version

Summary of AtREG401 (All List)

OrganismArabidopsis thaliana  
IDAtREG401  
SequenceAACGGGCC  
Annotation  
PPDB MotifAAACG(C/G)  function unknown  
ACGGGC  function unknown  
CCAACGG  function unknown  
PLACE MotifGGGCC  one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);  
Total Entry Count95  

Entry Sequences (95 entries)

LocusGene modelSequenceDescription
AT1G04070AT1G04070.1GGCCCGTTASubunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. 
AT1G04080AT1G04080.1TAACGGGCCPRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink). 
AT1G09590AT1G09590.1ACAGGCCCGTTA60S ribosomal protein L21 (RPL21A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, chloroplast; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21C) (TAIR:AT1G09690.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). 
AT1G10910AT1G10910.1TATGGCCCGTTAINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink). 
AT1G13220AT1G13220.1TAACGGGCCEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. 
AT1G13220.2TAACGGGCCEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. 
AT1G15270AT1G15270.1TTTAACGGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT1G15280AT1G15280.1TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). 
AT1G15280.2TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). 
AT1G25260AT1G25260.1AACGGGCCacidic ribosomal protein P0-related; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 809 Blast hits to 807 proteins in 249 species: Archae - 78; Bacteria - 0; Metazoa - 294; Fungi - 172; Plants - 102; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink). 
AT1G27310AT1G27310.1TAACGGGCCCAACTEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. 
AT1G29060AT1G29060.1ATCGGCCCGTTAAAAAAGCCCATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G33120AT1G33120.1TTTAACGGGCCATGGGCTTAT60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). 
AT1G56440AT1G56440.1AACGGGCCGGTTTATserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink). 
AT1G56450AT1G56450.1ATAAACCGGCCCGTT20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds 
AT1G64510AT1G64510.1AACGGGCCTTTAACAGGCCCAATAAribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: thylakoid, chloroplast thylakoid membrane, ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 978 Blast hits to 978 proteins in 282 species: Archae - 0; Bacteria - 578; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink). 
AT1G64520AT1G64520.1TTATTGGGCCTGTTAAAGGCCCGTTRegulatory Particle non-ATPase 12a (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: RPN12b (Regulatory Particle Non-ATPase 12b); peptidase (TAIR:AT5G42040.1); Has 353 Blast hits to 353 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 84; Plants - 39; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). 
AT1G64680AT1G64680.1AACGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03055.1); Has 64 Blast hits to 64 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G65150AT1G65150.1TTTAGGCCCGTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT1G65150.2TTTAGGCCCGTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT1G65280AT1G65280.1GGGCCTAAACGGGCCTTTAheat shock protein binding; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G22080.1); Has 22647 Blast hits to 16088 proteins in 1412 species: Archae - 102; Bacteria - 2761; Metazoa - 9875; Fungi - 2142; Plants - 1453; Viruses - 33; Other Eukaryotes - 6281 (source: NCBI BLink). 
AT1G75870AT1G75870.1AAAAGGCCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G76940AT1G76940.1AACGGGCCGGGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT2G03150AT2G03150.1AACGGGCCTATAembryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink). 
AT2G03150.1TAACGGGCCembryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink). 
AT2G03430AT2G03430.1AAAAGGCCCATAAACGGGCCCAATATankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink). 
AT2G04410AT2G04410.1TAACGGGCCCATTAAGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G23090AT2G23090.1TTTAACGGGCCTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1909 (InterPro:IPR015023); Has 104 Blast hits to 104 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 33; Plants - 46; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT2G37660AT2G37660.1TCAGGCCCGTTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, apoplast, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 1711 Blast hits to 1685 proteins in 445 species: Archae - 20; Bacteria - 1147; Metazoa - 3; Fungi - 23; Plants - 245; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink). 
AT2G44920AT2G44920.1AACGGGCCTTTTthylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink). 
AT2G44920.2AACGGGCCTTTTthylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink). 
AT2G47250AT2G47250.1TAACGGGCCTTGRNA helicase, putative; FUNCTIONS IN: in 7 functions; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT3G62310.1); Has 7386 Blast hits to 6689 proteins in 1000 species: Archae - 0; Bacteria - 1927; Metazoa - 2123; Fungi - 842; Plants - 395; Viruses - 601; Other Eukaryotes - 1498 (source: NCBI BLink). 
AT3G02660AT3G02660.1TTTAACGGGCCGTAEMBRYO DEFECTIVE 2768 (emb2768); FUNCTIONS IN: RNA binding, tyrosine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), RNA-binding S4 (InterPro:IPR002942), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6358 Blast hits to 6354 proteins in 1524 species: Archae - 11; Bacteria - 2982; Metazoa - 99; Fungi - 101; Plants - 19; Viruses - 0; Other Eukaryotes - 3146 (source: NCBI BLink). 
AT3G05060AT3G05060.1AACGGGCCSAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein 
AT3G05070AT3G05070.1GGCCCGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink). 
AT3G06680AT3G06680.1AACGGGCCTAAG60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G06680.2AACGGGCCTAAG60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G08780AT3G08780.1TAACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G08780.2TAACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G14290AT3G14290.1TTAAGGCCCGTTEncodes 20S proteasome subunit PAE2 (PAE2). 
AT3G15280AT3G15280.1AACGGGCCunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G15290AT3G15290.1GGCCCGTT3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink). 
AT3G18100AT3G18100.1CCCGGCCCGTTMember of the R2R3 transcription factor gene family. 
AT3G25800AT3G25800.1TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit 
AT3G25800.2TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit 
AT3G28455AT3G28455.1AACGGGCCCATATMember of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. 
AT3G47610AT3G47610.1TTTAGGCCCGTTtranscription regulator/ zinc ion binding; FUNCTIONS IN: transcription regulator activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2HC5-type (InterPro:IPR009349); Has 247 Blast hits to 233 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 80; Plants - 16; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT3G53970AT3G53970.1TTAAGGCCCGTTproteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink). 
AT3G53970.2TTAAGGCCCGTTproteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink). 
AT3G63370AT3G63370.1AACGGGCCCTApentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16480 Blast hits to 4859 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 46; Plants - 16142; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink). 
AT4G00058AT4G00058.1CAATGGGCTCAAGCCCAGGCCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown. 
AT4G03280AT4G03280.1ATTGGCCCGTTEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. 
AT4G03280.2ATTGGCCCGTTEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. 
AT4G11380AT4G11380.1ATCGGCCCGTTAbeta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink). 
AT4G13940AT4G13940.1GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. 
AT4G13940.2GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. 
AT4G13940.3GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. 
AT4G13940.4GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. 
AT4G15010AT4G15010.1TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). 
AT4G15010.2TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). 
AT4G15010.3TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink). 
AT4G15020AT4G15020.1AACGGGCCGGGTCGADNA binding / protein dimerization; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G22220.2); Has 326 Blast hits to 324 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 323; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT4G15020.2AACGGGCCGGGTCGADNA binding / protein dimerization; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G22220.2); Has 326 Blast hits to 324 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 323; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT4G17510AT4G17510.1CCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). 
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). 
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). 
AT4G17520AT4G17520.1TAACGGGCCCGGCCCAATAAnuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 13357 Blast hits to 8375 proteins in 750 species: Archae - 13; Bacteria - 2605; Metazoa - 5274; Fungi - 1340; Plants - 1789; Viruses - 136; Other Eukaryotes - 2200 (source: NCBI BLink). 
AT4G23820AT4G23820.1TATGGCCCGTTglycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G41870.1); Has 2405 Blast hits to 2400 proteins in 312 species: Archae - 2; Bacteria - 563; Metazoa - 8; Fungi - 896; Plants - 841; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). 
AT4G23840AT4G23840.1AACGGGCCATAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G15740.1); Has 7635 Blast hits to 5145 proteins in 376 species: Archae - 2; Bacteria - 2863; Metazoa - 1987; Fungi - 78; Plants - 1868; Viruses - 40; Other Eukaryotes - 797 (source: NCBI BLink). 
AT4G25050AT4G25050.1AGATGGGCCCGTTencodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. 
AT4G25210AT4G25210.1GTTAGGCCCGTTtranscription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00130.1); Has 5777 Blast hits to 3070 proteins in 342 species: Archae - 2; Bacteria - 508; Metazoa - 1816; Fungi - 705; Plants - 351; Viruses - 71; Other Eukaryotes - 2324 (source: NCBI BLink). 
AT4G32680AT4G32680.1ATTGGCCCGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G32690AT4G32690.1TAACGGGCCAATEncodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. 
AT4G34960AT4G34960.1TTTAGGCCCGTTApeptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP5 (CYCLOPHILIN 5); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G29960.1); Has 11230 Blast hits to 11218 proteins in 1505 species: Archae - 82; Bacteria - 3582; Metazoa - 2365; Fungi - 952; Plants - 729; Viruses - 4; Other Eukaryotes - 3516 (source: NCBI BLink). 
AT4G35800AT4G35800.1AGGCCCGTTAEncodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. 
AT5G10630AT5G10630.1TATAGGCCCGTTAAAAGCCCAACAelongation factor 1-alpha, putative / EF-1-alpha, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Zinc finger, RanBP2-type (InterPro:IPR001876), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: EF-1-alpha-related GTP-binding protein, putative (TAIR:AT1G18070.2); Has 58110 Blast hits to 58057 proteins in 13368 species: Archae - 652; Bacteria - 20622; Metazoa - 14216; Fungi - 8620; Plants - 1274; Viruses - 3; Other Eukaryotes - 12723 (source: NCBI BLink). 
AT5G11240AT5G11240.1ATAAGGCCCGTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink). 
AT5G14220AT5G14220.1CAAAGGCCCGTTAEncodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. 
AT5G14680AT5G14680.1CAATGGGCCCGTTuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G01520.1); Has 1288 Blast hits to 1284 proteins in 330 species: Archae - 88; Bacteria - 759; Metazoa - 35; Fungi - 21; Plants - 361; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT5G15200AT5G15200.1TCAAAACGGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT5G15200.2TCAAAACGGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT5G16550AT5G16550.1AACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT5G25475AT5G25475.1TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G25475.2TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G25475.3TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G38830AT5G38830.1CTTAGGCCCGTTtRNA synthetase class I (C) family protein; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, cysteinyl-tRNA aminoacylation; LOCATED IN: cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT3G56300.1); Has 8148 Blast hits to 7899 proteins in 1622 species: Archae - 141; Bacteria - 3284; Metazoa - 371; Fungi - 182; Plants - 67; Viruses - 3; Other Eukaryotes - 4100 (source: NCBI BLink). 
AT5G43600AT5G43600.1AACGGGCCTCTEncodes a protein that is 27% identical and 43% similar to the E. coli allantoate amidohydrolase. In vitro assays with purified protein and allantoate as a substrate do not show any increase in ammonium concentration, no AAH activity. 
AT5G48375AT5G48375.1TAACGGGCCIs a myrosinase pseudogene that codes for a truncated and frameshifted protein. Although TGG3 apparently is a pseudogene, its mRNA is expressed specifically in stamen and petal according to RT-PCR analysis. Western analysis shows no band of the size expected for a TGG3 protein. 
AT5G51340AT5G51340.1AACGGGCCTAAATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 96 proteins in 39 species: Archae - 0; Bacteria - 2; Metazoa - 115; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G51700AT5G51700.1ATTTGGGCCGAGGCCCGTTEncodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. 
AT5G64440AT5G64440.1TAACGGGCCAtFAAH (fatty acid amide hydrolase) modulates endogenous NAEs (N-Acylethanolamines) levels in plants by hydrolyzing NAEs to ethanolamine and their corresponding free fatty acids. NAE depletion likely participates in the regulation of plant growth. 
AT5G65950AT5G65950.1CAAAGGCCCGTTAAAAGCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT5G65950.1TTAAAGGCCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT5G66080AT5G66080.1TAACGGGCCATAprotein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3605 Blast hits to 3604 proteins in 217 species: Archae - 0; Bacteria - 11; Metazoa - 1260; Fungi - 366; Plants - 1225; Viruses - 5; Other Eukaryotes - 738 (source: NCBI BLink). 
AT5G66090AT5G66090.1TATGGCCCGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.