390 | AT3G18390.1 | CCCATTAAAGGCCCATTT | embryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae - 5; Bacteria - 10; Metazoa - 293; Fungi - 119; Plants - 305; Viruses - 46; Other Eukaryotes - 371 (source: NCBI BLink).  |
AT3G19508 | AT3G19508.1 | TTAAAGGCCCATTAAG | unknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G21200 | AT3G21200.1 | CCCATTAAACCGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 97 Blast hits to 97 proteins in 25 species: Archae - 0; Bacteria - 24; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT3G21295 | AT3G21295.1 | CTTAATGGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G51745.1); Has 428 Blast hits to 314 proteins in 77 species: Archae - 0; Bacteria - 111; Metazoa - 87; Fungi - 55; Plants - 63; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink).  |
AT3G22150 | AT3G22150.1 | GTTTGGGCTTCTTAAAGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 17039 Blast hits to 5252 proteins in 171 species: Archae - 2; Bacteria - 4; Metazoa - 101; Fungi - 62; Plants - 16511; Viruses - 0; Other Eukaryotes - 359 (source: NCBI BLink).  |
AT3G22230 | AT3G22230.1 | TTAATGGGCCGAA | 60S ribosomal protein L27 (RPL27B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27C) (TAIR:AT4G15000.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).  |
AT3G22968 | AT3G22968.1 | CCCATTAA | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF59 represents a conserved upstream opening reading frame relative to major ORF AT3G22970.1  |
AT3G22970 | AT3G22970.1 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G22970.2 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT3G24070 | AT3G24070.1 | CCCATTAAAAGTCAA | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G13450.1); Has 72 Blast hits to 72 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G24070.1 | TTAATGGGC | zinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G13450.1); Has 72 Blast hits to 72 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G24570 | AT3G24570.1 | TTAATGGGCCGG | peroxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, integral to membrane, peroxisomal membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane 22 kDa family protein (TAIR:AT5G43140.1); Has 898 Blast hits to 898 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 471; Fungi - 216; Plants - 153; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).  |
AT3G25520 | AT3G25520.1 | TAAAAGCCCATAGGCCCATTAA | Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2.  |
AT3G25520.1 | TAAAGCCCATTAA | Encodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2.  | |
AT3G26560 | AT3G26560.1 | AAAGCCCATTAA | ATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink).  |
AT3G27110 | AT3G27110.1 | GAAGCCCATTAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink).  |
AT3G27110.2 | GAAGCCCATTAA | peptidase M48 family protein; FUNCTIONS IN: metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M48, Ste24p (InterPro:IPR001915); Has 1644 Blast hits to 1644 proteins in 511 species: Archae - 158; Bacteria - 1140; Metazoa - 0; Fungi - 9; Plants - 21; Viruses - 0; Other Eukaryotes - 316 (source: NCBI BLink).  | |
AT3G27240 | AT3G27240.1 | TTGGCCCATTAAGGCCCAAAT | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT5G40810.1); Has 2901 Blast hits to 2901 proteins in 507 species: Archae - 0; Bacteria - 704; Metazoa - 170; Fungi - 165; Plants - 63; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink).  |
AT3G28500 | AT3G28500.1 | AAAAGGCCCATTAA | 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae - 48; Bacteria - 1; Metazoa - 282; Fungi - 204; Plants - 184; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink).  |
AT3G28500.1 | ATAAGGCCCATTAA | 60S acidic ribosomal protein P2 (RPP2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2E) (TAIR:AT5G40040.1); Has 918 Blast hits to 917 proteins in 250 species: Archae - 48; Bacteria - 1; Metazoa - 282; Fungi - 204; Plants - 184; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink).  | |
AT3G46130 | AT3G46130.1 | TTAATGGG | Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons.  |
AT3G46130.2 | TTAATGGG | Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons.  | |
AT3G46130.3 | TTAATGGG | Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons.  | |
AT3G46230 | AT3G46230.1 | TTAAGGCCCATTAA | member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds  |
AT3G46580 | AT3G46580.1 | CTTAATGGGCCCAAAAGCCCAAAA | Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.  |
AT3G47700 | AT3G47700.1 | AGGGCCCATTAA | Involved in transportation of seed storage proteins from the ER to the vacuole. Mutant seed cell accumulates the precursors of 12S globulin and 2S albumin instead of the vacuolar-located mature proteins.  |
AT3G49500 | AT3G49500.1 | TAAAAGCCCATTAA | Encodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance.  |
AT3G50590 | AT3G50590.1 | TTAAAGCCCATTTAGGCCCATTAAACGACA | nucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).  |
AT3G50808 | AT3G50808.1 | CTTAATGGGCCGA | unknown protein.  |
AT3G50920 | AT3G50920.1 | AAAAGCCCATTAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  |
AT3G50920.2 | AAAAGCCCATTAA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).  | |
AT3G51290 | AT3G51290.1 | CCCATTAA | proline-rich family protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF630 (InterPro:IPR006868), Protein of unknown function DUF632 (InterPro:IPR006867); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT3G60320.1); Has 34091 Blast hits to 17701 proteins in 932 species: Archae - 107; Bacteria - 4016; Metazoa - 13252; Fungi - 3462; Plants - 6890; Viruses - 1341; Other Eukaryotes - 5023 (source: NCBI BLink).  |
AT3G52300 | AT3G52300.1 | CTTAATGGG | ATP SYNTHASE D CHAIN, MITOCHONDRIAL (ATPQ); FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: response to salt stress; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit D, mitochondrial (InterPro:IPR008689); Has 220 Blast hits to 220 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 31; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT3G52300.2 | CTTAATGGG | ATP SYNTHASE D CHAIN, MITOCHONDRIAL (ATPQ); FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: response to salt stress; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit D, mitochondrial (InterPro:IPR008689); Has 220 Blast hits to 220 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 31; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  | |
AT3G52960 | AT3G52960.1 | GTAGGCCCATTAAGGCCCAATAACGGCGT | peroxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink).  |
AT3G53500 | AT3G53500.2 | TTAATGGGCTTTA | RSZ32; FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, RNA splicing; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: RSZ33; nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT2G37340.1); Has 19457 Blast hits to 16188 proteins in 516 species: Archae - 6; Bacteria - 235; Metazoa - 7507; Fungi - 1066; Plants - 1444; Viruses - 8093; Other Eukaryotes - 1106 (source: NCBI BLink).  |
AT3G53580 | AT3G53580.1 | CTTAATGGGCTTTTT | diaminopimelate epimerase family protein; FUNCTIONS IN: diaminopimelate epimerase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diaminopimelate epimerase, active site (InterPro:IPR018510), Diaminopimelate epimerase (InterPro:IPR001653); Has 5079 Blast hits to 5075 proteins in 1167 species: Archae - 51; Bacteria - 2343; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 2658 (source: NCBI BLink).  |
AT3G54210 | AT3G54210.1 | TATAGGCCCATTAAGGCCCATCA | ribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G09770.1); Has 5385 Blast hits to 5385 proteins in 1530 species: Archae - 0; Bacteria - 3017; Metazoa - 102; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2110 (source: NCBI BLink).  |
AT3G55440 | AT3G55440.1 | TTAATGGGCCTAAAGCCCATA | Encodes triosephosphate isomerase.  |
AT3G55600 | AT3G55600.1 | TTAAAGCCCAGCCTAGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: cation exchanger, putative (CAX10) (TAIR:AT1G54110.1); Has 167 Blast hits to 167 proteins in 56 species: Archae - 0; Bacteria - 8; Metazoa - 84; Fungi - 28; Plants - 42; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT3G56440 | AT3G56440.1 | AGAGGCCCATTAAG | AtATG18d; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18c (TAIR:AT2G40810.2); Has 1093 Blast hits to 1046 proteins in 176 species: Archae - 0; Bacteria - 24; Metazoa - 508; Fungi - 305; Plants - 110; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).  |
AT3G56860 | AT3G56860.1 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  |
AT3G56860.2 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  | |
AT3G56860.3 | TTAATGGGCTTAT | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.  | |
AT3G56990 | AT3G56990.1 | AATAGGCCCATTAAG | embryo sac development arrest 7 (EDA7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: megagametogenesis; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NUC153 (InterPro:IPR012580), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 3435 Blast hits to 2597 proteins in 327 species: Archae - 0; Bacteria - 215; Metazoa - 1552; Fungi - 648; Plants - 432; Viruses - 52; Other Eukaryotes - 536 (source: NCBI BLink).  |
AT3G57000 | AT3G57000.1 | CTTAATGGGCCTATT | nucleolar essential protein-related; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal biogenesis, methyltransferase, EMG1/NEP1 (InterPro:IPR005304); Has 1252 Blast hits to 912 proteins in 202 species: Archae - 94; Bacteria - 9; Metazoa - 674; Fungi - 138; Plants - 36; Viruses - 2; Other Eukaryotes - 299 (source: NCBI BLink).  |
AT3G57650 | AT3G57650.1 | CCCATTAA | Encodes an endoplasmic reticulum localized protein with lysophosphatidyl acyltransferase activity.  |
AT3G57900 | AT3G57900.1 | TTAATGGGCTTTAATTAGGCCCAATAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: epidermis; Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G57910 | AT3G57910.1 | TTATTGGGCCTAATTAAAGCCCATTAA | D111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT5G26610.2); Has 5088 Blast hits to 3153 proteins in 241 species: Archae - 10; Bacteria - 109; Metazoa - 2809; Fungi - 372; Plants - 190; Viruses - 44; Other Eukaryotes - 1554 (source: NCBI BLink).  |
AT3G58600 | AT3G58600.1 | AAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: endocytosis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Adaptin ear-binding coat-associated protein 1 NECAP-1 (InterPro:IPR012466); BEST Arabidopsis thaliana protein match is: ATNAP4 (Arabidopsis thaliana non-intrinsic ABC protein 4); ATPase, coupled to transmembrane movement of substances / transporter (TAIR:AT1G03900.1); Has 329 Blast hits to 329 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 43; Plants - 52; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).  |
AT3G58610 | AT3G58610.1 | TTAATGGGCCTTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink).  |
AT3G58610.2 | TTAATGGGCCTTTT | ketol-acid reductoisomerase; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, ketol-acid reductoisomerase activity, catalytic activity; INVOLVED IN: response to cadmium ion, branched chain family amino acid biosynthetic process; LOCATED IN: in 6 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acetohydroxy acid isomeroreductase, catalytic (InterPro:IPR013116), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Acetohydroxy acid isomeroreductase C-terminal (InterPro:IPR000506), Ketol-acid reductoisomerase, plant (InterPro:IPR016206), Acetohydroxy acid isomeroreductase (InterPro:IPR013023), NAD(P)-binding (InterPro:IPR016040); Has 5485 Blast hits to 5266 proteins in 1271 species: Archae - 134; Bacteria - 2645; Metazoa - 0; Fungi - 179; Plants - 83; Viruses - 0; Other Eukaryotes - 2444 (source: NCBI BLink).  | |
AT3G59540 | AT3G59540.1 | TTAATGGGCCTAAGGGGT | 60S ribosomal protein L38 (RPL38B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38A) (TAIR:AT2G43460.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).  |
AT3G59990 | AT3G59990.1 | CCCGACCCATTAAG | Encodes a MAP2 like methionine aminopeptidase  |
AT3G59990.1 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase  | |
AT3G59990.2 | CCCGACCCATTAAG | Encodes a MAP2 like methionine aminopeptidase  | |
AT3G59990.2 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase  | |
AT3G59990.3 | CCCGACCCATTAAG | Encodes a MAP2 like methionine aminopeptidase  | |
AT3G59990.3 | GTAAGGCCCATTAA | Encodes a MAP2 like methionine aminopeptidase  | |
AT3G61130 | AT3G61130.1 | TTAATGGG | Encodes a protein with putative galacturonosyltransferase activity.  |
AT3G61960 | AT3G61960.1 | TTAATGGG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G37840.1); Has 96538 Blast hits to 94555 proteins in 3142 species: Archae - 71; Bacteria - 8635; Metazoa - 41764; Fungi - 8770; Plants - 18509; Viruses - 485; Other Eukaryotes - 18304 (source: NCBI BLink).  |
AT3G61960.2 | TTAATGGG | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G37840.1); Has 96538 Blast hits to 94555 proteins in 3142 species: Archae - 71; Bacteria - 8635; Metazoa - 41764; Fungi - 8770; Plants - 18509; Viruses - 485; Other Eukaryotes - 18304 (source: NCBI BLink).  | |
AT3G62080 | AT3G62080.1 | TTAATGGGCCGGGCCTAAT | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).  |
AT3G62080.1 | TTAATGGGCCTGG | SNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).  | |
AT3G62360 | AT3G62360.1 | TAGTGGGCTTTATAAAGCCCATTAAGCCCTA | carbohydrate binding; FUNCTIONS IN: carbohydrate binding; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding-like fold (InterPro:IPR013784), Collagen-binding surface protein Cna-like, B region (InterPro:IPR008454); Has 234 Blast hits to 193 proteins in 70 species: Archae - 4; Bacteria - 76; Metazoa - 122; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT3G62370 | AT3G62370.1 | TAGGGCTTAATGGGCTTTATAAAGCCCACTA | unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G62680 | AT3G62680.1 | TTAATGGGCCTAT | Proline-rich protein  |
AT3G62800 | AT3G62800.1 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.  |
AT3G62800.2 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.  | |
AT3G62800.3 | ATAAGCCCAATTTTGGCCCATTAA | Encodes a nuclear dsRNA-binding protein that interacts specifically with DCL4. May regulate DCL4 function and thereby affect miRNA biogenesis. DRB4 interacts with the P6 viral protein from Cauliflower mosaic virus and may be a target of viral silencing suppression.  | |
AT3G62810 | AT3G62810.1 | TTAATGGGCCAAAATTGGGCTTAT | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 68 Blast hits to 68 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 22; Plants - 17; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT3G62840 | AT3G62840.1 | TTAATGGGCTTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  |
AT3G62840.2 | TTAATGGGCTTTA | FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative (TAIR:AT2G47640.4); Has 535 Blast hits to 535 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 109; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).  | |
AT3G63190 | AT3G63190.1 | TACGGCCCATTAAGGCCCACA | RIBOSOME RECYCLING FACTOR, CHLOROPLAST PRECURSOR (RRF); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: defense response to bacterium, translation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosome recycling factor, bacterial-like (InterPro:IPR015998), Ribosome recycling factor (InterPro:IPR002661); BEST Arabidopsis thaliana protein match is: ribosome recycling factor family protein / ribosome releasing factor family protein (TAIR:AT3G01800.1); Has 5492 Blast hits to 5492 proteins in 1475 species: Archae - 0; Bacteria - 2924; Metazoa - 104; Fungi - 52; Plants - 56; Viruses - 0; Other Eukaryotes - 2356 (source: NCBI BLink).  |
AT4G00090 | AT4G00090.1 | TTAATGGG | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink).  |
AT4G00500 | AT4G00500.1 | TTAATGGGCCTATA | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  |
AT4G00500.2 | TTAATGGGCCTATA | lipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).  | |
AT4G00520 | AT4G00520.2 | TATAGGCCCATTAA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink).  |
AT4G00520.3 | TATAGGCCCATTAA | acyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink).  | |
AT4G00710 | AT4G00710.1 | CCCATTAA | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized.  |
AT4G00840 | AT4G00840.1 | TTATTGGGCCTGTTAATGGGCCTTAT | zinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G60800.1); Has 3992 Blast hits to 3990 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1955; Fungi - 533; Plants - 396; Viruses - 0; Other Eukaryotes - 1108 (source: NCBI BLink).  |
AT4G00850 | AT4G00850.1 | ATAAGGCCCATTAACAGGCCCAATAA | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA  |
AT4G01860 | AT4G01860.1 | TAAGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink).  |
AT4G01860.2 | TAAGCCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink).  | |
AT4G03280 | AT4G03280.1 | TAAGCCCATTAAG | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.  |
AT4G03280.2 | TAAGCCCATTAAG | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.  | |
AT4G03430 | AT4G03430.1 | AAAAAGCCCATTAAAAAGCCCACTA | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes.  |
AT4G05160 | AT4G05160.1 | CCCATTAA | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At4g05160 preferentially activates fatty acids with medium chain length (C6:0 and C7:0) as well as even-numbered long-chain fatty acids (C14:0, C16:0 and C18:0). At4g05160 was also able to catalyze the conversion of OPC-6:0 to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis.  |
AT4G05410 | AT4G05410.1 | TTAATGGGCTCA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink).  |
AT4G09000 | AT4G09000.1 | AAAAAGCCCATTAA | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available.  |
AT4G09000.2 | AAAAAGCCCATTAA | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available.  | |
AT4G09670 | AT4G09670.1 | CCCATTAA | oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase, N-terminal (InterPro:IPR000683), Oxidoreductase, C-terminal (InterPro:IPR004104), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G34200.1); Has 10490 Blast hits to 10489 proteins in 1179 species: Archae - 137; Bacteria - 6095; Metazoa - 233; Fungi - 386; Plants - 50; Viruses - 0; Other Eukaryotes - 3589 (source: NCBI BLink).  |
AT4G09730 | AT4G09730.1 | CTTAATGGGCCAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT3G06980.1); Has 26614 Blast hits to 26065 proteins in 1716 species: Archae - 427; Bacteria - 10484; Metazoa - 4922; Fungi - 3195; Plants - 1331; Viruses - 9; Other Eukaryotes - 6246 (source: NCBI BLink).  |
AT4G09830 | AT4G09830.1 | CCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP009193 (InterPro:IPR016549); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64780.1); Has 56 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G10180 | AT4G10180.1 | TCAGGCCCATTAA | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling.  |
AT4G10320 | AT4G10320.1 | TACGGCCCATTAA | isoleucyl-tRNA synthetase, putative / isoleucine--tRNA ligase, putative; FUNCTIONS IN: isoleucine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: male gametophyte, guard cell, epidermis, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Isoleucyl-tRNA synthetase (InterPro:IPR018353), Isoleucyl-tRNA synthetase, class Ia (InterPro:IPR002301), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Isoleucyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015905), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ catalytic/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.1); Has 27648 Blast hits to 24183 proteins in 1801 species: Archae - 699; Bacteria - 11987; Metazoa - 692; Fungi - 480; Plants - 135; Viruses - 0; Other Eukaryotes - 13655 (source: NCBI BLink).  |
AT4G10320.1 | TTAATGGGCTTA | isoleucyl-tRNA synthetase, putative / isoleucine--tRNA ligase, putative; FUNCTIONS IN: isoleucine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: male gametophyte, guard cell, epidermis, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Isoleucyl-tRNA synthetase (InterPro:IPR018353), Isoleucyl-tRNA synthetase, class Ia (InterPro:IPR002301), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Isoleucyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015905), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ catalytic/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.1); Has 27648 Blast hits to 24183 proteins in 1801 species: Archae - 699; Bacteria - 11987; Metazoa - 692; Fungi - 480; Plants - 135; Viruses - 0; Other Eukaryotes - 13655 (source: NCBI BLink).  | |
AT4G10480 | AT4G10480.1 | CTAAGGCCCATTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink).  |
AT4G10480.2 | CTAAGGCCCATTAA | nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA5 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5) (TAIR:AT1G33040.1); Has 868 Blast hits to 860 proteins in 234 species: Archae - 53; Bacteria - 5; Metazoa - 324; Fungi - 191; Plants - 110; Viruses - 2; Other Eukaryotes - 183 (source: NCBI BLink).  | |
AT4G11120 | AT4G11120.1 | CTTAATGGGCCAT | translation elongation factor Ts (EF-Ts), putative; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Translation elongation factor Ts, conserved site (InterPro:IPR018101), Translation elongation factor EFTs/EF1B (InterPro:IPR001816), UBA-like (InterPro:IPR009060), Translation elongation factor EFTs/EF1B, dimerisation (InterPro:IPR014039); BEST Arabidopsis thaliana protein match is: emb2726 (embryo defective 2726); RNA binding / translation elongation factor (TAIR:AT4G29060.1); Has 6692 Blast hits to 6063 proteins in 1504 species: Archae - 0; Bacteria - 3293; Metazoa - 104; Fungi - 16; Plants - 114; Viruses - 0; Other Eukaryotes - 3165 (source: NCBI BLink).  |
AT4G14270 | AT4G14270.1 | CTTAATGGGCTTATGGGCTTC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.  |
AT4G14270.2 | CTTAATGGGCTTATGGGCTTC | Protein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.  | |
AT4G14320 | AT4G14320.1 | TTAATGGGCTTTTT | 60S ribosomal protein L36a/L44 (RPL36aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aA) (TAIR:AT3G23390.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).  |
AT4G14330 | AT4G14330.1 | AAAAAGCCCATTAA | phragmoplast-associated kinesin-related protein 2 (PAKRP2); FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: phragmoplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATK1 (ARABIDOPSIS THALIANA KINESIN 1); microtubule motor/ minus-end-directed microtubule motor (TAIR:AT4G21270.1); Has 19997 Blast hits to 14982 proteins in 632 species: Archae - 102; Bacteria - 784; Metazoa - 9932; Fungi - 1679; Plants - 1066; Viruses - 71; Other Eukaryotes - 6363 (source: NCBI BLink).  |
AT4G14490 | AT4G14490.1 | TAAAAGCCCATTTAAGGCCCATTAA | forkhead-associated domain-containing protein / FHA domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253); BEST Arabidopsis thaliana protein match is: forkhead-associated domain-containing protein / FHA domain-containing protein / AT hook motif-containing protein (TAIR:AT3G02400.1); Has 1075 Blast hits to 1048 proteins in 243 species: Archae - 14; Bacteria - 671; Metazoa - 68; Fungi - 54; Plants - 81; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).  |
AT4G14600 | AT4G14600.1 | CCCATTAACCCGAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT4G15030 | AT4G15030.1 | TACGGCCCAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages.  |
AT4G15030.2 | TACGGCCCAGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages.  | |
AT4G15240 | AT4G15240.1 | TTAATGGGCCGA | fringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT1G05280.1); Has 368 Blast hits to 364 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 109; Plants - 125; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT4G15410 | AT4G15410.1 | TTTGGGCCCATTAA | Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma (PUX5); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBX (InterPro:IPR001012), SEP (InterPro:IPR012989), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: PUX4; protein binding (TAIR:AT4G04210.1); Has 2169 Blast hits to 897 proteins in 184 species: Archae - 0; Bacteria - 87; Metazoa - 456; Fungi - 202; Plants - 88; Viruses - 16; Other Eukaryotes - 1320 (source: NCBI BLink).  |
AT4G16580 | AT4G16580.1 | GCCCATTAA | catalytic; FUNCTIONS IN: catalytic activity; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932); BEST Arabidopsis thaliana protein match is: 5-azacytidine resistance protein -related (TAIR:AT5G66720.1); Has 560 Blast hits to 550 proteins in 150 species: Archae - 0; Bacteria - 2; Metazoa - 153; Fungi - 152; Plants - 117; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).  |
AT4G16630 | AT4G16630.1 | ATAAGCCCATTAA | DEAD/DEAH box helicase, putative (RH28); FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G16280.1); Has 75014 Blast hits to 49574 proteins in 2104 species: Archae - 542; Bacteria - 21437; Metazoa - 22382; Fungi - 7369; Plants - 2826; Viruses - 629; Other Eukaryotes - 19829 (source: NCBI BLink).  |
AT4G16695 | AT4G16695.1 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G16695.2 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G16695.3 | AGAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G17020 | AT4G17020.1 | CAAGGCCCATTAA | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT4G17020.2 | CAAGGCCCATTAA | transcription factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: DNA repair, regulation of transcription, DNA-dependent; LOCATED IN: endomembrane system, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor Tfb2 (InterPro:IPR004598); Has 322 Blast hits to 321 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 97; Plants - 31; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  | |
AT4G17530 | AT4G17530.1 | TTAATGGGCCTTAG | ATRAB1C; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1A; GTP binding (TAIR:AT5G47200.1); Has 23593 Blast hits to 23542 proteins in 647 species: Archae - 17; Bacteria - 111; Metazoa - 13220; Fungi - 2827; Plants - 2160; Viruses - 19; Other Eukaryotes - 5239 (source: NCBI BLink).  |
AT4G17540 | AT4G17540.1 | CTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 80 Blast hits to 67 proteins in 31 species: Archae - 4; Bacteria - 22; Metazoa - 9; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT4G17840 | AT4G17840.1 | AAAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35260.1); Has 1905 Blast hits to 183 proteins in 52 species: Archae - 0; Bacteria - 24; Metazoa - 708; Fungi - 70; Plants - 25; Viruses - 2; Other Eukaryotes - 1076 (source: NCBI BLink).  |
AT4G17960 | AT4G17960.1 | GTGGGCTTTTATTAATGGGCTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46620.1); Has 22 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G18120 | AT4G18120.1 | TTAATGGG | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML3 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML3 is the transcript with highest frequency of alternative splicing. Expression was detected during early embryo development (heart and torpedo stage); no accumulation was detected in vegetative and floral apices, as revealed by in situ hybridization.  |
AT4G18120.2 | TTAATGGG | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML3 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML3 is the transcript with highest frequency of alternative splicing. Expression was detected during early embryo development (heart and torpedo stage); no accumulation was detected in vegetative and floral apices, as revealed by in situ hybridization.  | |
AT4G18975 | AT4G18975.1 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G18975.2 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G18975.3 | AAAAGGCCCATTAA | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G20480 | AT4G20480.1 | GTAGGCCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G06810.1); Has 76 Blast hits to 74 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G21190 | AT4G21190.1 | TTAATGGGCCTATT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT4G21190.1 | TTAATGGGCCTATT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT4G21190.1 | TTAATGGGCCTTAT | embryo defective 1417 (emb1417); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 144 Blast hits to 143 proteins in 15 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  | |
AT4G21192 | AT4G21192.1 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G21192.1 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21192.1 | ATAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21192.2 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21192.2 | AATAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G21192.2 | ATAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase biogenesis protein Cmc1-like (InterPro:IPR013892); Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 29; Plants - 9; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT4G22770 | AT4G22770.1 | CCCATTAA | DNA-binding family protein; FUNCTIONS IN: DNA binding; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: DNA-binding family protein (TAIR:AT4G12080.1); Has 554 Blast hits to 548 proteins in 75 species: Archae - 0; Bacteria - 59; Metazoa - 26; Fungi - 29; Plants - 423; Viruses - 8; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT4G22910 | AT4G22910.1 | CAAGCCCATTAA | FIZZY-RELATED 2 (FZR2); FUNCTIONS IN: signal transducer activity; INVOLVED IN: trichome branching, signal transduction, DNA endoreduplication, cell growth; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: CCS52A2; signal transducer (TAIR:AT4G11920.1); Has 32185 Blast hits to 17091 proteins in 521 species: Archae - 40; Bacteria - 4571; Metazoa - 14163; Fungi - 6386; Plants - 2781; Viruses - 0; Other Eukaryotes - 4244 (source: NCBI BLink).  |
AT4G23680 | AT4G23680.1 | GCCCATTAA | major latex protein-related / MLP-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT4G23670.1); Has 219 Blast hits to 199 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 219; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G23710 | AT4G23710.1 | TTAATGGGCCTGA | VAG2; FUNCTIONS IN: hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances; INVOLVED IN: proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar (H+)-ATPase G subunit (InterPro:IPR005124); BEST Arabidopsis thaliana protein match is: VMA10 (VACUOLAR MEMBRANE ATPASE 10); hydrogen ion transporting ATP synthase, rotational mechanism (TAIR:AT3G01390.2); Has 470 Blast hits to 470 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 268; Fungi - 80; Plants - 75; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
AT4G24500 | AT4G24500.1 | TTAATGGGCCGGTTTAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT4G24500.2 | TTAATGGGCCGGTTTAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink).  | |
AT4G24690 | AT4G24690.1 | AGGGCCCATTAA | ubiquitin-associated (UBA)/TS-N domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Zinc finger, ZZ-type (InterPro:IPR000433); Has 492 Blast hits to 472 proteins in 101 species: Archae - 0; Bacteria - 6; Metazoa - 329; Fungi - 68; Plants - 57; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT4G25360 | AT4G25360.1 | TTAATGGGCT | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: YLS7 (TAIR:AT5G51640.1); Has 699 Blast hits to 688 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G25360.2 | TTAATGGGCT | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: YLS7 (TAIR:AT5G51640.1); Has 699 Blast hits to 688 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G26310 | AT4G26310.1 | TTAATGGGCTA | elongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink).  |
AT4G26400 | AT4G26400.1 | TTAATGGGCTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7059 Blast hits to 7033 proteins in 227 species: Archae - 0; Bacteria - 6; Metazoa - 2361; Fungi - 631; Plants - 2786; Viruses - 51; Other Eukaryotes - 1224 (source: NCBI BLink).  |
AT4G26400.2 | TTAATGGGCTTTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7059 Blast hits to 7033 proteins in 227 species: Archae - 0; Bacteria - 6; Metazoa - 2361; Fungi - 631; Plants - 2786; Viruses - 51; Other Eukaryotes - 1224 (source: NCBI BLink).  | |
AT4G26410 | AT4G26410.1 | TTAAAGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022280 (InterPro:IPR016803); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45060.1); Has 47 Blast hits to 47 proteins in 12 species: Archae - 3; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 40; Viruses - 1; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT4G26600 | AT4G26600.1 | CAAGCCCATTAAG | nucleolar protein, putative; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: nucleolus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), Nop2p (InterPro:IPR011023); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT5G55920.1); Has 58475 Blast hits to 25518 proteins in 1706 species: Archae - 305; Bacteria - 24540; Metazoa - 13109; Fungi - 5777; Plants - 1987; Viruses - 583; Other Eukaryotes - 12174 (source: NCBI BLink).  |
AT4G26760 | AT4G26760.1 | TAAGCCCATTAAG | MAP65-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anaphase; LOCATED IN: cortical microtubule, preprophase band, phragmoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MAP65/ASE1 (InterPro:IPR007145); BEST Arabidopsis thaliana protein match is: ATMAP65-1 (MICROTUBULE-ASSOCIATED PROTEINS 65-1); microtubule binding (TAIR:AT5G55230.1); Has 7158 Blast hits to 5289 proteins in 462 species: Archae - 120; Bacteria - 495; Metazoa - 4190; Fungi - 430; Plants - 357; Viruses - 13; Other Eukaryotes - 1553 (source: NCBI BLink).  |
AT4G26990 | AT4G26990.1 | ATAAGGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54920.1); Has 176 Blast hits to 161 proteins in 44 species: Archae - 0; Bacteria - 4; Metazoa - 71; Fungi - 20; Plants - 57; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT4G27150 | AT4G27150.1 | CCCATTAA | 2S seed storage protein 2 / 2S albumin storage protein / NWMU2-2S albumin 2; FUNCTIONS IN: lipid binding, nutrient reservoir activity; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Bifunctional trypsin/alpha-amylase inhibitor (InterPro:IPR013771), Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Napin/ Bra allergen (InterPro:IPR000617), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: AT2S3; lipid binding / nutrient reservoir (TAIR:AT4G27160.1); Has 152 Blast hits to 147 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT4G27630 | AT4G27630.2 | TTAATGGG | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG2 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG2 and may act to down-regulate GTG2 binding to ABA. GTG2 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG2 transcript levels do not appear to change in response to ABA or abiotic stresses.  |
AT4G28450 | AT4G28450.1 | AAAAAGCCCATTAAG | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  |
AT4G28730 | AT4G28730.1 | TATAGGCCCATTAAG | glutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae - 0; Bacteria - 1253; Metazoa - 362; Fungi - 221; Plants - 386; Viruses - 107; Other Eukaryotes - 817 (source: NCBI BLink).  |
AT4G28880 | AT4G28880.1 | CCCATTAA | Casein Kinase I-like 3 (ckl3); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl4 (Casein Kinase I-like 4); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28860.1); Has 47686 Blast hits to 47386 proteins in 1403 species: Archae - 19; Bacteria - 6033; Metazoa - 20862; Fungi - 4890; Plants - 5655; Viruses - 307; Other Eukaryotes - 9920 (source: NCBI BLink).  |
AT4G29330 | AT4G29330.1 | TTAATGGGTCAAATAAAAGCC | DERLIN-1 (DER1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 666 Blast hits to 665 proteins in 170 species: Archae - 0; Bacteria - 12; Metazoa - 290; Fungi - 127; Plants - 84; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink).  |
AT4G29390 | AT4G29390.1 | TATAGGCCCATTAAG | 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  |
AT4G29400 | AT4G29400.1 | CTTAATGGGCCTATA | unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink).  |
AT4G29510 | AT4G29510.1 | TTAATGGG | Has arginine N-methyltransferase activity. Modifies AtMBD7.  |
AT4G29520 | AT4G29520.1 | TTAATGGGCCTTAC | LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 120 Blast hits to 120 proteins in 43 species: Archae - 2; Bacteria - 0; Metazoa - 42; Fungi - 10; Plants - 19; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  |
AT4G29530 | AT4G29530.1 | GTAAGGCCCATTAA | 2,3-diketo-5-methylthio-1-phosphopentane phosphatase family; FUNCTIONS IN: phosphatase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G17710.1); Has 269 Blast hits to 267 proteins in 80 species: Archae - 0; Bacteria - 19; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT4G29820 | AT4G29820.1 | TAAAGGCCCATTAA | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit.  |
AT4G29830 | AT4G29830.1 | TTAATGGGCCTGT | The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin.  |
AT4G29830.1 | TTAATGGGCCTTTA | The protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin.  | |
AT4G29840 | AT4G29840.1 | TTAATGGGCCCAAAA | threonine synthase  |
AT4G30400 | AT4G30400.1 | CCCATTAA | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: MEE16 (maternal effect embryo arrest 16); protein binding / zinc ion binding (TAIR:AT2G18650.1); Has 6257 Blast hits to 6242 proteins in 227 species: Archae - 0; Bacteria - 0; Metazoa - 1925; Fungi - 543; Plants - 2685; Viruses - 49; Other Eukaryotes - 1055 (source: NCBI BLink).  |
AT4G30480 | AT4G30480.1 | CTTAATGGGCCAAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink).  |
AT4G30480.2 | CTTAATGGGCCAAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink).  | |
AT4G30480.3 | CTTAATGGGCCAAT | tetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 10494 Blast hits to 7864 proteins in 509 species: Archae - 360; Bacteria - 1926; Metazoa - 3500; Fungi - 950; Plants - 1004; Viruses - 24; Other Eukaryotes - 2730 (source: NCBI BLink).  | |
AT4G30620 | AT4G30620.1 | TAAAAGCCCATTAA | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24020.1); Has 1303 Blast hits to 1303 proteins in 522 species: Archae - 0; Bacteria - 1050; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).  |
AT4G30750 | AT4G30750.1 | CTTAATGGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30760 | AT4G30760.1 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30760.2 | AGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT4G30940 | AT4G30940.1 | TTAATGGG | potassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT2G24240.1); Has 948 Blast hits to 933 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 800; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).  |
AT4G31560 | AT4G31560.1 | TTAATGGGCCTC | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane.  |
AT4G31930 | AT4G31930.1 | GAAGCCCATTAA | mitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial matrix; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 212 Blast hits to 212 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 66; Plants - 109; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).  |
AT4G32590 | AT4G32590.1 | TAAATGGGCTTGTTAATGGG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink).  |
AT4G32590.2 | TAAATGGGCTTGTTAATGGG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink).  | |
AT4G32590.3 | TAAATGGGCTTGTTAATGGG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink).  | |
AT4G32590.4 | TAAATGGGCTTGTTAATGGG | ferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink).  | |
AT4G32820 | AT4G32820.1 | AATAGGCCCATTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026).  |
AT4G32820.2 | AATAGGCCCATTAA | binding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026).  | |
AT4G32850 | AT4G32850.1 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  |
AT4G32850.10 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G32850.2 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G32850.3 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G32850.4 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G32850.5 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G32850.6 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G32850.7 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G32850.8 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G32850.9 | CCCATTAA | Encodes a nuclear poly(A) polymerase.  | |
AT4G33060 | AT4G33060.1 | TTAATGGGCTGGGCTTAG | peptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 18511 Blast hits to 16644 proteins in 1616 species: Archae - 90; Bacteria - 4190; Metazoa - 5100; Fungi - 1622; Plants - 926; Viruses - 34; Other Eukaryotes - 6549 (source: NCBI BLink).  |
AT4G33520 | AT4G33520.1 | CCCATTAAG | Encodes a putative metal-transporting P-type ATPase.  |
AT4G33520.2 | CCCATTAAG | Encodes a putative metal-transporting P-type ATPase.  | |
AT4G33520.3 | CCCATTAAG | Encodes a putative metal-transporting P-type ATPase.  | |
AT4G34135 | AT4G34135.1 | CCCATTAA | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position.  |
AT4G34135.2 | CCCATTAA | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position.  | |
AT4G34270 | AT4G34270.1 | TTAAAGCCCATTAAG | TIP41-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: TIP41-like protein (InterPro:IPR007303); Has 248 Blast hits to 248 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  |
AT4G34460 | AT4G34460.1 | TTAATGGG | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  |
AT4G34460.2 | TTAATGGG | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  | |
AT4G34460.3 | TTAATGGG | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  | |
AT4G34460.4 | TTAATGGG | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase  | |
AT4G34700 | AT4G34700.1 | TTAATGGGCCGAT | complex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 51; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT4G36800 | AT4G36800.1 | AAATGGGCCTAACGGGCTTTAATGGGCCAA | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.  |
AT4G36800.2 | AAATGGGCCTAACGGGCTTTAATGGGCCAA | RUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.  | |
AT4G36830 | AT4G36830.1 | CCCATTAAG | GNS1/SUR4 membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: GNS1/SUR4 membrane protein (InterPro:IPR002076); BEST Arabidopsis thaliana protein match is: GNS1/SUR4 membrane family protein (TAIR:AT1G75000.1); Has 99 Blast hits to 99 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 24; Plants - 39; Viruses - 2; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT4G37040 | AT4G37040.1 | TTGGCCCATTAATAGCCCAATAT | encodes a methionine aminopeptidase  |
AT4G37090 | AT4G37090.1 | TTAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink).  |
AT4G37090.2 | TTAATGGGCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink).  | |
AT4G37409 | AT4G37409.1 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G37830 | AT4G37830.1 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  |
AT4G37830.2 | TGATGGGCTAAAATAGCCCATAAAAGGCCCATTAA | cytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIa (InterPro:IPR001349); Has 138 Blast hits to 138 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).  | |
AT4G38380 | AT4G38380.1 | AGTGGGCTTTAATGGGCTTA | antiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink).  |
AT4G38890 | AT4G38890.1 | TTATGGGCCGGTTTTTGGCCCATTAA | dihydrouridine synthase family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: oxidation reduction, tRNA processing, metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G49640.1); Has 7322 Blast hits to 7247 proteins in 1396 species: Archae - 11; Bacteria - 4174; Metazoa - 431; Fungi - 362; Plants - 91; Viruses - 0; Other Eukaryotes - 2253 (source: NCBI BLink).  |
AT4G39080 | AT4G39080.1 | GAAGCCCATTAAAAGCCCAATA | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast.  |
AT4G39560 | AT4G39560.1 | TGAGGCCCATTAAG | kelch repeat-containing F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), EF-HAND 1 (InterPro:IPR018247), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2608 Blast hits to 2033 proteins in 134 species: Archae - 4; Bacteria - 110; Metazoa - 1739; Fungi - 7; Plants - 628; Viruses - 37; Other Eukaryotes - 83 (source: NCBI BLink).  |
AT4G39560.2 | TGAGGCCCATTAAG | kelch repeat-containing F-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), EF-HAND 1 (InterPro:IPR018247), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2608 Blast hits to 2033 proteins in 134 species: Archae - 4; Bacteria - 110; Metazoa - 1739; Fungi - 7; Plants - 628; Viruses - 37; Other Eukaryotes - 83 (source: NCBI BLink).  | |
AT4G39770 | AT4G39770.1 | TTAATGGG | trehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: catalytic/ trehalose-phosphatase (TAIR:AT2G22190.1); Has 1503 Blast hits to 1499 proteins in 531 species: Archae - 29; Bacteria - 768; Metazoa - 195; Fungi - 108; Plants - 274; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).  |
AT4G39880 | AT4G39880.1 | TTCGGCCCATTAAGGCCCATTAA | ribosomal protein L23 family protein; FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L23/L15e, core (InterPro:IPR012678), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal protein L25/L23 (InterPro:IPR013025); Has 2011 Blast hits to 2011 proteins in 690 species: Archae - 0; Bacteria - 1392; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 592 (source: NCBI BLink).  |
AT4G40040 | AT4G40040.1 | TGAGCCCATTAA | histone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink).  |
AT4G40040.2 | TGAGCCCATTAA | histone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink).  | |
AT4G40042 | AT4G40042.1 | TTAATGGGCTCA | peptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, integral to membrane, signal peptidase complex; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT2G22425.2); Has 218 Blast hits to 218 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 56; Plants - 39; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).  |
AT5G01170 | AT5G01170.1 | CCCATTAA | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF740 (InterPro:IPR008004); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT3G09070.1); Has 822 Blast hits to 767 proteins in 109 species: Archae - 0; Bacteria - 26; Metazoa - 389; Fungi - 59; Plants - 135; Viruses - 31; Other Eukaryotes - 182 (source: NCBI BLink).  |
AT5G01500 | AT5G01500.1 | CCCATTAAG | encodes an ATP/ADP carrier that is located to the thylakoid membrane involved in providing ATP during thylakoid biogenesis and turnover  |
AT5G02050 | AT5G02050.1 | TATGGCCCATTAAGTAATTGGGCCTTAT | mitochondrial glycoprotein family protein / MAM33 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT3G55605.1); Has 329 Blast hits to 328 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 39; Fungi - 94; Plants - 115; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).  |
AT5G02530 | AT5G02530.1 | AAAAGGCCCATTAAG | RNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G59950.4); Has 10734 Blast hits to 7876 proteins in 597 species: Archae - 2; Bacteria - 1111; Metazoa - 4776; Fungi - 1622; Plants - 1564; Viruses - 50; Other Eukaryotes - 1609 (source: NCBI BLink).  |
AT5G02960 | AT5G02960.1 | CTTAATGGGCCTAC | 40S ribosomal protein S23 (RPS23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S23, eukaryotic/archaeal (InterPro:IPR005680), Ribosomal protein S12/S23 (InterPro:IPR006032), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S23 (RPS23A) (TAIR:AT3G09680.1); Has 6124 Blast hits to 6121 proteins in 1817 species: Archae - 180; Bacteria - 2807; Metazoa - 329; Fungi - 198; Plants - 755; Viruses - 0; Other Eukaryotes - 1855 (source: NCBI BLink).  |
AT5G03770 | AT5G03770.1 | TTAATGGGCTTAAGGCC | 3-deoxy-D-manno-octulosonic acid transferase-related; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, carbohydrate metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Three-deoxy-D-manno-octulosonic-acid transferase, N-terminal (InterPro:IPR007507); Has 3832 Blast hits to 3832 proteins in 736 species: Archae - 0; Bacteria - 1449; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 2371 (source: NCBI BLink).  |
AT5G03880 | AT5G03880.1 | TTAAGGCCCAAAAGTAAGGCCCATTAAG | electron carrier; FUNCTIONS IN: electron carrier activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin active site (InterPro:IPR011767), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron carrier/ protein disulfide oxidoreductase (TAIR:AT4G10000.2); Has 401 Blast hits to 305 proteins in 119 species: Archae - 48; Bacteria - 196; Metazoa - 1; Fungi - 33; Plants - 60; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT5G04720 | AT5G04720.1 | TTAATGGG | ADR1-like 2 (ADR1-L2); FUNCTIONS IN: protein binding, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: defense response, apoptosis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Disease resistance, plant (InterPro:IPR014011), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: ADR1-L1 (ADR1-like 1); ATP binding / protein binding (TAIR:AT4G33300.2); Has 16716 Blast hits to 11049 proteins in 439 species: Archae - 24; Bacteria - 1102; Metazoa - 2478; Fungi - 82; Plants - 12542; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink).  |
AT5G04800 | AT5G04800.1 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  |
AT5G04800.2 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  | |
AT5G04800.3 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  | |
AT5G04800.4 | TAGGGCCCATTAA | 40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).  | |
AT5G04810 | AT5G04810.1 | TTAATGGG | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Pentatricopeptide repeat (InterPro:IPR002885), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 31905 Blast hits to 10772 proteins in 409 species: Archae - 7; Bacteria - 279; Metazoa - 3431; Fungi - 1699; Plants - 24118; Viruses - 137; Other Eukaryotes - 2234 (source: NCBI BLink).  |
AT5G05200 | AT5G05200.1 | CGGTTCGGTTTAATGGG | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink).  |
AT5G05210 | AT5G05210.1 | CCCATTAAACCGAACCG | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  |
AT5G05210.2 | CCCATTAAACCGAACCG | nucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).  | |
AT5G05310 | AT5G05310.1 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  |
AT5G05310.2 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  | |
AT5G05310.3 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).  | |
AT5G05670 | AT5G05670.1 | TTAATGGGCTTTTATTCGGCCCATTAA | signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae - 2; Bacteria - 40; Metazoa - 443; Fungi - 156; Plants - 102; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink).  |
AT5G05670.2 | TTAATGGGCTTTTATTCGGCCCATTAA | signal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae - 2; Bacteria - 40; Metazoa - 443; Fungi - 156; Plants - 102; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink).  | |
AT5G05680 | AT5G05680.1 | TTAATGGGCCGAATAAAAGCCCATTAA | nuclear pore complex protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; Has 361 Blast hits to 348 proteins in 84 species: Archae - 2; Bacteria - 20; Metazoa - 218; Fungi - 31; Plants - 27; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).  |
AT5G06260 | AT5G06260.1 | CCCATTAA | nucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink).  |
AT5G06310 | AT5G06310.1 | CGGCCCATTAA | Encodes AtPOT1b. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b.  |
AT5G06360 | AT5G06360.1 | TTAGCCCATTAA | ribosomal protein S8e family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047); Has 361 Blast hits to 360 proteins in 172 species: Archae - 6; Bacteria - 2; Metazoa - 152; Fungi - 111; Plants - 23; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT5G07360 | AT5G07360.1 | CCCATTAA | amidase family protein; FUNCTIONS IN: amidase activity, carbon-nitrogen ligase activity, with glutamine as amido-N-donor; INVOLVED IN: acrylonitrile catabolic process, aldoxime metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amidase signature enzyme (InterPro:IPR000120); BEST Arabidopsis thaliana protein match is: glutamyl-tRNA(Gln) amidotransferase, putative (TAIR:AT3G25660.1); Has 13555 Blast hits to 13547 proteins in 1426 species: Archae - 141; Bacteria - 6093; Metazoa - 496; Fungi - 872; Plants - 207; Viruses - 0; Other Eukaryotes - 5746 (source: NCBI BLink).  |
AT5G07360.2 | CCCATTAA | amidase family protein; FUNCTIONS IN: amidase activity, carbon-nitrogen ligase activity, with glutamine as amido-N-donor; INVOLVED IN: acrylonitrile catabolic process, aldoxime metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amidase signature enzyme (InterPro:IPR000120); BEST Arabidopsis thaliana protein match is: glutamyl-tRNA(Gln) amidotransferase, putative (TAIR:AT3G25660.1); Has 13555 Blast hits to 13547 proteins in 1426 species: Archae - 141; Bacteria - 6093; Metazoa - 496; Fungi - 872; Plants - 207; Viruses - 0; Other Eukaryotes - 5746 (source: NCBI BLink).  | |
AT5G07670 | AT5G07670.1 | CTTAATGGG | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G51380.1); Has 2187 Blast hits to 1299 proteins in 134 species: Archae - 0; Bacteria - 18; Metazoa - 1162; Fungi - 142; Plants - 676; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).  |
AT5G08270 | AT5G08270.1 | CCATTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23200.1); Has 51 Blast hits to 51 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G08540 | AT5G08540.1 | AAAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G08670 | AT5G08670.1 | ATAGGCCCAACTAAGCCCATTAACTAAGCCCAC | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level.  |
AT5G09390 | AT5G09390.1 | TCAGCCCATTAATACGGCCCAATT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).  |
AT5G09390.2 | TCAGCCCATTAATACGGCCCAATT | CD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink).  | |
AT5G09720 | AT5G09720.1 | CCCATTAA | metal ion transmembrane transporter; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-7) (TAIR:AT5G09690.3); Has 239 Blast hits to 235 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 29; Plants - 178; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).  |
AT5G10700 | AT5G10700.1 | TAAAAGCCCATTAAG | aminoacyl-tRNA hydrolase/ protein tyrosine phosphatase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity, protein tyrosine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, translation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833), Protein-tyrosine phosphatase, low molecular weight (InterPro:IPR017867); Has 128 Blast hits to 128 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 81; Fungi - 6; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).  |
AT5G10710 | AT5G10710.1 | CTTAATGGGCTTTTA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G10710.2 | CTTAATGGGCTTTTA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: chromosome segregation, cell division; LOCATED IN: chromosome, centromeric region, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Centromere protein Cenp-O (InterPro:IPR018464); Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G10780 | AT5G10780.1 | TAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  |
AT5G10780.2 | TAAAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).  | |
AT5G11170 | AT5G11170.1 | TTTAGGCCCATTAA | ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus; EXPRESSED IN: guard cell, root, cultured cell; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT5G11200.1); Has 28546 Blast hits to 28139 proteins in 1749 species: Archae - 514; Bacteria - 11832; Metazoa - 5046; Fungi - 3322; Plants - 1384; Viruses - 50; Other Eukaryotes - 6398 (source: NCBI BLink).  |
AT5G11200 | AT5G11200.1 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  |
AT5G11200.2 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  | |
AT5G11200.3 | CTAGGCCCATTAA | DEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, guard cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT5G11170.1).  | |
AT5G11580 | AT5G11580.1 | TTAATGGGCCTATT | UVB-resistance protein-related / regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: chromatin binding, Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15654 Blast hits to 4338 proteins in 271 species: Archae - 65; Bacteria - 1617; Metazoa - 6245; Fungi - 716; Plants - 1411; Viruses - 0; Other Eukaryotes - 5600 (source: NCBI BLink).  |
AT5G12290 | AT5G12290.1 | TACTGGGCCCATTAAAAGCCCAATAAG | Encodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background.  |
AT5G13190 | AT5G13190.1 | AAAAGGCCCATTAAG | INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: LPS-induced tumor necrosis factor alpha factor (InterPro:IPR006629); Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G13790 | AT5G13790.1 | CCCATTAA | AGL15 (AGAMOUS-Like 15) is a member of the MADS domain family of regulatory factors. Although AGL15 is preferentially expressed during embryogenesis, AGL15 is also expressed in leaf primordia, shoot apical meristems and young floral buds, suggesting that AGL15 may play a role during post-germinative development. Transgenic plants that ectopically express AGL15 show delays in the transition to flowering, perianth abscission and senescence and fruit and seed maturation.  |
AT5G14030 | AT5G14030.1 | TTAATGGG | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT5G14030.2 | TTAATGGG | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14030.3 | TTAATGGG | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14030.4 | TTAATGGG | translocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  | |
AT5G14040 | AT5G14040.1 | TTAATGGG | mitochondrial phosphate transporter; FUNCTIONS IN: binding; INVOLVED IN: transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial phosphate transporter, putative (TAIR:AT3G48850.1); Has 12348 Blast hits to 8451 proteins in 336 species: Archae - 0; Bacteria - 0; Metazoa - 6294; Fungi - 3202; Plants - 1869; Viruses - 3; Other Eukaryotes - 980 (source: NCBI BLink).  |
AT5G14050 | AT5G14050.1 | CCCATTAA | transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: TAF5 (TBP-ASSOCIATED FACTOR 5); nucleotide binding / transcription regulator (TAIR:AT5G25150.1); Has 4822 Blast hits to 3684 proteins in 283 species: Archae - 24; Bacteria - 1509; Metazoa - 1460; Fungi - 771; Plants - 200; Viruses - 2; Other Eukaryotes - 856 (source: NCBI BLink).  |
AT5G15020 | AT5G15020.1 | TTAATGGGCCTAAT | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190).  |
AT5G16140 | AT5G16140.1 | TAAGCCCATTAA | peptidyl-tRNA hydrolase family protein; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G38290.2); Has 5393 Blast hits to 5390 proteins in 1416 species: Archae - 0; Bacteria - 2886; Metazoa - 37; Fungi - 45; Plants - 77; Viruses - 0; Other Eukaryotes - 2348 (source: NCBI BLink).  |
AT5G16140.2 | TAAGCCCATTAA | peptidyl-tRNA hydrolase family protein; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G38290.2); Has 5393 Blast hits to 5390 proteins in 1416 species: Archae - 0; Bacteria - 2886; Metazoa - 37; Fungi - 45; Plants - 77; Viruses - 0; Other Eukaryotes - 2348 (source: NCBI BLink).  | |
AT5G16480 | AT5G16480.1 | CCCATTAA | tyrosine specific protein phosphatase family protein; FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, phosphoprotein phosphatase activity; INVOLVED IN: dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Protein-tyrosine phosphatase, SIW14-like (InterPro:IPR004861); BEST Arabidopsis thaliana protein match is: phosphatase/ phosphoprotein phosphatase/ protein tyrosine phosphatase (TAIR:AT3G02800.1); Has 465 Blast hits to 450 proteins in 106 species: Archae - 0; Bacteria - 41; Metazoa - 7; Fungi - 250; Plants - 83; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).  |
AT5G17190 | AT5G17190.1 | AATAGGCCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G17210 | AT5G17210.1 | TTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13380.1); Has 229 Blast hits to 225 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 229; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G17210.2 | TTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13380.1); Has 229 Blast hits to 225 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 229; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G17230 | AT5G17230.1 | TTAATGGGTCAAA | Encodes phytoene synthase.  |
AT5G17230.2 | TTAATGGGTCAAA | Encodes phytoene synthase.  | |
AT5G17230.3 | TTAATGGGTCAAA | Encodes phytoene synthase.  | |
AT5G17550 | AT5G17550.1 | CTTAATGGGCTTT | PEX19-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome; CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); BEST Arabidopsis thaliana protein match is: PEX19-1 (peroxin 19-1) (TAIR:AT3G03490.1); Has 291 Blast hits to 285 proteins in 122 species: Archae - 0; Bacteria - 4; Metazoa - 130; Fungi - 93; Plants - 19; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).  |
AT5G17560 | AT5G17560.1 | AAAGCCCATTAAG | BolA-like family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BolA-like protein (InterPro:IPR002634); BEST Arabidopsis thaliana protein match is: BolA-like family protein (TAIR:AT1G55805.1); Has 1368 Blast hits to 1368 proteins in 267 species: Archae - 2; Bacteria - 509; Metazoa - 31; Fungi - 15; Plants - 67; Viruses - 0; Other Eukaryotes - 744 (source: NCBI BLink).  |
AT5G18150 | AT5G18150.1 | CCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14602.1); Has 25 Blast hits to 25 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G18790 | AT5G18790.1 | TTAATGGGCCGAA | ribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT3G06320.1); Has 1786 Blast hits to 1786 proteins in 750 species: Archae - 0; Bacteria - 1570; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink).  |
AT5G18800 | AT5G18800.1 | TTCGGCCCATTAA | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 73; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G18800.2 | TTCGGCCCATTAA | NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 73; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  | |
AT5G19240 | AT5G19240.1 | CTTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19230.1); Has 42 Blast hits to 41 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G19300 | AT5G19300.1 | TGAGGCCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Protein of unknown function DUF171 (InterPro:IPR003750); Has 4766 Blast hits to 2044 proteins in 217 species: Archae - 72; Bacteria - 102; Metazoa - 2264; Fungi - 372; Plants - 195; Viruses - 4; Other Eukaryotes - 1757 (source: NCBI BLink).  |
AT5G20120 | AT5G20120.1 | TTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 36 Blast hits to 36 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  |
AT5G20160 | AT5G20160.1 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  |
AT5G20160.2 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G20160.3 | CCAGGCCCATTAA | ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  | |
AT5G20170 | AT5G20170.1 | TTTTGGGCTTTTAATGGGCTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 35; Fungi - 3; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G20180 | AT5G20180.1 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
AT5G20180.1 | TTAATGGG | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  | |
AT5G20180.2 | TAAAGCCCATTAAAAGCCCAAAA | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  | |
AT5G20180.2 | TTAATGGG | ribosomal protein L36 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36 (InterPro:IPR000473); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00760.1); Has 2593 Blast hits to 2593 proteins in 1117 species: Archae - 0; Bacteria - 1934; Metazoa - 39; Fungi - 51; Plants - 452; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  | |
AT5G23200 | AT5G23200.1 | TTTAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).  |
AT5G23260 | AT5G23260.1 | CCCATTAA | Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule.  |
AT5G23260.2 | CCCATTAA | Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule.  | |
AT5G23260.3 | CCCATTAA | Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule.  | |
AT5G23630 | AT5G23630.1 | TTAATGGG | A novel member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure.  |
AT5G23630.1 | TTAATGGGCTA | A novel member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure.  | |
AT5G24230 | AT5G24230.1 | CCCATTAA | LOCATED IN: cellular_component unknown; EXPRESSED IN: root; BEST Arabidopsis thaliana protein match is: triacylglycerol lipase (TAIR:AT5G24200.1); Has 125 Blast hits to 125 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 7; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G24830 | AT5G24830.1 | TTAATGGGCCATAGCCCAAAA | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 22335 Blast hits to 5701 proteins in 178 species: Archae - 6; Bacteria - 14; Metazoa - 418; Fungi - 405; Plants - 20611; Viruses - 0; Other Eukaryotes - 881 (source: NCBI BLink).  |
AT5G24840 | AT5G24840.1 | GAAGCCCATTAAG | tRNA (guanine-N7-)-methyltransferase; FUNCTIONS IN: tRNA (guanine-N7-)-methyltransferase activity; INVOLVED IN: acetate biosynthetic process from carbon monoxide, methanol oxidation, tRNA modification; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA (guanine-N-7) methyltransferase (InterPro:IPR003358); BEST Arabidopsis thaliana protein match is: tRNA (guanine-N7-)-methyltransferase (TAIR:AT5G17660.1); Has 3254 Blast hits to 3250 proteins in 1207 species: Archae - 0; Bacteria - 2194; Metazoa - 104; Fungi - 94; Plants - 68; Viruses - 0; Other Eukaryotes - 794 (source: NCBI BLink).  |
AT5G24970 | AT5G24970.1 | TTAATGGGCCTGA | ABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink).  |
AT5G24980 | AT5G24980.1 | TCAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G25070 | AT5G25070.1 | TTAAGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 81684 Blast hits to 44791 proteins in 1880 species: Archae - 1252; Bacteria - 11295; Metazoa - 39436; Fungi - 6166; Plants - 3117; Viruses - 367; Other Eukaryotes - 20051 (source: NCBI BLink).  |
AT5G25080 | AT5G25080.1 | TTAATGGGCCTTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146), Exosome-associated factor Rrp47/DNA strand repair C1D (InterPro:IPR011082); Has 137 Blast hits to 137 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 42; Plants - 16; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT5G26360 | AT5G26360.1 | TTAATGGGCCTTAG | chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, gamma subunit (InterPro:IPR012719), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G11830.1); Has 12411 Blast hits to 12269 proteins in 2241 species: Archae - 394; Bacteria - 5329; Metazoa - 1841; Fungi - 951; Plants - 480; Viruses - 2; Other Eukaryotes - 3414 (source: NCBI BLink).  |
AT5G27620 | AT5G27620.1 | TTAATGGG | core cell cycle genes  |
AT5G27710 | AT5G27710.1 | CTTAATGGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G35360 | AT5G35360.1 | CTTAATGGGCTTTAT | Encodes biotin carboxylase subunit (CAC2).  |
AT5G35360.2 | CTTAATGGGCTTTAT | Encodes biotin carboxylase subunit (CAC2).  | |
AT5G39210 | AT5G39210.1 | GTGGCCCATTAA | Encodes a protein of the chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved in respiration, photosystem I (PSI) cyclic electron transport and CO2 uptake. The product of this gene appears to be essential for the stable formation of the NDH Complex.  |
AT5G40370 | AT5G40370.1 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink).  |
AT5G40370.2 | CAAGGCCCAATAAAGCCCATTAA | glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G63030.1); Has 4824 Blast hits to 4814 proteins in 838 species: Archae - 0; Bacteria - 2010; Metazoa - 439; Fungi - 264; Plants - 472; Viruses - 0; Other Eukaryotes - 1639 (source: NCBI BLink).  | |
AT5G40770 | AT5G40770.1 | TTGGCCCATTAA | prohibitin 3  |
AT5G40810 | AT5G40810.1 | ATAGGCCCTTAATGGGCTTTTA | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink).  |
AT5G40810.2 | ATAGGCCCTTAATGGGCTTTTA | cytochrome c1, putative; FUNCTIONS IN: electron carrier activity, iron ion binding, heme binding, electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex activity; LOCATED IN: mitochondrial respiratory chain, mitochondrion, vacuole, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c1 (InterPro:IPR002326), Cytochrome c, monohaem (InterPro:IPR009056); BEST Arabidopsis thaliana protein match is: cytochrome c1, putative (TAIR:AT3G27240.1); Has 2945 Blast hits to 2945 proteins in 515 species: Archae - 0; Bacteria - 722; Metazoa - 171; Fungi - 166; Plants - 63; Viruses - 0; Other Eukaryotes - 1823 (source: NCBI BLink).  | |
AT5G41520 | AT5G41520.1 | TTAGCCCATTAA | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink).  |
AT5G41520.2 | TTAATGGG | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink).  | |
AT5G41520.2 | TTAGCCCATTAA | 40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink).  | |
AT5G41940 | AT5G41940.1 | AAGGCCCATTAA | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3483 Blast hits to 2868 proteins in 186 species: Archae - 2; Bacteria - 83; Metazoa - 1894; Fungi - 490; Plants - 337; Viruses - 5; Other Eukaryotes - 672 (source: NCBI BLink).  |
AT5G41960 | AT5G41960.1 | GGCTTTAACGGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G42790 | AT5G42790.1 | GAAGCCCATTAA | encodes a protein with extensive homology to the largest subunit of the multicatalytic proteinase complex (proteasome)  |
AT5G43060 | AT5G43060.1 | TAGCCCATTAA | cysteine proteinase, putative / thiol protease, putative; FUNCTIONS IN: cysteine-type peptidase activity, cysteine-type endopeptidase activity; INVOLVED IN: response to salt stress; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Granulin (InterPro:IPR000118), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: RD21 (responsive to dehydration 21); cysteine-type endopeptidase/ cysteine-type peptidase (TAIR:AT1G47128.1); Has 7000 Blast hits to 6290 proteins in 593 species: Archae - 25; Bacteria - 79; Metazoa - 3655; Fungi - 4; Plants - 1235; Viruses - 122; Other Eukaryotes - 1880 (source: NCBI BLink).  |
AT5G44320 | AT5G44320.1 | AAAAGCCCATTGAGGCCCATTAAG | eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT4G20980.3); Has 341 Blast hits to 337 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 40; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  |
AT5G45775 | AT5G45775.1 | ATTGGCCCATTAA | 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).  |
AT5G45775.2 | ATTGGCCCATTAA | 60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).  | |
AT5G45990 | AT5G45990.1 | TTTAGGCCCATTAAG | crooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink).  |
AT5G47110 | AT5G47110.1 | CAAAGCCCATTAA | lil3 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis, light harvesting; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LIL3:1; transcription factor (TAIR:AT4G17600.1); Has 51 Blast hits to 51 proteins in 19 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  |
AT5G47210 | AT5G47210.1 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  |
AT5G47210.1 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  | |
AT5G47210.2 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  | |
AT5G47210.2 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  | |
AT5G47210.3 | TTAATGGGCTTA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  | |
AT5G47210.3 | TTAATGGGCTTTAA | nuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT4G17520.1); Has 18320 Blast hits to 10363 proteins in 904 species: Archae - 11; Bacteria - 4859; Metazoa - 6001; Fungi - 1554; Plants - 1660; Viruses - 232; Other Eukaryotes - 4003 (source: NCBI BLink).  | |
AT5G47860 | AT5G47860.1 | GTGGCCCATTAAG | unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1350 (InterPro:IPR010765); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43540.1); Has 289 Blast hits to 289 proteins in 66 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).  |
AT5G47880 | AT5G47880.1 | TACTGGGCTTAGGCCCATTAA | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.  |
AT5G47880.1 | TTCGGCCCATTAAG | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.  | |
AT5G47880.2 | TACTGGGCTTAGGCCCATTAA | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.  | |
AT5G47880.2 | TTCGGCCCATTAAG | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.  | |
AT5G48710 | AT5G48710.1 | TCAGCCCATTAAGGCCCAACT | ubiquitin-related; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin-related (TAIR:AT5G48700.1); Has 703 Blast hits to 702 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 438; Fungi - 87; Plants - 102; Viruses - 1; Other Eukaryotes - 75 (source: NCBI BLink).  |
AT5G49000 | AT5G49000.1 | ATAAGGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink).  |
AT5G49000.2 | ATAAGGCCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39550.1); Has 5235 Blast hits to 3308 proteins in 165 species: Archae - 10; Bacteria - 167; Metazoa - 4114; Fungi - 13; Plants - 659; Viruses - 110; Other Eukaryotes - 162 (source: NCBI BLink).  | |
AT5G50810 | AT5G50810.1 | TGTTGGGCTTTTAATGGG | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.  |
AT5G50960 | AT5G50960.1 | CTTAATGGGCTTTAT | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal.  |
AT5G52820 | AT5G52820.1 | TTCGGCCCATTAATTAAAGGC | WD-40 repeat family protein / notchless protein, putative; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), G-protein, beta subunit (InterPro:IPR001632); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 92804 Blast hits to 28593 proteins in 717 species: Archae - 60; Bacteria - 7422; Metazoa - 44321; Fungi - 18160; Plants - 9806; Viruses - 6; Other Eukaryotes - 13029 (source: NCBI BLink).  |
AT5G52840 | AT5G52840.1 | ATTAGGCCCATTAA | NADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, chloroplast, respiratory chain complex I, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ETC complex I subunit (InterPro:IPR006806); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28005.1); Has 272 Blast hits to 272 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 69; Plants - 31; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).  |
AT5G54600 | AT5G54600.1 | TAGCCCATTAAG | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink).  |
AT5G54600.2 | TAGCCCATTAAG | 50S ribosomal protein L24, chloroplast (CL24); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), Ribosomal protein L24 (InterPro:IPR003256), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: KOW domain-containing protein (TAIR:AT5G23535.1); Has 4980 Blast hits to 4980 proteins in 1459 species: Archae - 0; Bacteria - 2986; Metazoa - 111; Fungi - 16; Plants - 68; Viruses - 0; Other Eukaryotes - 1799 (source: NCBI BLink).  | |
AT5G54660 | AT5G54660.1 | CCCATTAA | heat shock protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I small heat shock protein (HSP17.6C-CI) (AA 1-156) (TAIR:AT1G53540.1); Has 528 Blast hits to 528 proteins in 75 species: Archae - 0; Bacteria - 15; Metazoa - 0; Fungi - 34; Plants - 464; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).  |
AT5G54940 | AT5G54940.1 | CTTAATGGGCCTAC | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink).  |
AT5G54940.2 | CTTAATGGGCCTAC | eukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT4G27130.1); Has 638 Blast hits to 635 proteins in 210 species: Archae - 21; Bacteria - 4; Metazoa - 295; Fungi - 105; Plants - 120; Viruses - 3; Other Eukaryotes - 90 (source: NCBI BLink).  | |
AT5G55160 | AT5G55160.1 | AGCCCATTTGAGCCCATTAAG | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays.  |
AT5G55160.2 | AGCCCATTTGAGCCCATTAAG | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays.  | |
AT5G55610 | AT5G55610.1 | TTAATGGGCCTTAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G55610.2 | TTAATGGGCCTTAA | unknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT5G55670 | AT5G55670.1 | TGAGCCCATTAA | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G13190.1); Has 39714 Blast hits to 21553 proteins in 936 species: Archae - 21; Bacteria - 7210; Metazoa - 18978; Fungi - 3959; Plants - 3841; Viruses - 192; Other Eukaryotes - 5513 (source: NCBI BLink).  |
AT5G56050 | AT5G56050.1 | CCCATTAAG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26490.1); Has 322 Blast hits to 322 proteins in 28 species: Archae - 0; Bacteria - 8; Metazoa - 10; Fungi - 1; Plants - 299; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G56120 | AT5G56120.1 | TTCGGCCCATTAAAGGCCCAAAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12870.1); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G56710 | AT5G56710.1 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  |
AT5G56710.2 | AATAGGCCCATTAAAGCCCAAT | 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  | |
AT5G56900 | AT5G56900.1 | GAAGCCCATTAAG | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  |
AT5G56900.2 | GAAGCCCATTAAG | CwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).  | |
AT5G56910 | AT5G56910.1 | CTTAATGGGCTTC | INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56920.1); Has 34 Blast hits to 34 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G57120 | AT5G57120.1 | CCCATTAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: LisH dimerisation motif (InterPro:IPR006594), SRP40, C-terminal (InterPro:IPR007718); Has 90949 Blast hits to 45608 proteins in 1620 species: Archae - 300; Bacteria - 8281; Metazoa - 37603; Fungi - 8095; Plants - 3374; Viruses - 548; Other Eukaryotes - 32748 (source: NCBI BLink).  |
AT5G57815 | AT5G57815.1 | TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA | cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  |
AT5G57930 | AT5G57930.1 | GCCCATTAAAGGCCCATTAT | ACCUMULATION OF PHOTOSYSTEM ONE 2  |
AT5G57930.2 | GCCCATTAAAGGCCCATTAT | ACCUMULATION OF PHOTOSYSTEM ONE 2  | |
AT5G58130 | AT5G58130.1 | TAAAAGCCCATTAAG | RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G50690.1); Has 13214 Blast hits to 6289 proteins in 622 species: Archae - 145; Bacteria - 5890; Metazoa - 2525; Fungi - 1196; Plants - 360; Viruses - 129; Other Eukaryotes - 2969 (source: NCBI BLink).  |
AT5G58140 | AT5G58140.1 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.  |
AT5G58140.2 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.  | |
AT5G58140.3 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.  | |
AT5G58140.4 | CTTAATGGGCTTTTA | Membrane-bound protein serine/threonine kinase that functions as blue light photoreceptor in redundancy with PHO1. Involved in stomatal opening, chloroplast movement and phototropism. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT2 possesses two LOV (LOV1 and LOV2, for light-oxygen-voltage-sensing) domains involved in FMN-binding and a C-terminus forming a serine/threonine kinase domain. LOV2 acts as an inhibitor of phototropin kinase in the dark, and light cancels the inhibition through cysteine-FMN adduct formation. LOV1 in contrast acts as an attenuator of photoactivation. Localized to the Golgi apparatus under the induction of blue light.  | |
AT5G58590 | AT5G58590.1 | GGGCCTTAATGGGCTTA | Encodes a Ran-binding protein 1 homolog (RanBP1).  |
AT5G58710 | AT5G58710.1 | TTAATGGGCT | Encodes cyclophilin ROC7.  |
AT5G58950 | AT5G58950.1 | TTAATGGGCCGAA | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G46930.1); Has 97287 Blast hits to 95864 proteins in 3755 species: Archae - 57; Bacteria - 8154; Metazoa - 43395; Fungi - 8207; Plants - 19435; Viruses - 506; Other Eukaryotes - 17533 (source: NCBI BLink).  |
AT5G59613 | AT5G59613.1 | TAGCCCATTAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial respiratory chain complex III; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46430.1); Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G59970 | AT5G59970.1 | ATAACCGGCCCATTAA | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59690.1); Has 2716 Blast hits to 2716 proteins in 361 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 282; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).  |
AT5G61240 | AT5G61240.1 | CCCATTAA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G13910.1); Has 54870 Blast hits to 18308 proteins in 781 species: Archae - 35; Bacteria - 3366; Metazoa - 15390; Fungi - 767; Plants - 32078; Viruses - 0; Other Eukaryotes - 3234 (source: NCBI BLink).  |
AT5G61240.1 | CCCATTAA | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G13910.1); Has 54870 Blast hits to 18308 proteins in 781 species: Archae - 35; Bacteria - 3366; Metazoa - 15390; Fungi - 767; Plants - 32078; Viruses - 0; Other Eukaryotes - 3234 (source: NCBI BLink).  | |
AT5G61840 | AT5G61840.1 | GCCCATTAAATAATGGGCT | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
AT5G62430 | AT5G62430.1 | TTAATGGG | Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon.  |
AT5G64740 | AT5G64740.1 | TTAATGGGTCCCAC | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles.  |
AT5G65110 | AT5G65110.1 | CTTAATGGGCCAC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis.  |
AT5G65110.2 | CTTAATGGGCCAC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis.  | |
AT5G65260 | AT5G65260.1 | AATTGGGCCTTATTAGGCCCATTAAG | polyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G10350.1); Has 5533 Blast hits to 5115 proteins in 414 species: Archae - 6; Bacteria - 543; Metazoa - 2461; Fungi - 1041; Plants - 837; Viruses - 0; Other Eukaryotes - 645 (source: NCBI BLink).  |
AT5G65270 | AT5G65270.1 | CTTAATGGGCCTAATAAGGCCCAATT | Arabidopsis Rab GTPase homolog A4a (AtRABA4a); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: RABA4B (RAB GTPASE HOMOLOG A4B); GTP binding (TAIR:AT4G39990.1); Has 23029 Blast hits to 22998 proteins in 639 species: Archae - 17; Bacteria - 108; Metazoa - 12691; Fungi - 2978; Plants - 2157; Viruses - 19; Other Eukaryotes - 5059 (source: NCBI BLink).  |
AT5G65660 | AT5G65660.1 | TTAATGGG | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 31 Blast hits to 31 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).  |
AT5G65950 | AT5G65950.1 | CCCATTAAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT5G66140 | AT5G66140.1 | TTAATGGGCCTGT | Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation.  |
AT5G66450 | AT5G66450.1 | TTAATGGGCTTTTA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  |
AT5G66450.2 | TTAATGGGCTTTTA | phosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT3G50920.1); Has 208 Blast hits to 208 proteins in 96 species: Archae - 0; Bacteria - 6; Metazoa - 67; Fungi - 59; Plants - 45; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).  | |
AT5G66590 | AT5G66590.1 | TTAATGGGCCTGA | allergen V5/Tpx-1-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related (InterPro:IPR001283), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: allergen V5/Tpx-1-related family protein (TAIR:AT5G57625.1); Has 1763 Blast hits to 1704 proteins in 235 species: Archae - 0; Bacteria - 47; Metazoa - 893; Fungi - 192; Plants - 589; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).  |
AT5G66680 | AT5G66680.1 | TAAGCCCATTAA | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins.  |
AT5G66700 | AT5G66700.1 | CCCATTAA | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development.  |
AT5G67070 | AT5G67070.1 | TGGCCCATTAA | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.  |
AT5G67100 | AT5G67100.1 | GTAAGGCCCATTAAG | Encodes the putative catalytic subunit of the DNA polymerase alpha. Interacts with genes involved in chromatin-mediated cellular memory. ICU2 genetically interacts with TERMINAL FLOWER2, the ortholog of HETEROCHROMATIN PROTEIN1 of animals and yeasts, and with the Polycomb group (PcG) gene CURLY LEAF. A number of regulatory genes were derepressed in the icu2-1 mutant, including genes associated with flowering time, floral meristem, and floral organ identity. Mutant has curled, involute leaves and causes early flowering.  |
AT5G67150 | AT5G67150.1 | TTAATGGGCTTA | transferase family protein; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G50280.1); Has 1367 Blast hits to 1362 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 151; Plants - 1216; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
ATCG00340 | ATCG00340.1 | TTAATGGG | Encodes the D1 subunit of photosystem I and II reaction centers.  |
ATMG00070 | ATMG00070.1 | TTAATGGG | NADH dehydrogenase subunit 9  |